ID: 1173849918

View in Genome Browser
Species Human (GRCh38)
Location 20:46211315-46211337
Sequence TGACCTTCCAGGAGACTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173849915_1173849918 17 Left 1173849915 20:46211275-46211297 CCTCAGCTACATGGTGGGGGAGC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1173849918 20:46211315-46211337 TGACCTTCCAGGAGACTCACAGG 0: 1
1: 0
2: 1
3: 5
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173849918 Original CRISPR TGACCTTCCAGGAGACTCAC AGG Intronic
900365828 1:2311613-2311635 CGACCCTCCCGGAGACTCAAAGG + Intergenic
900621507 1:3589620-3589642 TGTCCTTGCAGGAGACACTCAGG - Intronic
900697969 1:4024072-4024094 TGTCCTTCCAGGAAACACAGAGG - Intergenic
900763250 1:4486918-4486940 CGGCCTTCCAGGAGCCTCCCAGG - Intergenic
900977922 1:6028656-6028678 TGACCTCCCAGCAGTCTTACAGG + Intronic
902549752 1:17212259-17212281 TGGCCTGCCAGGAGCCCCACAGG - Intronic
902615091 1:17619328-17619350 TGACTTTCCAGGTGACTCGGAGG + Exonic
906612260 1:47211832-47211854 TGCCTTCCTAGGAGACTCACTGG - Intergenic
907964124 1:59312758-59312780 TAACCTTCCAAGAGCCACACAGG - Intronic
911065775 1:93786620-93786642 TGGCCTTCCAGGAGTGTCTCTGG - Intronic
911178444 1:94840773-94840795 TGACCAGCCAGAAGACACACAGG + Intronic
916877509 1:168985430-168985452 TGACAGTCCAGTAGACTCAAAGG + Intergenic
921844527 1:219864275-219864297 TGACCCTCCAGCAGCCTAACTGG + Intronic
923117958 1:230961692-230961714 TAACCATCCAGGAAGCTCACTGG - Intronic
1070499237 10:77054878-77054900 TGTTCTACCAGGAGACGCACAGG + Intronic
1070828562 10:79405105-79405127 TGAACTTCCAGGGGACTCTGTGG + Intronic
1072923356 10:99595386-99595408 TGGCCTCCCAGGAGGATCACAGG + Intergenic
1073695413 10:105860997-105861019 TGAGCTTTCAGCAGTCTCACAGG + Intergenic
1074808516 10:117078819-117078841 TGACCTTCCAAAAGTCACACAGG - Intronic
1075068718 10:119306789-119306811 TCTCCCTCCAGGTGACTCACTGG + Intronic
1075287634 10:121201023-121201045 TGCCCTTCCAGGGGCCTCATTGG + Intergenic
1076782843 10:132733956-132733978 GGAGCTCCCAGGAGACTCGCAGG - Intronic
1077743831 11:4878854-4878876 TGATCTTCCTTGATACTCACTGG + Intronic
1081655233 11:44852860-44852882 TCACCTCCCAGGAGACTCTTGGG + Intronic
1084611429 11:70205599-70205621 TATCCTTGCAGGAGACACACAGG - Intronic
1087451536 11:98330196-98330218 TGACCCTCCAGCAGCCTAACTGG - Intergenic
1088366226 11:109042647-109042669 TTACCTTTCAGGAGACACAGCGG + Intergenic
1089875881 11:121722130-121722152 TGACCTTCCAGGAGGCCTAGTGG - Intergenic
1091202259 11:133790882-133790904 TGACCTCCCAGGAGGCTTCCAGG - Intergenic
1093958010 12:25244545-25244567 TGACCTTCAAGGTGTCTTACAGG + Intronic
1100905800 12:99297725-99297747 TCCCCTTCCAAGTGACTCACAGG + Intronic
1101962539 12:109260580-109260602 TGACCACCCAGGAGCCTCCCCGG - Exonic
1102841555 12:116130082-116130104 TGACTTTCCAGGAAACCAACAGG + Intronic
1104147867 12:126053228-126053250 TGACCATCCAGCCGAATCACTGG - Intergenic
1104408885 12:128541836-128541858 TCACCCTCCAGGAGAAACACTGG - Intronic
1104815454 12:131642985-131643007 TGCCCATCGAGGAGACTCAGGGG - Intergenic
1105410541 13:20168004-20168026 TCACCTTCCAGGTGACTGGCTGG - Intergenic
1108699972 13:52935364-52935386 TGAACTCCCAGGAAACTCTCTGG - Intergenic
1110586537 13:77199736-77199758 TGACCCTCCAGCAGCCTAACTGG + Intronic
1111365734 13:87242033-87242055 TTACTTTCCAGGAGACTCTTTGG + Intergenic
1112368318 13:98774043-98774065 TGTCCTTCCGGGAGACTCCTTGG - Intergenic
1116306431 14:43262770-43262792 TGACCCCCCAGCAGCCTCACTGG + Intergenic
1117583649 14:57178094-57178116 CCACCTTCCAGGAGCCTCCCAGG + Intergenic
1119424565 14:74527355-74527377 TTCCCTTCCAGGTGACTCTCAGG - Exonic
1119892496 14:78193442-78193464 TTACCCTCCAGCAGACTCCCTGG - Intergenic
1121917767 14:97851768-97851790 TGACCTCTCAGGAGACACAAAGG - Intergenic
1122827376 14:104376832-104376854 TGACCTCCCGGTAGCCTCACGGG - Intergenic
1125835385 15:42746056-42746078 TGAGCTTCGAGGAGAGGCACTGG + Exonic
1125958017 15:43804126-43804148 TGTCCTTACAGCAGACTCAGGGG - Intergenic
1129175834 15:73839130-73839152 TGCCCTTCCAGGCCACTCAGTGG - Intergenic
1130730488 15:86487131-86487153 TGACCTTCCAGAACTGTCACCGG + Intronic
1131287696 15:91075290-91075312 TGACCTTTCAAGAGAGGCACTGG - Intergenic
1131323492 15:91420659-91420681 TGCCCTGAAAGGAGACTCACAGG - Intergenic
1131585800 15:93691519-93691541 TTACCTTCAAGTAAACTCACTGG - Intergenic
1133668628 16:7995706-7995728 TAACCTCCCTGGAGACTCTCTGG + Intergenic
1134376897 16:13684993-13685015 TTACATTCCTGGGGACTCACTGG + Intergenic
1135748818 16:25039981-25040003 CGACCACCAAGGAGACTCACAGG - Intergenic
1140098690 16:71895970-71895992 TGACCTTCCCGAAGTCTCTCCGG - Intronic
1141534304 16:84668538-84668560 TGACCGTGCAGGAGCCTCAGGGG - Intergenic
1141744915 16:85919328-85919350 TAACCCTCCAGGAGACACCCAGG - Intronic
1141793061 16:86249745-86249767 TGACCTTCCATGACCCTCCCGGG + Intergenic
1146262718 17:31432214-31432236 CCACATCCCAGGAGACTCACTGG - Intronic
1148726786 17:49797987-49798009 TTCCCTTCCAGGAGATACACAGG - Intronic
1149698575 17:58636413-58636435 TTACCTCCTAGGAGGCTCACAGG - Intronic
1151218613 17:72594293-72594315 TGACATTCCCGGAGAGTCAGTGG + Intergenic
1151534374 17:74730433-74730455 TGACCTTCCAGGAGGCAAAGCGG + Intronic
1154124476 18:11677958-11677980 TAACACTCCAGGAGAGTCACAGG - Intergenic
1154216206 18:12418638-12418660 TGTCCTTGCAGGAGGCTCAGAGG + Intronic
1155536855 18:26827751-26827773 TGAGCCTCAAGGAGGCTCACAGG - Intergenic
1157466998 18:47955893-47955915 TGAACTTCCAGGAGCCACAGGGG - Intergenic
1159941451 18:74412019-74412041 TGCCCTTCCAGGAGGCTCACTGG - Intergenic
1164821191 19:31252334-31252356 TGTCCTTACAAGAGACACACGGG - Intergenic
1165826165 19:38707021-38707043 GGGCCATCCAGGAGACTCAGAGG - Intronic
1167339334 19:48905607-48905629 TGTCCTTCCTGGAGACTCTGAGG + Intronic
1168186468 19:54703346-54703368 AGACCTTCCAGGAGCCTGGCTGG - Intergenic
928009931 2:27597737-27597759 TGACCCTTCAGAAGACTCCCTGG - Intronic
931791222 2:65665924-65665946 TGAGCTTCCAGGAGACAAAATGG - Intergenic
932890927 2:75597066-75597088 TGAGTGACCAGGAGACTCACAGG + Intergenic
933324924 2:80823368-80823390 TTACATTCCAGGAGAATCACAGG + Intergenic
936165038 2:110114027-110114049 TGCTCTTCCAGGAGTTTCACTGG + Intronic
936379557 2:111972361-111972383 TGAGCTTCAGGGAGACTCTCAGG + Intronic
938434242 2:131272924-131272946 TGGCCTTCCCGGACACGCACAGG - Intronic
938434564 2:131274914-131274936 TGGCCTTCCCGGACACGCACAGG - Intronic
938601906 2:132850967-132850989 TCACCTGCAAGGAGTCTCACTGG - Intronic
939988615 2:148856030-148856052 TGACCTTGCAGGAAACTTGCAGG - Intergenic
940931015 2:159430994-159431016 AGCCCTTCCATGAGTCTCACAGG - Exonic
948345052 2:237288822-237288844 TGAACTTACAGGTGACTCAATGG + Intergenic
948570712 2:238915537-238915559 TCATCTTCCATGAGCCTCACAGG - Intergenic
1171429452 20:25071962-25071984 GGACTTTGCAGGAGACACACAGG - Intronic
1173849918 20:46211315-46211337 TGACCTTCCAGGAGACTCACAGG + Intronic
1176413555 21:6461773-6461795 TGTCCTCCCAGGAGACTCTTGGG - Intergenic
1177505488 21:22013629-22013651 TGACCATCCAGCAAAATCACTGG + Intergenic
1179463248 21:41552010-41552032 TCACCTCCCAGGTGACTCCCAGG + Intergenic
1181114131 22:20620709-20620731 TGACTTCCCAGGAGACCCTCTGG - Intergenic
1181732857 22:24860000-24860022 TGGCCTCCCAGGAAACTCAAAGG + Intronic
1182333876 22:29570331-29570353 TCTCCTTCCTGGAGCCTCACAGG + Intronic
1182702141 22:32249046-32249068 TGACCTTCCAGGGGTTCCACTGG - Intronic
1182883616 22:33754879-33754901 AGACCTTCCAGCACACTCTCTGG + Intronic
1183265693 22:36823906-36823928 AGACCTTCCTGGAGAGTCAGCGG - Intergenic
949319137 3:2789218-2789240 GGACCTTCCCAGAGACACACAGG - Intronic
949398968 3:3645677-3645699 TGACCTTCCATGAAACTAACGGG + Intergenic
950107697 3:10398689-10398711 TGGCCTCCCTGGAGACACACCGG + Intronic
950487118 3:13280473-13280495 TCCCCTCACAGGAGACTCACAGG - Intergenic
954541946 3:51399201-51399223 TGTCCTTCAAGGATACGCACAGG + Intronic
955378215 3:58415775-58415797 TGACCTTCCAGATGGCTTACAGG + Intronic
960573745 3:119209549-119209571 TGCCTTGCCAGGAGTCTCACAGG - Intergenic
964299131 3:155268468-155268490 TGCCCTTCCAAGAAAATCACAGG + Intergenic
967567303 3:190987685-190987707 GGAACTTCCAAGAGACTTACTGG + Intergenic
969129044 4:4977556-4977578 TGATTCACCAGGAGACTCACAGG - Intergenic
969971667 4:11054220-11054242 TGTCCTGTCAGGAGACTCAGTGG - Intergenic
970324976 4:14914038-14914060 TGCCCTTGTAGGAGACACACAGG - Intergenic
971304269 4:25466260-25466282 TGACCTCCAAGTAGAGTCACAGG - Intergenic
975099728 4:70499007-70499029 TGACGGTCCATGAGAATCACAGG + Intergenic
975642876 4:76517876-76517898 TGACCTCCCGGTAGCCTCACCGG + Intronic
975988614 4:80232634-80232656 TGAGCTTGCAGGGGACTTACAGG + Intergenic
980199952 4:129643366-129643388 GGAACTTTCAGGAGACTCAAGGG - Intergenic
983622413 4:169774838-169774860 GGGCCTTCCAGGAGACGCCCCGG - Intergenic
984649680 4:182257089-182257111 TGAGCTTGCAGCAGAATCACTGG + Intronic
985817543 5:2137773-2137795 TGCTCTTCCTGGAGACACACAGG + Intergenic
986424451 5:7616671-7616693 TGACATTCCAGTAGATTCTCTGG + Intronic
987993378 5:25244340-25244362 TTACCTTCCAGGTGAATGACAGG - Intergenic
990396952 5:55391887-55391909 TGACCTTCCAGATGGCTTACAGG - Intronic
990613567 5:57484209-57484231 TGACTCTCCAAGAGGCTCACTGG - Intergenic
991426546 5:66498358-66498380 TGACCTTCCAGGTGAGACATTGG - Intergenic
992050695 5:72937850-72937872 TGAGCTTACAGGAAAATCACTGG + Intergenic
994773872 5:104019325-104019347 TGACCTGCCAGGTGATTCTCTGG - Intergenic
997740138 5:136245986-136246008 TGGCCCTCCAGGAGACTATCTGG + Intronic
998971169 5:147594096-147594118 TAACATTCCAGGAGACTGCCTGG - Intronic
999814542 5:155163026-155163048 TGACCTTCGAGTAGCCTAACTGG - Intergenic
1005393214 6:25354918-25354940 TGACTGTCCAGGTGACTCTCAGG - Intronic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1007118092 6:39358170-39358192 TCACGTTCCAGGAGGCTTACAGG - Intronic
1007966960 6:46012241-46012263 TTAACTTTCAGGAGCCTCACTGG - Intronic
1011687120 6:89832389-89832411 TCTCCTTCCAGGAGAATCACTGG + Intronic
1013398496 6:109768190-109768212 TGTCCTTCCAGGGGCCTTACTGG - Intronic
1015139237 6:129910936-129910958 TTACCTTCCAGGACCCTGACTGG + Intergenic
1016080341 6:139847625-139847647 TGATTTTCCAGGAGACACAAAGG + Intergenic
1020349366 7:7201429-7201451 TGACCTCCCAGTAGCCTAACTGG - Intronic
1020638732 7:10729015-10729037 GGACCATCCAGCAGAATCACCGG - Intergenic
1022612897 7:31894997-31895019 TGACCTCCAAGGTGACTCCCAGG + Intronic
1024318094 7:48040134-48040156 GGACCACCCAGGAGACTCCCTGG - Intronic
1029257740 7:99280788-99280810 TAAGCTCCCAGGAGACTCAAGGG + Intergenic
1030526438 7:110660543-110660565 TGACCTCCGAGGAGCCTAACTGG - Intergenic
1031558039 7:123202609-123202631 TGACCATCCAGAAGTCTCAATGG - Intergenic
1032672501 7:134098228-134098250 TTACCTTCCAGCAAACCCACTGG - Intergenic
1033563723 7:142558690-142558712 TCTTCTTCCAGGAGACACACTGG - Intergenic
1033582267 7:142748958-142748980 TGACCTTCCTGCACACTGACTGG + Intergenic
1034968009 7:155403464-155403486 GGACCCTCCAGGACACTGACAGG + Intergenic
1035238870 7:157517361-157517383 TCACCTTCCAGGAAACCCCCAGG - Intergenic
1040287056 8:46105802-46105824 GGACCTTCCACGAGAGGCACAGG + Intergenic
1040288199 8:46111075-46111097 GGGCCTTCCGGGAGACACACAGG + Intergenic
1040299501 8:46180565-46180587 GGACCCTCCAAGAGAGTCACAGG + Intergenic
1040299577 8:46180914-46180936 GGTCCTTCCAAGAGAGTCACAGG + Intergenic
1040302713 8:46196226-46196248 GGATCTTCCACGAGAGTCACAGG - Intergenic
1040317615 8:46273222-46273244 TGTCCTTCCACGAGAGACACAGG - Intergenic
1040324951 8:46337011-46337033 GGGCCTTCCAGGAGAAACACAGG - Intergenic
1040325889 8:46341322-46341344 GGGCCTTCCGGGAGAGTCACAGG - Intergenic
1040329174 8:46377220-46377242 TGGCCTTCCATAAGACACACAGG - Intergenic
1040335340 8:46413161-46413183 TGGCCTTCCAGGAGAGACACAGG - Intergenic
1041259969 8:56012919-56012941 TGAACCTAAAGGAGACTCACAGG + Intergenic
1041305047 8:56448998-56449020 TGACATTTCAGGAGTCTCAGGGG - Intergenic
1048008719 8:130439841-130439863 GGACCTCCGAGGAGACTTACAGG - Intronic
1055801755 9:80045046-80045068 TGTTCTCCCAGGACACTCACTGG + Intergenic
1055877096 9:80956223-80956245 TGTCCTTACAAGAGACACACAGG + Intergenic
1059682383 9:116598363-116598385 TAACTTGCCAGGAGACTCAGGGG + Intronic
1060202119 9:121657323-121657345 TGACATTCCAGCAGATTCACTGG - Intronic
1060268484 9:122125926-122125948 AGAGCTTCCTGGTGACTCACCGG + Intergenic
1060965959 9:127712456-127712478 AGACTTTCCAGGAGTCTCTCAGG - Intronic
1062578412 9:137219076-137219098 TGACCTTCAGGGACACACACTGG - Intergenic
1186474788 X:9849027-9849049 GTGCCTTCCAGGAGACCCACGGG - Intronic
1186986486 X:15020216-15020238 TGATCTTCCAAGAGAACCACAGG - Intergenic
1187852593 X:23606039-23606061 TGAGTTTCCAGGAGACTCCTTGG + Intergenic
1187857454 X:23651122-23651144 TGACCTTCGAGTAGCCTAACTGG - Intergenic
1196044318 X:111241217-111241239 TGACATTCCAGGATTCTCTCTGG - Intergenic
1196504284 X:116422908-116422930 TGGGATTCCAGGAGATTCACAGG + Intergenic
1201741955 Y:17333486-17333508 TGGGCTTCCAGCAGACCCACAGG - Intergenic