ID: 1173850354

View in Genome Browser
Species Human (GRCh38)
Location 20:46214042-46214064
Sequence ACATTTCTGCAAAAGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173850353_1173850354 -7 Left 1173850353 20:46214026-46214048 CCTTGCAGAGAAGATGACATTTC 0: 1
1: 0
2: 2
3: 58
4: 349
Right 1173850354 20:46214042-46214064 ACATTTCTGCAAAAGTCAGAAGG 0: 1
1: 0
2: 2
3: 27
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173850354 Original CRISPR ACATTTCTGCAAAAGTCAGA AGG Intronic
900002763 1:23941-23963 ACATTTATGGTAAAGTCTGAGGG - Intergenic
900022484 1:194466-194488 ACATTTATGGTAAAGTCTGAGGG - Intergenic
903074695 1:20754534-20754556 ACATTCCTGAAAAAGTTAGAGGG + Intronic
905185501 1:36193279-36193301 ACATGTGTGCCAAAGTCAGTTGG + Intergenic
905871618 1:41407638-41407660 TCATTTCTGAAAAAGGGAGAGGG - Intergenic
908945659 1:69493223-69493245 ACATTTATCCAAATGTCAGAGGG + Intergenic
909050077 1:70755796-70755818 AAAGTACAGCAAAAGTCAGATGG - Intergenic
910140839 1:84025995-84026017 ACATATCTTCAAAATTCAAAGGG + Intergenic
910951207 1:92650200-92650222 GCATTTCTGCAAAAGTCCATGGG + Intronic
911735489 1:101332166-101332188 TGATTTCTGCAGAAGACAGAAGG + Intergenic
913313276 1:117525594-117525616 ACATTTGTGCCAAAGGCACAAGG - Exonic
916270336 1:162934523-162934545 ACATATCTGGAAAAGTTAAAGGG + Intergenic
916461391 1:165028538-165028560 AGATTTTGGCAAAAGTCAAAGGG + Intergenic
916611296 1:166394320-166394342 ACTCTTCTGGAAAAGTCAGGGGG + Intergenic
918911262 1:190573645-190573667 ACATTTCTTTAAAGGACAGAGGG + Intergenic
919531967 1:198733057-198733079 ACATTTCTGCATAAATCCAATGG - Intronic
921560717 1:216655001-216655023 AAATCTCTTCAAAAGGCAGAAGG + Intronic
921700599 1:218264772-218264794 ACAACTCTGCACAAGTCACAAGG - Intergenic
922018901 1:221684052-221684074 ATATTTCTCCAAAAATCAGCAGG + Intergenic
922842775 1:228657563-228657585 ACAGTTCTACAAAAGACAAATGG + Intergenic
923883360 1:238128431-238128453 ACTTTTCTGCAAAAGCAGGAAGG - Intergenic
1063599705 10:7469214-7469236 AGACCTCTGCAAAAGCCAGATGG + Intergenic
1063630652 10:7730844-7730866 AAATTTTTACAAAAGTCAGCTGG - Intronic
1064396334 10:14984916-14984938 ACATTACTGCTAATGTCACAGGG + Intronic
1065428957 10:25634048-25634070 AGATTTCTGCAAATCTCAGAGGG - Intergenic
1065448256 10:25825097-25825119 ATATTTATTCAAAAGTGAGAGGG - Intergenic
1065982451 10:30913466-30913488 ACATTTAAGCAAAAATCTGATGG - Intronic
1066233905 10:33467186-33467208 ACATTTCTTTTAGAGTCAGAGGG + Intergenic
1067414704 10:46094494-46094516 TCATTTCTGCAATAGTCATGGGG + Intergenic
1067434761 10:46269072-46269094 TCATTTCTGCAGTAGTCATAGGG + Intergenic
1068928380 10:62563524-62563546 GCATTTCAGAAAAAGTCACAGGG - Intronic
1069069470 10:63978465-63978487 ACACTTCTGTTACAGTCAGAGGG + Intergenic
1069167283 10:65177646-65177668 AGACTTCTTCAAAGGTCAGATGG + Intergenic
1070053362 10:72910765-72910787 ACTTTTCTCCAAAGGTCAGATGG + Intronic
1071139515 10:82491548-82491570 AAATTTCTGCAAAGTTAAGATGG - Intronic
1071839776 10:89457797-89457819 ATATTTTTGAAAAAGTCACAGGG - Intronic
1074256971 10:111812480-111812502 ACTTTTCTTGAAAAATCAGAAGG - Intergenic
1074304956 10:112268441-112268463 ACATTTAAGCAAAAGTCAGGAGG + Intergenic
1074928261 10:118095718-118095740 GCATTTCTGCAATAGTAAGAAGG + Intergenic
1077605460 11:3607780-3607802 ACATTTCAGCAAGAGACAGATGG + Intergenic
1078847005 11:15127422-15127444 AGATTTCTTGAAAAGTCAGAGGG + Intronic
1078978972 11:16509802-16509824 CCATTTATGCAAAAGTAAAATGG + Intronic
1079027751 11:16962127-16962149 TCATTTCTGCCAAAGCCACAGGG - Intronic
1079797070 11:24817901-24817923 ACATATTTGCAAAAATCAGCTGG - Intronic
1083763621 11:64831975-64831997 ACATTTCTGCTGAAGCCTGAGGG + Intronic
1084472725 11:69372616-69372638 ACATTTCTGTAAGTGGCAGATGG - Intergenic
1084658347 11:70532401-70532423 ACCTTTGTGCAAATGTGAGAAGG - Intronic
1085160804 11:74342304-74342326 ACAATTCTGGAACAGCCAGATGG - Intronic
1086013034 11:82128649-82128671 ACATTTCTGTAAAATTGACAGGG + Intergenic
1086746008 11:90427648-90427670 AAAATTCTGGAAAAGTCGGAGGG + Intergenic
1089141317 11:116286930-116286952 ACAGTTGTGTAAAAGTGAGAAGG + Intergenic
1090231108 11:125104404-125104426 ACATTTAAGCAGAAATCAGAAGG - Intronic
1091120581 11:133054294-133054316 AAACTTCTTAAAAAGTCAGATGG + Intronic
1091376182 12:26004-26026 ACATTTATGGTAAAGTCTGAGGG - Intergenic
1092164553 12:6335052-6335074 AGCTTTCTGAAAAAGTCAGCTGG + Intronic
1095455758 12:42384138-42384160 ACATTATTGCAAAAGTAAGATGG + Intronic
1096014949 12:48262114-48262136 ATGTTTCTGCAAAAGACATAGGG + Intergenic
1097392077 12:59027071-59027093 ATAGTTGTTCAAAAGTCAGACGG - Intergenic
1097547297 12:61020437-61020459 ACATTCTTGCAGAAGTAAGATGG + Intergenic
1099019797 12:77389363-77389385 ACATTTCTTCAACTGTGAGATGG - Intergenic
1100652780 12:96608868-96608890 AATTTTCAGCAAAAGTAAGAAGG + Intronic
1101161144 12:101977611-101977633 ACAGTTCTGCAAACCTCAGAGGG - Intronic
1101924244 12:108957917-108957939 TCTTTTCTGCAAAAGTCTCACGG - Intronic
1102536994 12:113589082-113589104 CCATTTCTTCAAATGTCAAATGG - Intergenic
1103581101 12:121916194-121916216 ACATTGGTGAAAAGGTCAGAAGG + Intronic
1105005667 12:132719108-132719130 ACATGCCTGAAACAGTCAGAAGG + Intronic
1105288934 13:19033815-19033837 AGGTTTCTGGAAAAGTCACATGG - Intergenic
1105992127 13:25632572-25632594 ACATTAGAGCAAAAGTCAGGGGG - Intronic
1106499954 13:30318335-30318357 ACATTTCTGGAAAAAGCAGATGG - Intergenic
1109263384 13:60169284-60169306 ATATTTCTGCTGTAGTCAGATGG - Intergenic
1109550184 13:63885239-63885261 AACTTTCTTCAAATGTCAGATGG + Intergenic
1109840674 13:67913893-67913915 ACATTACTGCTAATGTCACAGGG - Intergenic
1110078277 13:71277767-71277789 ACACTTCTGCAGAAGTTAAAAGG - Intergenic
1110104372 13:71652683-71652705 AGATATCTGCAAAATTTAGAAGG - Intronic
1111221141 13:85206968-85206990 ACATTTCTGAAAGAGTAATATGG + Intergenic
1111430332 13:88141397-88141419 ACATTTATTCAAAAGTTACAAGG - Intergenic
1111555940 13:89881735-89881757 ACATCACTGCTAAAGTCACAGGG - Intergenic
1111646998 13:91043765-91043787 AGATTTCTTCTAATGTCAGATGG + Intergenic
1112079250 13:95950244-95950266 ACACCTCTACAAAAGCCAGAAGG + Intronic
1112325996 13:98443214-98443236 ACTTTTCCTCAAAAGGCAGACGG - Intronic
1112983899 13:105422656-105422678 GCATTTCTGCAGGAGTGAGATGG - Intergenic
1114377739 14:22166900-22166922 ACATTTATGCAGAACTCAGCAGG - Intergenic
1114937396 14:27558142-27558164 ACATATATGCAAATATCAGATGG - Intergenic
1116936470 14:50745617-50745639 ACAAATCTGAACAAGTCAGAAGG + Intronic
1120096061 14:80389066-80389088 GCAATTCTGCAAATGTCACAAGG - Intergenic
1120238116 14:81916634-81916656 ACATATATGCCAAAGTCAGTGGG + Intergenic
1121427178 14:93860594-93860616 GCATTTCAGCAAGGGTCAGAAGG + Intergenic
1121969950 14:98346867-98346889 ACACTATTGCAAAAGTCAGGAGG - Intergenic
1122013654 14:98774597-98774619 ACATTTCTGGATTATTCAGATGG + Intergenic
1124216400 15:27810824-27810846 CCATTTTTGCAAGAGTAAGATGG - Intronic
1125402873 15:39322587-39322609 ACATTTTTGTAAATGTCAAATGG + Intergenic
1127084322 15:55410777-55410799 ACTTTTCTGCGCAAGTCACAGGG + Intronic
1127713708 15:61626654-61626676 ACCTTTCTGCAAAAGTAAGAAGG + Intergenic
1127989989 15:64106870-64106892 ACAGTTCTGAAAAAGTCCAATGG - Intronic
1128414636 15:67433719-67433741 ACATTTCTGCAGGACTCAGGAGG + Intronic
1131780594 15:95853409-95853431 ATATTTCTGTAATAGTCTGATGG - Intergenic
1132450748 15:101966998-101967020 ACATTTATGGTAAAGTCTGAGGG + Intergenic
1138245585 16:55464683-55464705 AGAGCTCTGCAAAAGTGAGATGG - Intronic
1139004015 16:62549177-62549199 ACATTTTTGCAAAATTCTGCAGG + Intergenic
1139549214 16:67664141-67664163 ACATGGATGCAAAGGTCAGAAGG - Intronic
1140289563 16:73640067-73640089 TCATTTCTTCAGAAGACAGAAGG + Intergenic
1142841197 17:2631881-2631903 ACATTTTTTAAAAAATCAGAAGG - Intronic
1145717804 17:27039343-27039365 AGGTTTCTGGAAAAGTCACATGG - Intergenic
1146377825 17:32306487-32306509 ACCTTTCAGGAAAAGGCAGAGGG - Intronic
1146692165 17:34884003-34884025 ATATTTCAGCAAAAGTCATCTGG - Intergenic
1146949767 17:36897791-36897813 CCATCTCTACAAAAGTTAGATGG + Intergenic
1149012170 17:51868533-51868555 ACATATCAACAAAAGTCAGGTGG - Intronic
1149052245 17:52319585-52319607 ACATTTATGCAAAAATCATGTGG - Intergenic
1150570246 17:66379389-66379411 ACATTTCTCCAAAACACATATGG - Intronic
1150985919 17:70197074-70197096 TCATGGCTGCATAAGTCAGAGGG - Intergenic
1151021822 17:70625603-70625625 ACATACCTGAAAAAGTCTGATGG + Intergenic
1152002782 17:77656792-77656814 ATTTTTCTGCAATAGTCAAATGG - Intergenic
1152582858 17:81175404-81175426 CTATTTCTGCAAAAGTCACTGGG - Intergenic
1153409792 18:4780930-4780952 AAATCTCTCCAAAAGCCAGATGG + Intergenic
1154470784 18:14698813-14698835 AGGTTTCTGGAAAAGTCACATGG + Intergenic
1156623884 18:38885323-38885345 ACAGTTGTGCATGAGTCAGATGG + Intergenic
1157059394 18:44269876-44269898 CCAGTTATGCAAAAGTCAGAGGG - Intergenic
1157201965 18:45667357-45667379 ACCTGTCTGCAATATTCAGATGG - Intronic
1157298910 18:46465656-46465678 ACATTTGTCCTAAATTCAGAAGG - Intergenic
1160634514 19:65549-65571 ACATTTATGGTAAAGTCTGAGGG - Intergenic
1161061008 19:2214884-2214906 TCATTTCTGTAACAGTCATAGGG + Intronic
1162894594 19:13757727-13757749 ACCCATCTGCAAAATTCAGATGG + Intronic
1163170293 19:15526458-15526480 ACATATCTGCAAAATTAAAAAGG - Intronic
1163874475 19:19855856-19855878 ACATTTCTACAAACTTCACAGGG - Intergenic
1163918698 19:20267031-20267053 ACATTTCTACAAACTTCACAGGG - Intergenic
1163930305 19:20383900-20383922 ACATTTCTACAAACTTCACAGGG + Intergenic
1163936027 19:20444650-20444672 ACATTTCTACAAACTTCACAGGG + Intergenic
1165240304 19:34461495-34461517 ACATTTTTTTAAAAGTCAGCTGG - Intronic
925629036 2:5869924-5869946 GTATTTCTGCAACACTCAGATGG - Intergenic
925674687 2:6349600-6349622 ACAGTTTTGAAAAAGCCAGAAGG + Intergenic
926181651 2:10649781-10649803 ACAGTGCTGCAAAAGCCACATGG + Intronic
926659403 2:15446740-15446762 ACAATAGTGCAAAAGCCAGAAGG + Intronic
926772104 2:16387499-16387521 ACGTTTCTGCATAAGTCAGTTGG + Intergenic
926884059 2:17580559-17580581 AGACTTTTGCAAAAGTCACACGG - Intronic
928982456 2:37150831-37150853 TGATTTCTGCAAAATTCAGAGGG - Intronic
929585564 2:43112098-43112120 AAGTTTCTGCAAAAGTCAGAGGG + Intergenic
929659365 2:43768760-43768782 TCATTTCTGCATAAATCAGGTGG - Intergenic
931618508 2:64186518-64186540 ACATTTCTACTAAAGGCAGGTGG - Intergenic
932348567 2:71012731-71012753 ATATTACTTCTAAAGTCAGAGGG - Intergenic
932730207 2:74215170-74215192 AAATTTCTGGAAAAGTCAACAGG - Exonic
933460620 2:82578992-82579014 ACATTTTTTCATAAGTCAGCTGG + Intergenic
933486256 2:82927923-82927945 AAATTTCTGCAAAAATCTAAAGG - Intergenic
935232292 2:101109417-101109439 ACATGTCTGCAAATTTCAAACGG + Intronic
935346140 2:102110315-102110337 ACACTTCTGCAAAATTACGAGGG - Intronic
936067095 2:109340530-109340552 GCACTGCAGCAAAAGTCAGATGG - Intronic
936566961 2:113589478-113589500 ACATTTATGGTAAAGTCTGAGGG + Intergenic
938233546 2:129682120-129682142 ACATTTATTCAAAAGTCAAGTGG + Intergenic
939597438 2:144143773-144143795 ACATGTGTTCATAAGTCAGAGGG + Intronic
939597495 2:144144868-144144890 ACATAACTGCAACAGTCAAACGG - Intronic
940377254 2:152970093-152970115 ACATATTGGCTAAAGTCAGAAGG - Intergenic
940619546 2:156093853-156093875 ACATTTGTGCAGAAATCTGAAGG - Intergenic
941101550 2:161301743-161301765 ACATTTCTTAAAAATTCAAATGG + Intergenic
941756018 2:169186927-169186949 ACATTTATACAAAAATCATAGGG - Intronic
942459901 2:176161473-176161495 ACTTTACTGCCAAAGTAAGATGG + Intronic
943185558 2:184602388-184602410 ACATTTCTGGATAAGTTATAGGG + Intronic
943276992 2:185880316-185880338 AAATTTCTGAAAAAGTAAAAGGG + Intergenic
943867483 2:192945442-192945464 ACATCTTTCCAAAAGACAGATGG + Intergenic
943934538 2:193898813-193898835 ACAATTATGCAAAAATCACAAGG - Intergenic
944019494 2:195084848-195084870 AGATTTCTGCAACAGTCAAATGG + Intergenic
944023519 2:195135975-195135997 TCATTTCTTCAAAACTCAGCAGG + Intergenic
944611600 2:201414357-201414379 ACATCTCTTTAAAAGTGAGAGGG - Intronic
945102791 2:206277360-206277382 ACATTTCTGCCTAAGTCATCTGG + Intronic
945944655 2:215983220-215983242 CCACTTCTGGAAAAATCAGATGG + Intronic
946147514 2:217742138-217742160 ACATTTCTGGAAAAGGAGGATGG - Intronic
946176383 2:217924239-217924261 ACATTTAAGCCAAAGCCAGAAGG - Intronic
946650495 2:221888089-221888111 ACATTTTTCCAAAAGTCAAGAGG + Intergenic
947139523 2:227008375-227008397 ACGTATCTGCAAAGGCCAGATGG - Intronic
1170773624 20:19356351-19356373 ACATTTGTGGAAAAGGCATAAGG - Intronic
1172397748 20:34621485-34621507 ACAGTGCTGCAACAGTCAGTAGG + Intronic
1173850354 20:46214042-46214064 ACATTTCTGCAAAAGTCAGAAGG + Intronic
1173922330 20:46755650-46755672 ACATTTGAGCAGAGGTCAGAAGG - Intergenic
1174582864 20:51584965-51584987 ACTTATCTCCAAAGGTCAGAGGG + Intergenic
1176803699 21:13459115-13459137 AGGTTTCTGGAAAAGTCACATGG - Intergenic
1179421881 21:41242851-41242873 CCACGTCTGCAAAGGTCAGATGG - Intronic
1179564889 21:42241106-42241128 ACGTGTCTGTGAAAGTCAGAAGG - Intronic
1182168159 22:28197454-28197476 ACAGTTCTTCAAAAACCAGATGG + Intronic
1182835067 22:33335145-33335167 ACATTTTTGCAAACGTTAAATGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
952060519 3:29503356-29503378 ACATTTCCGTAAAGGACAGAAGG - Intronic
952362547 3:32645453-32645475 CCATTTCTGCAAAAATTAGCTGG + Intergenic
956009424 3:64814708-64814730 ACATTTGTGACAAAGGCAGAAGG - Intergenic
956304414 3:67808374-67808396 TCCTTTCTGCAAAACTCAGGAGG - Intergenic
956878493 3:73487781-73487803 AAATTGCTGGAAAGGTCAGATGG - Intronic
958939699 3:100297406-100297428 ACAATGCTGTATAAGTCAGATGG + Intronic
959531188 3:107435382-107435404 ATATTTATGCAAAATTCAAAAGG + Intergenic
959829353 3:110841961-110841983 CCATTTAAGCAGAAGTCAGATGG + Intergenic
961671949 3:128539076-128539098 ACATTTCAGCTAAAGGCAAAAGG - Intergenic
966298206 3:178448636-178448658 AAATTTCTTTACAAGTCAGATGG - Intronic
966507723 3:180725855-180725877 ATATTTCTCCAAAAGACAAAGGG + Intronic
967081822 3:186056828-186056850 ACACTTCTGCAAAATTTAGGGGG - Intronic
967150536 3:186645107-186645129 GCATTTCTACAAGAGTCAGGCGG + Intronic
967273047 3:187746443-187746465 ACACTTCAGCAAAAGTCCAAGGG - Intergenic
970082749 4:12306573-12306595 ACACTTCTGCAAAAACCTGAGGG - Intergenic
970152370 4:13102988-13103010 ACATTTCCTCATAAATCAGAGGG + Intergenic
970644361 4:18103142-18103164 ATATTTCTGGAAATGTCAAATGG + Intergenic
970861715 4:20711696-20711718 TCATTTCGAAAAAAGTCAGATGG + Intronic
971067032 4:23044862-23044884 TCATTTCTCCAATATTCAGATGG - Intergenic
971989643 4:33875578-33875600 ATATGTCTGCTAAACTCAGATGG - Intergenic
973258480 4:48136993-48137015 AGATTTCTGTAGAAGTCAAAGGG + Exonic
974441025 4:61917725-61917747 ATATTTGAGCAAAACTCAGAAGG + Intronic
974563992 4:63560008-63560030 ACAATTTTGGAAAAGTTAGATGG - Intergenic
976088669 4:81432260-81432282 TCATTGCTGCACAAGTCTGAAGG - Intronic
976323915 4:83749606-83749628 ACCTTTCTGAAAAAATTAGAGGG - Intergenic
976730582 4:88256980-88257002 ACATTTCTGTAAAAGACACCAGG - Intergenic
976796107 4:88934867-88934889 ATATTTCTCCAAATGTCACAGGG + Intronic
978569413 4:110120059-110120081 ACATTCCTTTGAAAGTCAGAAGG + Intronic
979853124 4:125598353-125598375 AAATTTCTTCAAAAGTCAGTAGG - Intergenic
980601164 4:135027419-135027441 ACATCCCTGCAAAAGGTAGATGG - Intergenic
980776408 4:137442373-137442395 TTATTGCTGCGAAAGTCAGAGGG + Intergenic
982023174 4:151224463-151224485 ATATTTTTGAAAAAGTCTGAAGG - Intronic
982150085 4:152444555-152444577 ACATTTCACCATAAGTCAGAAGG + Intronic
983113047 4:163777409-163777431 AAATATCTGCAAAAGTCACAAGG - Intronic
983258944 4:165434028-165434050 ACATTTAAGCTAAAGACAGAAGG - Intronic
983388661 4:167101186-167101208 ACAGTTCTTGAGAAGTCAGATGG - Intronic
984840940 4:184066663-184066685 ACAATTCTGAGAAAATCAGAGGG - Intergenic
985289049 4:188368375-188368397 ATATTTCTGCAAATGGAAGATGG + Intergenic
986952042 5:13100618-13100640 TCATTTCTCCAAAAGTCTCAGGG + Intergenic
987792525 5:22586530-22586552 ATATTTCTGCAAAAGAGATATGG + Intronic
989427581 5:41314588-41314610 ACATTTGTGCAAAGGTTTGAAGG + Intronic
990216012 5:53532491-53532513 ACATTTCTGCAAATGTGTAAAGG + Intergenic
990915887 5:60905570-60905592 AACTTTCTTTAAAAGTCAGATGG + Intronic
993136783 5:83978459-83978481 ACATTTCTCCAAAATTCTGAAGG - Intronic
993138426 5:83999044-83999066 ACAAGTCTGCAAGAGTCACAGGG + Intronic
993203848 5:84853018-84853040 ACATTTTTGTAAAATTTAGATGG + Intergenic
993553168 5:89301229-89301251 ACATATCTGCAAATTTCATATGG + Intergenic
993935811 5:94000816-94000838 TAATTTCTGCAAAAGGCATAAGG + Intronic
994168771 5:96636793-96636815 ACACTTCTGCAAATGTCGTAAGG - Intronic
995421482 5:111972581-111972603 ATATTTGTGCACAAGTCAAAGGG + Intronic
995602357 5:113811588-113811610 CCATTTCTGCAAATCTCAGCAGG - Intergenic
996219724 5:120915853-120915875 ACCTTTAAGAAAAAGTCAGATGG + Intergenic
996975148 5:129423824-129423846 AGACTTCTGCAAATGGCAGATGG - Intergenic
996988186 5:129594082-129594104 ACATTCCTGTTAAACTCAGAAGG + Intronic
997093138 5:130879675-130879697 ACATTTGAGCAAAAGCCTGAAGG + Intergenic
997111854 5:131083648-131083670 ACATTTCTAAAAAAGTGGGAAGG - Intergenic
997327414 5:133033476-133033498 ACACTTCTGGAAAACTGAGATGG - Intergenic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
1000783659 5:165515396-165515418 AAATTTCTTCAAAAGACAGCAGG + Intergenic
1002187969 5:177463726-177463748 ACATTTCAGGTAAAGTCTGAAGG - Intronic
1003636206 6:7833706-7833728 ACTGTTCTGAAAAATTCAGATGG + Intronic
1005472288 6:26172943-26172965 TAATTTCTTCTAAAGTCAGAAGG + Intergenic
1005568389 6:27120139-27120161 ACATTTCTCCCAAACTCAGAAGG - Intergenic
1007019264 6:38503239-38503261 TCATTTCTGCAGAAGGCAGCGGG - Intronic
1009484605 6:64204394-64204416 ACATTTCTGGAAAAGTCTTTTGG - Intronic
1009992672 6:70863356-70863378 ACTTTTCTCCAAAAGGCAGCAGG - Intronic
1010150651 6:72728049-72728071 ACTTGTCAGCAAAAGTCACATGG + Intronic
1011487592 6:87858795-87858817 ATATTTCTGCACAAGAAAGAGGG - Intergenic
1011981865 6:93388304-93388326 ACATCTTTTCAAAAGTCAAAAGG + Intronic
1012508653 6:99977623-99977645 ACATTTCTTTTAAATTCAGAAGG - Intronic
1012587428 6:100940955-100940977 ACATTTCTGCATATGTCTGTTGG + Intergenic
1014261702 6:119225814-119225836 ACTTTTCTTCAAAAGTGAAAGGG + Intronic
1015156848 6:130106321-130106343 ACTTTTCTGCAAAAATGAGTGGG + Intronic
1015408007 6:132858765-132858787 ACATTCCTACAAAAGTAAAAAGG - Intergenic
1015479862 6:133696830-133696852 AAATTTCAGCAAAAGTTTGAGGG - Intergenic
1015760321 6:136652503-136652525 CCATTTCTGCAAAGTTTAGATGG - Intronic
1016546982 6:145235006-145235028 ATATTTCTGAAAAACTCACAAGG + Intergenic
1016624252 6:146147023-146147045 AAATTTTTGAAAAAGTCAGATGG - Intronic
1017301167 6:152860098-152860120 ACTTTTATGCAAAATTCATATGG + Intergenic
1019141084 6:169943694-169943716 ACATTTCTCCAATATTCAGTGGG - Intergenic
1019451253 7:1099736-1099758 ACATCTGTGCACAGGTCAGACGG - Intronic
1020483127 7:8687077-8687099 ACATATCTGCTGAAGTCAAAAGG - Intronic
1020493148 7:8814336-8814358 AAATTTCTGCAAATGTTACAAGG - Intergenic
1020934873 7:14450455-14450477 AGATTTCTGCCAAACTAAGAGGG + Intronic
1021067933 7:16199256-16199278 TCACTTCTGCAAAACTCAGAAGG + Intronic
1021075793 7:16302971-16302993 ATATTGCTGTAAAAGTTAGATGG + Intronic
1021108931 7:16671987-16672009 ACATTTCTTCAAAATTCTTATGG - Intronic
1022437466 7:30403350-30403372 ATATTTCTGAAGCAGTCAGAGGG - Intronic
1022618971 7:31963096-31963118 ACATTTTTTTAAAAGCCAGATGG + Intronic
1022977208 7:35569704-35569726 ACATGTCTGCAGAAGTGAGGTGG + Intergenic
1023391143 7:39712972-39712994 ACATATCTGCCAAAGAGAGAAGG + Intergenic
1024499293 7:50085835-50085857 ACATTCCTGAAAAAGTTAGCAGG + Intronic
1024522361 7:50316601-50316623 AAATGACTGCAAAAGTAAGAAGG + Intronic
1024662117 7:51507004-51507026 ACATTTATACAAAAGTTAGCTGG - Intergenic
1024996441 7:55276221-55276243 AAATTACTGCAAAACTCAGAAGG - Intergenic
1026732964 7:72927217-72927239 ACATTTCTACAAAAGTATGAGGG - Intronic
1027530966 7:79332119-79332141 ACATTTCTGAGAAATTCAGTGGG - Intronic
1027720019 7:81728954-81728976 GCCTGTCTGCAAAAGTCAAATGG + Intronic
1027786680 7:82588867-82588889 AATTTTCTGGAAAAGTCAAAAGG + Intergenic
1028432351 7:90762133-90762155 ACATTTATGCATAGGTCTGAAGG + Intronic
1028620566 7:92822751-92822773 ACAATTCTGCAAAAATAAAATGG - Intronic
1030235348 7:107253869-107253891 ACATTTTGGCAAAAATCTGAAGG - Intronic
1030873222 7:114782846-114782868 ACATTACTGCAAAAGTCTTGGGG - Intergenic
1030950484 7:115785158-115785180 GTATTTCTACAAAAGGCAGAGGG + Intergenic
1032332693 7:130994676-130994698 ACATTTCTGCCAAGCCCAGAGGG - Intergenic
1033040877 7:137917075-137917097 CCATTTCAGCAAAGGGCAGATGG - Intronic
1034148732 7:148896461-148896483 ACATTTATGTAAATGTAAGAAGG + Intergenic
1037168651 8:15862595-15862617 TCATCTCTGAAAAATTCAGAAGG - Intergenic
1037223765 8:16557718-16557740 TCATTTCACCAAAAGTCACAAGG + Intronic
1037433539 8:18839580-18839602 ACACTTCTGCAAATGTAAGCAGG + Intronic
1040909751 8:52505852-52505874 ACATTACTGGTAAAGTCACATGG + Intergenic
1043658607 8:82705635-82705657 ACATTTATAAATAAGTCAGAGGG - Intergenic
1044715108 8:95092920-95092942 CTATTTCTGCAAAAGTAAAATGG - Intronic
1045407648 8:101882705-101882727 TCTTGTTTGCAAAAGTCAGAGGG - Intronic
1045479033 8:102577936-102577958 ATACTTCTGAAAAAGCCAGAAGG - Intergenic
1045528913 8:102965479-102965501 ACATTTAAGGAAAAGTGAGAAGG - Intronic
1045778885 8:105840161-105840183 TCATTTCTGCTAAAGTCACAAGG + Intergenic
1046205313 8:110986699-110986721 ACATTTGTGAAAAAGTGAAATGG - Intergenic
1046992977 8:120481584-120481606 AAATTTCTTCAAAAGGCAGAAGG + Intronic
1047067843 8:121306450-121306472 CTGTTTCTGCAAAAGTAAGAGGG - Intergenic
1047470135 8:125162927-125162949 AGATTTATGCAAAATTCTGAGGG - Intronic
1047571982 8:126109078-126109100 ACATTTGTGTAAAAGTCTCAGGG - Intergenic
1048634601 8:136282431-136282453 TCACTTCTGCTAAAGTCATATGG + Intergenic
1048746767 8:137623273-137623295 ACATTTGTGCAAAAGTCGTATGG + Intergenic
1048796074 8:138151417-138151439 AGGTCTCTGCAGAAGTCAGATGG + Exonic
1049079655 8:140431916-140431938 ACTTTTCTTCCAATGTCAGAAGG - Intronic
1049885568 9:24054-24076 ACATTTATGGTAAAGTCTGAGGG - Intergenic
1049891796 9:76318-76340 ACAATTCTTCAAAAGTAAGGGGG + Intergenic
1050196491 9:3089561-3089583 CCCTTTCTGCAAGAGTCAGTTGG + Intergenic
1050439694 9:5648798-5648820 ACATTTTTTCAAAAGACATATGG - Intronic
1051245045 9:15101464-15101486 ACCTTTCTGCCAAAATCACATGG + Intergenic
1051277440 9:15410434-15410456 CCATTCCTGCAAAAGTAAGGTGG + Intergenic
1052345654 9:27407217-27407239 ACATTTTTTCTAAACTCAGATGG - Intronic
1055158997 9:73101229-73101251 CATTTTCTACAAAAGTCAGAGGG + Intergenic
1055739324 9:79368640-79368662 ACATTTTGACAATAGTCAGAAGG - Intergenic
1055927746 9:81527818-81527840 ACATTTGTGCAGCAGTAAGATGG - Intergenic
1058117246 9:101098391-101098413 GCACTTCTGCAACATTCAGAAGG + Intronic
1058785565 9:108383221-108383243 TCATTTCAGAAAAAGGCAGAGGG - Intergenic
1060017996 9:120104075-120104097 AGGTTTATGCAAAAGTCTGAAGG + Intergenic
1060452929 9:123760583-123760605 ACATTTCTATAAAAGTTATAGGG + Intronic
1060462861 9:123875142-123875164 CCATTTCTATAAAATTCAGAAGG + Intronic
1060983232 9:127805429-127805451 ACATAGCTGGAATAGTCAGATGG + Intronic
1061443023 9:130619540-130619562 AGATTTCTGCAAATGTCCTAAGG + Intronic
1186075674 X:5875763-5875785 CCATTTCTGCAAGAGTAAGGTGG - Intronic
1186931689 X:14398299-14398321 ACATTTAAGCAGAAATCAGAAGG - Intergenic
1188397901 X:29707240-29707262 ACATTCCTGCAGGAGTGAGATGG - Intronic
1188559518 X:31451686-31451708 TCATTTCTGCCAAATTCTGAGGG + Intronic
1189297901 X:39931680-39931702 ACATTTCTGGAAACCACAGAGGG - Intergenic
1190234985 X:48608285-48608307 CCATCTCTGCAAAAATCAGCTGG - Exonic
1191068644 X:56377587-56377609 ACATTTTTAAAAAAATCAGAAGG - Intergenic
1193648463 X:84098809-84098831 ACATATGTGCAAAATTAAGAGGG + Intronic
1193737784 X:85180557-85180579 ACATTTCTGTCAATGACAGATGG - Intergenic
1194499710 X:94666870-94666892 AGAATTCTGCAAATCTCAGAAGG - Intergenic
1194771202 X:97908306-97908328 AGATTTCTGTTAAAGTCACATGG + Intergenic
1194952486 X:100144002-100144024 ACATTTATTCAAAAGGCACATGG + Intergenic
1195573368 X:106421776-106421798 ACATTTCTGAAAAAGGAAAAGGG - Intergenic
1195892412 X:109710194-109710216 ATATTTTTGCAAAAGAAAGAGGG - Intronic
1198924385 X:141771315-141771337 ACATTTCTGAAAATTTCCGAAGG - Intergenic
1199535186 X:148894969-148894991 ACATTGCTGCAAAAGCAAGTAGG + Intronic
1199914425 X:152323446-152323468 ACATTGCTGGGAAAGTGAGAAGG - Intronic
1200873411 Y:8126883-8126905 ACTTTTTTGTAAAAGTGAGATGG - Intergenic