ID: 1173854002

View in Genome Browser
Species Human (GRCh38)
Location 20:46238052-46238074
Sequence CTGTGGAGAAGGGCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 1, 2: 7, 3: 51, 4: 643}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173854002 Original CRISPR CTGTGGAGAAGGGCTGAGGA TGG (reversed) Intronic
900352268 1:2240850-2240872 CAGTGCCGAAGGGCTGTGGACGG - Intronic
900515751 1:3081472-3081494 GTGAGGAGCAGGGCTGAGGTGGG + Intronic
900525998 1:3128961-3128983 CTGTGCAGATGAGATGAGGAGGG + Intronic
900827531 1:4938786-4938808 CTCTGGAGGAGGACTGAGAAGGG - Intergenic
900931120 1:5738469-5738491 CTATGGAGAAGGGTGGGGGAGGG - Intergenic
901016107 1:6232048-6232070 CTTCGGAGAATGTCTGAGGAAGG - Exonic
901023585 1:6267422-6267444 CCCTGGAGAGGGGCTGAGGAAGG + Intronic
901855134 1:12039573-12039595 CAGTGGAGAAGGGGAGAGGGAGG + Intergenic
902447656 1:16477151-16477173 CTGTGGACCAGGCCTGAGGCAGG + Intergenic
902575012 1:17372227-17372249 CTGCGGTGCAGGCCTGAGGATGG + Exonic
903279394 1:22242001-22242023 GTGTGGGCCAGGGCTGAGGAGGG + Intergenic
903559244 1:24215663-24215685 GTGTGCAGAAGGGCTGTAGAGGG + Intergenic
903686397 1:25135387-25135409 CTTTGGAGAAGAGCTGGGGGAGG + Intergenic
903951087 1:26996316-26996338 CCAGGGAGAAGGGCTGATGAGGG - Intronic
903958601 1:27042087-27042109 CTGTGTAAAAGGGCTGAGTGAGG + Intergenic
904353498 1:29924049-29924071 TTGTGGAGGAGGGGAGAGGAAGG - Intergenic
904617520 1:31757969-31757991 GAGTGGGTAAGGGCTGAGGATGG + Intronic
905001242 1:34671549-34671571 CTGAGGGGGAGGGCTGAGGGTGG + Intergenic
905178615 1:36153386-36153408 GTGCGGAGGATGGCTGAGGAGGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905279692 1:36841244-36841266 CTGGGAAGAAGGGATGAGCAGGG - Intronic
905735574 1:40323487-40323509 CTTGGGAGAAGGGATGAGGCTGG - Intergenic
905927021 1:41758366-41758388 CTCTGGAGAGGGGCTGGGGGAGG + Intronic
905971609 1:42146039-42146061 CAGTGCAGAAGGGCTGATGGGGG - Intergenic
906124801 1:43421201-43421223 CTGAGGAGAAGGACTGAAGGTGG - Exonic
906166351 1:43689291-43689313 CTTTGGAGATGAGCTGAGGGTGG + Intronic
906536948 1:46556325-46556347 CTGGGGAGGTGGGCTGAGAAAGG + Intergenic
906946688 1:50300653-50300675 TTCTGGAGAAGGGCTGAGCTGGG - Intergenic
906993647 1:50766459-50766481 CTCTGGGGAAGTGCTGAAGATGG + Intronic
907275257 1:53313429-53313451 CTGTGGAGGACGGTGGAGGAAGG - Intronic
907366302 1:53963541-53963563 CTCTTGAGCAGGGCTCAGGAAGG + Intronic
907446861 1:54513727-54513749 CTGCGGGGAAGGGCTGAAGGTGG + Intergenic
909502630 1:76353032-76353054 CTTTGGAGAATGGATGATGAGGG - Intronic
910015681 1:82520393-82520415 CTGGAGAGAAAGGCTGTGGAGGG + Intergenic
910278972 1:85477364-85477386 CTGTAGAAAAGGCCTGAGGGCGG - Intronic
910929184 1:92425684-92425706 CTGGGGAGATGAGGTGAGGATGG + Intergenic
911091658 1:94022200-94022222 CTCCAGGGAAGGGCTGAGGAAGG - Intronic
911274249 1:95841229-95841251 CTGTGGAGGAGAGTTTAGGATGG - Intergenic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912681007 1:111729113-111729135 CAGTGAAGAAGGGCTGAAAAGGG + Intronic
913230026 1:116734087-116734109 CCGTGGGGAATAGCTGAGGAAGG - Intergenic
913710203 1:121475026-121475048 GAGTGGGGAAGGGATGAGGAAGG - Intergenic
914446325 1:147753432-147753454 CTGTGGGGTAGGGCTGGAGAGGG - Intergenic
915456708 1:156045154-156045176 CGGTGGGGAGGGGCTGAGGTAGG - Intronic
915616470 1:157043356-157043378 ATGGGGAGAAGCGTTGAGGAGGG + Intronic
915637293 1:157195700-157195722 CTGTGGGGAAAGGCAGAGAAGGG + Intergenic
916007820 1:160678047-160678069 CCGAGGAGATGGGGTGAGGAGGG + Intergenic
916069452 1:161161335-161161357 CTGTAATGAAGGGCTGAGAAAGG - Intronic
916087899 1:161284521-161284543 GTGTGGAGAAGGGGAGAGAAGGG - Exonic
916919881 1:169453666-169453688 GTGTGGAGAATCGTTGAGGAAGG - Intronic
917033466 1:170720607-170720629 CTGGGGAGGAGAGCTGAGGTAGG - Intronic
917269404 1:173257010-173257032 CAGTGGAGAAGTGATGAAGAAGG - Intergenic
917457841 1:175200840-175200862 CTGTTGACAAGGGCTGGGCAGGG + Intergenic
917802074 1:178580563-178580585 CTGAGGAGGAGGGATGGGGAGGG - Intergenic
917867272 1:179209117-179209139 CAGAGGAGAAGGGCTGGAGAAGG - Intronic
918363734 1:183784866-183784888 CACTGGAGAAGTGCTTAGGAAGG - Intronic
918958856 1:191244851-191244873 CTGTGGAGCAGGGCGGTGGGAGG - Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919685412 1:200479521-200479543 GTGTGCAGAGGGGCTGGGGAAGG - Intergenic
919759941 1:201091594-201091616 CTGTGGGGCAGGGCCTAGGATGG - Intronic
919913111 1:202123913-202123935 CAGGGGAGAAGGGCTGAGGAAGG - Intronic
920376906 1:205513726-205513748 CTGTGGGGAAGGGGTTCGGAGGG - Intronic
920380256 1:205530877-205530899 CTGGGGTGGAGGGTTGAGGAGGG - Intronic
920500331 1:206481327-206481349 CTGAGGACAAGGGCTGGGGGTGG - Intronic
920681081 1:208073275-208073297 CTGTGTAGAAGGACTGAAGCAGG - Intronic
921146322 1:212361413-212361435 CTCTGGAGAATTGCAGAGGAAGG - Exonic
921399306 1:214703165-214703187 GTGTGGAGGAGAGGTGAGGATGG - Intergenic
922082054 1:222306868-222306890 ATGTGGAGCAAAGCTGAGGATGG + Intergenic
922113711 1:222589131-222589153 GTGTGGAGGAGGGGTGCGGAAGG + Intronic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922823153 1:228498171-228498193 GCGTGGTCAAGGGCTGAGGAAGG - Intergenic
923271444 1:232358721-232358743 CTGTGGTTAAGGGCAGTGGAGGG + Intergenic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
1062919180 10:1266376-1266398 CTGGGGAGAATGCCTGAGGGTGG + Intronic
1063124751 10:3128419-3128441 CTCTGGATCAGAGCTGAGGAAGG + Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063393055 10:5662523-5662545 CTGTCGAGAAGGGGGGGGGAGGG + Intronic
1064141673 10:12795892-12795914 CTGCCAGGAAGGGCTGAGGACGG + Intronic
1064191035 10:13206061-13206083 CATTGGAGAATGGCAGAGGATGG - Intronic
1064414124 10:15134290-15134312 GTGTGGAGAGGGGCCGAGGCAGG - Intronic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1066103494 10:32137745-32137767 CTGGGGAGAAGGGGAGAGGTCGG + Intergenic
1067937048 10:50622265-50622287 CTGTGCAGAAGGGGAGAGGGCGG - Intronic
1068639997 10:59392748-59392770 CTGTAGAGAAGGGATGAATATGG + Intergenic
1069571151 10:69495154-69495176 GTGTGGAGAGGGGCTCTGGAGGG + Intronic
1069801587 10:71085058-71085080 CTGTAGGGAAGGGGTGGGGAGGG + Intergenic
1070103973 10:73414353-73414375 CGGTAGAGAAGGGCTGAGACTGG + Intergenic
1070665375 10:78338910-78338932 CTCTGGAGACAGGCAGAGGAAGG - Intergenic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1070805243 10:79266969-79266991 CAGTGGAATGGGGCTGAGGAGGG + Intronic
1072022821 10:91420882-91420904 CTGTGGACTAGAGCTGAGGTAGG - Intronic
1072553621 10:96497649-96497671 CTGTGGTGAGGGGCAGGGGAGGG - Intronic
1073330042 10:102664364-102664386 CTGTGCAGAAGAGCTGGGGCAGG + Intergenic
1073375856 10:103033773-103033795 ATGTGTAGAAGGGCTGGGCACGG - Intronic
1073631481 10:105154270-105154292 CTGTGGTGAGGGGCTGAGGAAGG - Intronic
1074081318 10:110170271-110170293 CTGTGGAGACTGGCTGGGGCTGG - Intergenic
1074485629 10:113875400-113875422 CTGAGGAGAACAGCTGGGGAAGG - Intronic
1075119948 10:119657493-119657515 CTGTGGAGAAGGGTAGAACATGG + Intronic
1075242209 10:120789432-120789454 CTGTTCAGTAGGGCTGAGGCTGG + Intergenic
1075474865 10:122725936-122725958 CTGAGGGCAGGGGCTGAGGAGGG - Intergenic
1075586865 10:123664974-123664996 CTGTGGGGAAGGGGTGGGGATGG - Intergenic
1075895591 10:125991914-125991936 CCGAGGAGAAGGGCAGAGCAGGG - Intronic
1075941454 10:126393772-126393794 CAGTGGAGTAGAGCTGAGGTGGG + Intergenic
1076089231 10:127666436-127666458 CTTTGGAGACTGGATGAGGAAGG + Intergenic
1076224742 10:128764990-128765012 CTGGGGGTAAGGGCTGGGGAGGG + Intergenic
1076890278 10:133280017-133280039 CTGGGCAGCAGGGGTGAGGAAGG + Intronic
1077239496 11:1503127-1503149 CTGTGGAGAAGGGATGGGGAGGG + Intergenic
1077353790 11:2105319-2105341 CTGTGGAGAAGGGCTCCCGCAGG - Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1077444673 11:2585458-2585480 CTGTGGTGATGGGGTGAGCACGG + Intronic
1077649346 11:3955820-3955842 CTATGTGGAAAGGCTGAGGAGGG + Intronic
1078334794 11:10455134-10455156 CTGGGGAGAAGAGCTCAGGAAGG - Intronic
1078422660 11:11224896-11224918 CTGCTGAGAAGGGCTGGGGCAGG - Intergenic
1078466368 11:11553412-11553434 CTGTGGAGGTGGGCTTTGGAGGG - Intronic
1078708034 11:13764213-13764235 CTGGGGAGTGGGGCAGAGGATGG - Intergenic
1078822678 11:14897789-14897811 GTCTGGAGCAGGCCTGAGGAGGG - Intergenic
1079444319 11:20545760-20545782 CTACGGGGAAGGGCAGAGGAAGG - Intergenic
1079706732 11:23630853-23630875 CTCGGGAGAAAGGGTGAGGAAGG - Intergenic
1081758210 11:45559500-45559522 CTGGCGAGAAGGGGTGTGGAGGG - Intergenic
1082780903 11:57286876-57286898 CTGGGCAGAAGGGCAGAGGAGGG - Intergenic
1082877514 11:58003020-58003042 GTGTGGAGAAGGGCGGGGGGTGG + Intergenic
1083195173 11:61081745-61081767 CTGGGGACAAGGGCTGATGTCGG - Intergenic
1083233900 11:61339813-61339835 GTGTGGAGAATGGATGAGCAAGG - Intronic
1083253050 11:61480950-61480972 CTGTGGAGGAGGCCGGAGGTTGG + Intronic
1083812691 11:65114629-65114651 CAGTTGAGAAGGGCAGAGGCTGG + Intronic
1083941360 11:65897828-65897850 CAGTGCAGAGGGGCTGAGGCAGG + Intronic
1084153628 11:67302536-67302558 CTGTGGAGAGGCACTGTGGATGG + Intergenic
1084276296 11:68052685-68052707 AGGTGGAGGAGGGCTGATGATGG + Intergenic
1084972509 11:72779657-72779679 CTGAGGAGCAGGGATGGGGAAGG - Intronic
1085326568 11:75610975-75610997 GTGAGGAGGAGGGGTGAGGAAGG - Intronic
1085343199 11:75747150-75747172 GGGTGGAGAAGAGCTGAGAAAGG + Intergenic
1085463641 11:76710012-76710034 GTGTGGAGCTGGGCTTAGGATGG + Intergenic
1085517116 11:77118130-77118152 ATGTGGGGAGGGGCTGAGCAGGG - Intronic
1088522291 11:110712529-110712551 GGCTGGAGGAGGGCTGAGGAGGG - Intronic
1089094394 11:115906654-115906676 CTGTGGAACAGGGATGAGAAGGG + Intergenic
1089170331 11:116507161-116507183 CTATAGAGAAGAGCTCAGGAAGG + Intergenic
1089406487 11:118201880-118201902 TTGGGGAGATGGGCTGAGGAGGG + Intronic
1089670630 11:120054597-120054619 CAATGGACAATGGCTGAGGATGG - Intergenic
1089682246 11:120125172-120125194 CTGTTGAGCTGGGCTGGGGACGG - Intronic
1089696746 11:120220604-120220626 CTCTGCAGAAGGGCTGGTGAGGG + Intronic
1090077416 11:123588012-123588034 CTATGGAGAAGGGTAGAGAAGGG - Intronic
1090397981 11:126431763-126431785 CTGAGGTAAAGGGCAGAGGAAGG + Intronic
1090644804 11:128758751-128758773 GAGTGGAGAAGGGATGAGGAAGG + Intronic
1090867395 11:130713724-130713746 CAAAGGAGTAGGGCTGAGGAGGG - Intronic
1091154116 11:133357965-133357987 CAGTGGGGTAGGCCTGAGGAAGG - Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091669158 12:2440003-2440025 CTGGGAAGAAGGGCTGGGCAGGG - Intronic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1091696833 12:2633367-2633389 CTGTGGAGAAGGGGTAGGGTGGG + Intronic
1091878992 12:3961001-3961023 GTGTGGAAAAGTGCTCAGGACGG + Intergenic
1092007981 12:5085685-5085707 CTGTGGAGAAGGGCTGTTACAGG - Intergenic
1092875284 12:12842385-12842407 CTGAGGAGCAGGCCTGGGGAAGG - Intergenic
1092910615 12:13141756-13141778 CTCAGGAGCAGGGCTGAGAATGG + Intronic
1093073975 12:14737983-14738005 ATGTGGAGCAGAACTGAGGAGGG - Intergenic
1093213576 12:16336292-16336314 CTGTGAACAAGGGCTTAGGAAGG - Intergenic
1093600550 12:21016140-21016162 GTGTGAAGAAAGGCTGAGGGAGG + Intronic
1093844866 12:23957091-23957113 CTGTAAAGAAGGACTTAGGAAGG - Intergenic
1095473994 12:42566378-42566400 CGGTGGAGAGGGTTTGAGGATGG + Intronic
1095952961 12:47791429-47791451 AGGTGGAGGTGGGCTGAGGAGGG + Intronic
1096097334 12:48944719-48944741 GTGTGGAAAATGGCTGAGAATGG - Intronic
1096122103 12:49094843-49094865 CTTGGGAGAAGGGCGGAGGGCGG - Intergenic
1096237490 12:49939723-49939745 CTGGGGTGAAGGGCATAGGATGG - Intergenic
1096496941 12:52044147-52044169 CTGTGGGGAAGCTCTGAGAAAGG - Intronic
1096519743 12:52178197-52178219 CTGTGGAGAAGGGCTTGCGATGG - Intronic
1096777703 12:53974121-53974143 CGATGGAGAAGGGGTGGGGAGGG + Intronic
1096797705 12:54088487-54088509 CATTGGAGCAGGGTTGAGGAAGG - Intergenic
1097684198 12:62676733-62676755 CCGAGGGGAAGGGCTGAGGGTGG + Intronic
1097861291 12:64521196-64521218 CTACAGGGAAGGGCTGAGGAGGG - Intergenic
1098204405 12:68092852-68092874 CAGTGTTGAGGGGCTGAGGATGG + Intergenic
1101503643 12:105327355-105327377 CTGTGGAGTAGAGATGGGGAGGG - Intronic
1102010792 12:109617203-109617225 CTGGGAAGAAGGGCTGTGGTAGG - Intergenic
1102068445 12:109998324-109998346 CTGTGGAGAATGGATTAGGTTGG + Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102468192 12:113142761-113142783 CTGGGGAGTGGGGCTGAGGCAGG - Intergenic
1103375732 12:120454529-120454551 CTGTAGCGAGAGGCTGAGGAGGG - Intronic
1103785675 12:123431088-123431110 CTGTGGTGAGAGGCTGAGGCAGG - Intronic
1103938698 12:124490254-124490276 ATGAGGGGAAGGGCTGAGGTTGG - Intronic
1104682770 12:130762626-130762648 GTGAGAAGGAGGGCTGAGGACGG + Intergenic
1105943151 13:25169472-25169494 CTCTGGAGCAGGGCGGGGGACGG + Exonic
1105959430 13:25316801-25316823 ATGTGGGGAGGGGCAGAGGAGGG - Intronic
1106312076 13:28563243-28563265 CTGTGGAGAATGTGTAAGGAAGG + Intergenic
1106538789 13:30671823-30671845 AGGTGGAGAAGGGCAGAGCAGGG + Intergenic
1106985313 13:35340434-35340456 TGGTGGCCAAGGGCTGAGGATGG + Intronic
1107270410 13:38609509-38609531 ATTTGGACAAAGGCTGAGGAAGG + Intergenic
1107889761 13:44903926-44903948 CTGGGGAGAAGTCCTGAGGCAGG + Intergenic
1108104693 13:46996501-46996523 CAGAGGAGAATGGCAGAGGAGGG + Intergenic
1109262762 13:60163681-60163703 CCGCGGAGAGAGGCTGAGGAAGG + Exonic
1110322639 13:74177338-74177360 GTTTGGAGAAGGGCTGAGGAAGG + Intergenic
1111495858 13:89048831-89048853 CAGGGGATAAGGGCTGAGGGGGG + Intergenic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112594702 13:100797135-100797157 TTGAGGACAAGGCCTGAGGATGG - Intergenic
1113209469 13:107958537-107958559 CAGTAAAGAAGGGCAGAGGAGGG - Intergenic
1113381487 13:109809978-109810000 CTGTGGAGAAGCTCTGAGTGAGG + Intergenic
1113618465 13:111697239-111697261 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113623994 13:111782500-111782522 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1114195022 14:20469523-20469545 CCATGGAGAACGGGTGAGGAGGG + Exonic
1114338584 14:21718866-21718888 TTGTAGAGAAGCTCTGAGGATGG - Intergenic
1114657213 14:24323282-24323304 CTGTGGGCTTGGGCTGAGGAAGG + Intronic
1115474149 14:33798315-33798337 CTCTGGAAGAGGGCTGGGGATGG - Intronic
1115476571 14:33820298-33820320 ATGTACAGAAGGCCTGAGGAAGG + Intergenic
1115641238 14:35336920-35336942 CTGTGAGGAAGGGTGGAGGAGGG + Intergenic
1115766469 14:36628201-36628223 CTTTGAAAAAGGGCTTAGGAGGG + Intergenic
1116895330 14:50310589-50310611 TTGGGGAGGGGGGCTGAGGAGGG + Intronic
1118592374 14:67411284-67411306 TGGTGGGGAAGGACTGAGGAGGG + Intronic
1118632165 14:67715502-67715524 CTGTGGTGAGGTGCTCAGGATGG - Intronic
1118655018 14:67937755-67937777 CTGTGGTAAGGGGCTGAAGAAGG - Intronic
1118761940 14:68885377-68885399 CTGTGGTGAGGGGCTGAGGCTGG - Intronic
1119348092 14:73942716-73942738 CTGTGGAGAAAGGATGGTGATGG + Intronic
1119621704 14:76136542-76136564 CTGGGGAGAGGGGCTGAGAAGGG + Intergenic
1120412413 14:84174436-84174458 GAGTGGAGTAGGGCTGAGGTTGG - Intergenic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121211213 14:92209283-92209305 CTGTGAAGAAGTGCTGAATACGG + Intergenic
1121780182 14:96617259-96617281 GGGTGGGGAGGGGCTGAGGACGG + Intergenic
1122283278 14:100636754-100636776 CAGTGGAGCAGGGCAGGGGAAGG - Intergenic
1122328665 14:100898607-100898629 CAGTGGGGAGGGGCTGAGGCTGG - Intergenic
1122446400 14:101772858-101772880 CTGTGAAGCAGGTCTGAGAATGG - Intronic
1122884031 14:104702645-104702667 CTGGGGAGACGGGCTGAGAATGG - Intronic
1123021329 14:105399108-105399130 GTGTGGAGAAGAGCTGCGGCGGG + Intronic
1202895057 14_GL000194v1_random:2060-2082 CTATGAGGAAGGGCTGAGGCAGG + Intergenic
1124181885 15:27483847-27483869 CCTTGGAGAATAGCTGAGGAAGG - Intronic
1124440832 15:29685330-29685352 CTGTGGACAAGGGCGGTGAATGG + Intergenic
1124721522 15:32115093-32115115 ATGTGGAGAAGGGCTGTTGCGGG - Intronic
1125335293 15:38620656-38620678 TGGTGGGGAAGGGCTGAGGTGGG - Intergenic
1125523947 15:40363870-40363892 GGCTGGAGAAGGGCTGAGGCTGG - Exonic
1125896987 15:43310720-43310742 GTATGTAGAAGGGCTGGGGAGGG + Intergenic
1126106515 15:45150468-45150490 TTGGGGACAAGGGCTGAGGTTGG + Intronic
1126359286 15:47829128-47829150 ATGTGGAGAAGAGCAGAGGAAGG + Intergenic
1126557335 15:50004031-50004053 CTGGGGAGATGGGCGGAGGTGGG - Intronic
1127612574 15:60651347-60651369 CTCTGGAGAAGGTCTCAGTAAGG + Intronic
1128308821 15:66617822-66617844 CTGTGGTGAGAGGCTGAGGTGGG - Intronic
1129913077 15:79244344-79244366 AGGTGGAGAAGGGCAGAGGTGGG - Intergenic
1130333792 15:82941741-82941763 ATGTGGAGAAAGGCTTGGGAAGG - Intronic
1130353531 15:83110739-83110761 CTGTGGGGATGAGCTGAAGAAGG - Intronic
1131371698 15:91887264-91887286 CTGGGGAAAATGGCCGAGGAAGG - Intronic
1132223845 15:100125601-100125623 GTGTGGGGAAGAGCTGGGGAGGG - Intronic
1132570696 16:642691-642713 CTGGGGTGAAGGGCGGAGGAGGG - Intronic
1132603914 16:785790-785812 CTGCGAGGAAGGGCTGAGGTGGG - Exonic
1133443169 16:5837480-5837502 CTGTGGAGGAGGGCAGAGGGTGG - Intergenic
1133624943 16:7562496-7562518 CTATGGAGAATGACAGAGGATGG + Intronic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1135323166 16:21510203-21510225 CTCTGCAGAAGGCCTGAGCAGGG - Intergenic
1135649713 16:24195321-24195343 CAGTTAAGAAGGGGTGAGGAAGG - Intronic
1136044151 16:27602229-27602251 GAGTTGAGAAGGGCTGAGGGAGG - Intronic
1136273857 16:29166360-29166382 CCTGGGAGAAGGGCAGAGGATGG + Intergenic
1136334650 16:29603390-29603412 CTCTGCAGAAGGCCTGAGCAGGG - Intergenic
1136470250 16:30474814-30474836 CTGTAGGGAAGAGATGAGGACGG + Intronic
1137372756 16:47923701-47923723 CTTTGGAGAAGATCTGAGGCAGG + Intergenic
1138113123 16:54340204-54340226 CTCTGTAGGAAGGCTGAGGAAGG - Intergenic
1139372356 16:66477033-66477055 CTGTGGAGTTGGGCTGGGCATGG - Intronic
1139476829 16:67207020-67207042 CTGTGGGCCAGGCCTGAGGAAGG + Intergenic
1139558700 16:67728512-67728534 CTGTGGGGAGGGGTTGAGGTGGG + Intronic
1139732081 16:68954609-68954631 CAGTGGTGAAGAGGTGAGGAAGG - Intronic
1140207784 16:72947712-72947734 GGGTGGGGAAGGGGTGAGGAAGG + Intronic
1141250113 16:82348234-82348256 CAGTGCAGAAGGTCTGGGGAGGG + Intergenic
1141464368 16:84196396-84196418 CTGTGGAGCAGTGCTGGTGATGG + Intronic
1141997000 16:87641976-87641998 CTGTGGAGGAGGGGTGGGGCTGG + Intronic
1142035363 16:87859226-87859248 CTCTGCAGAAGGCCTGAGCAGGG - Intronic
1142077399 16:88128103-88128125 CCTGGGAGAAGGGCAGAGGATGG + Intergenic
1142196385 16:88741121-88741143 CACTGCAGAAGGGCTGAGAAGGG - Intronic
1142269034 16:89079577-89079599 CTCTGCAGGAGGGCGGAGGAGGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143338419 17:6190771-6190793 CTGCAGTGAAGGGCTGAGGTCGG + Intergenic
1143462624 17:7114008-7114030 CTGTGAACAGGGACTGAGGAGGG - Intronic
1143627042 17:8116477-8116499 CTCTGGAGAAGTGCAGAGGGAGG + Intronic
1143775367 17:9195557-9195579 CTGTGGAGCTAGGCTGAGGCAGG + Intronic
1144222495 17:13112730-13112752 CAGGGGAGAAGGGCAGAAGAAGG + Intergenic
1146481325 17:33207130-33207152 CTGAGGAGAAGGGCTTATAAAGG + Intronic
1146639791 17:34531573-34531595 CTGGGGAGTAGGGCTGTGTAAGG - Intergenic
1147892238 17:43725554-43725576 CTCAGGAGGAGGGCTCAGGAGGG - Intergenic
1148853214 17:50564816-50564838 CTGGGGAGAAGGGCTGGGGCTGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1149858238 17:60104001-60104023 CCTTTGAGAAGGGCAGAGGAGGG + Intergenic
1149858462 17:60106368-60106390 CTGTGGAGCTGGGCTCATGAGGG - Intergenic
1152650231 17:81489123-81489145 CTGGAGAGAAGGGCAGAGGCCGG + Intergenic
1152710509 17:81868689-81868711 GGGTGGGGGAGGGCTGAGGAGGG + Exonic
1152724716 17:81939547-81939569 CTCTGGGGGAAGGCTGAGGAAGG - Intronic
1152938251 17:83152893-83152915 CCGTGGAGATGGGCCGAGAATGG + Intergenic
1152976558 18:226487-226509 CTTTGGAGGAGGTCTGAGGGAGG + Intronic
1153758030 18:8302850-8302872 CTGTGGAGAGGAGCTCAGGTTGG + Intronic
1153774630 18:8441716-8441738 ATGGGAAGAAGGGCTGATGAAGG + Intergenic
1154299962 18:13184341-13184363 CTGGGGAGAAAGGCTGTGGCTGG + Intergenic
1154385739 18:13890362-13890384 TTCTGGAGAAGAGCTGGGGAAGG + Intronic
1155718336 18:28975474-28975496 CTGTGGAGCAGGGCCAAGGAGGG + Intergenic
1155844324 18:30686537-30686559 CTGAGGAGCAGGGGTAAGGATGG - Intergenic
1156463276 18:37333541-37333563 CTGTGGGGAAGAGCTGAGAATGG + Intronic
1156489319 18:37486950-37486972 CTGTGGAGACTGGCTGGGGATGG - Intronic
1156975393 18:43216000-43216022 ATGTGAAGTAGTGCTGAGGAAGG + Intergenic
1157385932 18:47260200-47260222 CAGTGGAGAAGGGAAGAGGGAGG - Intergenic
1157505550 18:48223592-48223614 GTGTGTAGGAGGGGTGAGGATGG + Intronic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158099965 18:53819533-53819555 CAGTGGAGATAGGCTGTGGATGG - Intergenic
1158136244 18:54211520-54211542 CTGTAGAGGAGTGCTGAGGATGG - Intronic
1158887305 18:61840425-61840447 CTGTGGCACAGGGCAGAGGATGG + Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159681787 18:71363019-71363041 GTGTGGAAAAGGTCTGAGGTCGG - Intergenic
1159908950 18:74125332-74125354 CTAAGGAAAAGGGATGAGGATGG + Intronic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1160694964 19:479166-479188 CCGTGCAGAAGGGCTGCTGAGGG + Intergenic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161680619 19:5678037-5678059 CTGCGGACAGGAGCTGAGGAGGG + Intronic
1162238876 19:9331624-9331646 TTTTGCAGAAGGGCTGATGAGGG + Intronic
1162307582 19:9884685-9884707 CTGTGGAGATGTGCACAGGAAGG - Intronic
1163333524 19:16657004-16657026 CTGTGCAGAAGGACAGAGGCAGG - Intronic
1163550533 19:17964268-17964290 CTGTGGAGGGGTGCTGGGGATGG + Intronic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164764685 19:30755160-30755182 CAGAGGCGGAGGGCTGAGGAAGG - Intergenic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1164852294 19:31494187-31494209 CTGTGGAGTTGGGTGGAGGATGG - Intergenic
1164899904 19:31909685-31909707 TTGTGGAGAGGGGGTGATGATGG + Intergenic
1165311616 19:35031977-35031999 CTGTGGAGAGGGGCTGAGTGTGG + Intronic
1165378242 19:35459184-35459206 CTGATGAGAAGTTCTGAGGAAGG - Intergenic
1166137039 19:40783898-40783920 CTGTGGAGAAGGGAGAAGGGAGG - Intronic
1166167411 19:41001412-41001434 GTGTGCATCAGGGCTGAGGAAGG + Intronic
1166255243 19:41599741-41599763 CTGTGAGGAGGGGCTGAGGGAGG - Intronic
1166258123 19:41620177-41620199 CAGTAGAAAAGGGCTGGGGAGGG + Intronic
1166281403 19:41796684-41796706 CTGTGGGGAGAGGCTGAGGGGGG - Exonic
1166318012 19:41999347-41999369 ATGTGGAGAGGGGCTGGGGGAGG - Intronic
1166499690 19:43331379-43331401 CTGCGGGGAGGGGCTGAGGGGGG + Intergenic
1166831964 19:45644627-45644649 CTCTGGGAAAAGGCTGAGGATGG - Intronic
1166852498 19:45767336-45767358 CTGCAGAGAAGCGCTGGGGAGGG + Intronic
1166874218 19:45887211-45887233 CTTTGGGGAAGGGCGGAGGCGGG + Intergenic
1166988119 19:46674474-46674496 CTGTGAAGAACCGCTGTGGAGGG + Exonic
1167324892 19:48818382-48818404 CTGAGGAGGAGGGCAGAGGCTGG - Intronic
1168243123 19:55097049-55097071 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243203 19:55097402-55097424 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243255 19:55097631-55097653 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168639164 19:58019460-58019482 GTGTGGAGTGGGGCTGAGCATGG - Intergenic
925007726 2:457266-457288 CTGTGGAGCAGTCCAGAGGAGGG + Intergenic
925128927 2:1480945-1480967 CTGTGGCCCAGGGCTGAGGGAGG - Intronic
925263494 2:2547903-2547925 CTCTGGAGAAGGGCTGGGTGAGG + Intergenic
925739392 2:6992493-6992515 GTGTGGAGAACGGGTAAGGAAGG + Intronic
926145150 2:10392787-10392809 CTCTGGAGAATGGCAGAGGGAGG - Intronic
926684640 2:15689572-15689594 CGGTGGAGGAGGGCAGAGGCAGG + Intergenic
927142026 2:20137196-20137218 CCTTGGGGAAGGGCTGGGGAGGG - Intergenic
927603161 2:24462270-24462292 CTGAGGAGGAGGACTGAGGTTGG + Intergenic
927881400 2:26692571-26692593 CTGGGGAGACGCGCCGAGGAGGG - Intergenic
927954824 2:27200953-27200975 CTGTGGAGAAGGGCAGGGAGGGG + Intronic
928199967 2:29241515-29241537 GTGTGGTGATGGGGTGAGGAAGG + Intronic
928355757 2:30613244-30613266 CTGGGGAGAAGGGGTGAAGGGGG + Intronic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930861940 2:56083524-56083546 CTTTGGAAAATGGCAGAGGAGGG + Intergenic
931495719 2:62804944-62804966 CTGGGGTGAAGGGCAGGGGATGG - Intronic
931757856 2:65389995-65390017 TTGTGGAGCAAAGCTGAGGATGG + Intronic
931977898 2:67663685-67663707 CCTTGGAGAAGGGCTGGGCAGGG - Intergenic
933370553 2:81410137-81410159 CTGTGGAGGAGGGTTGCAGAGGG + Intergenic
933840941 2:86285077-86285099 CGGTGGAGAAGGGCCGTGTAGGG - Intronic
933998535 2:87687472-87687494 CTGTGGGGAAGGGCTGAGTGTGG + Intergenic
934517297 2:94996707-94996729 CTGGGGAGAGGAGCTGGGGATGG + Intergenic
934791988 2:97069504-97069526 CTCTGGGGAAGGGCTGAGTGTGG - Intergenic
935138316 2:100327795-100327817 CTGTTGAAAAGGGCAGGGGAAGG - Intergenic
935842719 2:107130986-107131008 CTGTAGGGAAGGGATGAGAAAGG - Intergenic
936015960 2:108959236-108959258 TTGTGCAGAGGGGCTGATGATGG + Intronic
936295314 2:111263401-111263423 CTGTGGGGAAGGGCTGAGTGTGG - Intergenic
936998810 2:118442683-118442705 CTGAGAGGAAGGGCTGAGGAGGG - Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937304872 2:120865045-120865067 CTGAGGGGAAGGGCTGGTGATGG + Intronic
937333937 2:121049148-121049170 ATGTGGAGAAGGCCAGAGAATGG + Intergenic
937991229 2:127663631-127663653 CTGGGCAGAAGGGCTGGGGCGGG - Intronic
938386799 2:130872493-130872515 GTGCGGAGGAGGGCTGGGGATGG - Intronic
938397416 2:130961804-130961826 GTGGGGAGAAGTGCTGGGGAAGG - Intronic
939071394 2:137548445-137548467 GTGTGTGGAAGGGCTGAGAAAGG - Intronic
940104302 2:150080781-150080803 GTGTGGGCAAGGGCAGAGGAAGG + Intergenic
940352934 2:152708789-152708811 AGGTGGAGGAGAGCTGAGGAAGG - Intronic
940888350 2:159010960-159010982 CCGTTGTGAAGAGCTGAGGATGG + Intronic
941471878 2:165898053-165898075 TTGTCGAGAAGAACTGAGGAAGG + Intronic
942060405 2:172224057-172224079 CTGTGGTGGTGGGCTGAGGTGGG - Intergenic
942075604 2:172354636-172354658 CTGAAGAGAGGGGCTGAGTATGG - Intergenic
942659620 2:178250605-178250627 CGGTGCAGAAGCCCTGAGGAAGG - Intronic
943029416 2:182668689-182668711 CTGCTGAGAAGGGCTGTGGCAGG - Intergenic
944415492 2:199475590-199475612 CAGTGGAGAGGGGCTGGGGAGGG - Intergenic
944418720 2:199505417-199505439 TAGTTGAGAAGGGCTGAAGAGGG + Intergenic
944894053 2:204145980-204146002 CTGGGGAGACGGGCCGGGGAGGG - Intergenic
946374835 2:219301856-219301878 GTGTGGACAAGGGCTGGGAAAGG - Intronic
946393229 2:219429178-219429200 ATGTGGGGCAGGGCTGAGAAGGG - Intergenic
946442500 2:219708502-219708524 CTGTCTGGAAGGGCTGAGAATGG + Intergenic
946595825 2:221304986-221305008 CTGATGAGAAGGGCTGAAGTGGG + Intergenic
947232455 2:227902044-227902066 CTGTTGAGGAGGGGTGAGGATGG + Intronic
948689359 2:239692152-239692174 CTGGAGAGAAGCGCTGAGCAGGG + Intergenic
948707562 2:239804574-239804596 CTGTGCTGACGGGCAGAGGATGG + Intergenic
948813900 2:240499923-240499945 CTGTGGAGCAGAGCAGAGCAGGG + Intronic
948836707 2:240629409-240629431 CTGTGGGGAAGGGCTGATGCAGG + Intronic
948952530 2:241263460-241263482 TTATGGAGAAGAACTGAGGAGGG + Intronic
949047005 2:241876905-241876927 CTGGGCAGAAGGGGTGGGGAGGG - Intergenic
1169066286 20:2695879-2695901 CTGTGGGGTGAGGCTGAGGAAGG - Intronic
1170956648 20:20986379-20986401 CTCTGCACAAAGGCTGAGGAAGG - Intergenic
1171062514 20:21979824-21979846 CTATGTAAAAGGACTGAGGAAGG + Intergenic
1171313873 20:24168843-24168865 TGGTCGTGAAGGGCTGAGGAGGG - Intergenic
1172072805 20:32270875-32270897 TTGGGGAGGAGGGCTGAAGAGGG - Intergenic
1173285838 20:41670869-41670891 TGGTGGAGAAGGGCTGGGCAGGG - Intergenic
1173556756 20:43971926-43971948 CTCTGGAGAGGGGCAGTGGATGG + Intronic
1173561591 20:44009829-44009851 CTGTGGTGCAGGGGTGAGCATGG + Intronic
1173821659 20:46023519-46023541 CTGTGGAGGAGGGCTAGGGAAGG - Intronic
1173845806 20:46187751-46187773 CTGTGGTGAGGGGGTGGGGATGG - Intronic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1174192480 20:48750123-48750145 CAGAGGAGAGGGGCTGAGGACGG - Intronic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1175149302 20:56920572-56920594 ATCTGGAGAAGGGGTGAGGGAGG + Intergenic
1175412252 20:58777917-58777939 CTGTGGGGAAGGGTGGAGGCTGG - Intergenic
1175426328 20:58869735-58869757 AAGTGGAGAGGGGTTGAGGAGGG - Intronic
1175816983 20:61888310-61888332 CTGCAGAGATGGGCTGGGGACGG - Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1175989138 20:62778871-62778893 ATGGGGAGAGGAGCTGAGGATGG + Intergenic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176390205 21:6159308-6159330 CAGTGGAGGAGGGGTGAGGTTGG - Intergenic
1177149318 21:17438844-17438866 CTTGGGGGAAGGGCTGAGCATGG - Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178176114 21:30101565-30101587 GTAAGGAGAAGGGCTGAGGTGGG + Intergenic
1178365503 21:31986205-31986227 CTGTGGTGGAGGGCGGAGGGCGG - Intronic
1178533345 21:33393055-33393077 CCGTGGAGGAGGGGTGGGGATGG + Intergenic
1178687717 21:34724271-34724293 GTGTGGAGAAGGGGTGGGGAAGG + Intergenic
1179165713 21:38933722-38933744 GGGTGGAGGGGGGCTGAGGAAGG - Intergenic
1179182985 21:39061356-39061378 ATCTGGAGAGGGGCTGAAGATGG - Intergenic
1179551495 21:42146597-42146619 CTGGGGAGGAGGGCTGAGGTTGG + Intergenic
1179551530 21:42146705-42146727 CTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179733261 21:43378932-43378954 CAGTGGAGGAGGGGTGAGGTTGG + Intergenic
1179886974 21:44318447-44318469 CTGTGGGGAAGGGTTCAGGCTGG - Intronic
1179951500 21:44711270-44711292 CTGTGGAGATGGGCAGAGGCGGG - Intronic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1181020540 22:20099527-20099549 CTGGGGAGAAGGGCTGGGAATGG + Intronic
1181256253 22:21564755-21564777 CTGTGGAGAATTACGGAGGAAGG - Intronic
1181804792 22:25368182-25368204 CTGTGCAGCATGGCTGCGGACGG - Intronic
1181987278 22:26808908-26808930 TTGGGGTGCAGGGCTGAGGATGG + Intergenic
1182017046 22:27049439-27049461 CTGAGGACTAGGGCTGAGAAGGG - Intergenic
1182194219 22:28497830-28497852 GTGAGGAATAGGGCTGAGGATGG + Intronic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1182334082 22:29571460-29571482 CTGTGGTTAAGGGCAGTGGAGGG + Intronic
1182443369 22:30376747-30376769 CTGTGGCCCAGGGCTGAGGCTGG + Exonic
1182583505 22:31329152-31329174 CTGCGGTGAGGGGCTGAGGCTGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182744917 22:32598108-32598130 CCGAGGAGAAGGGGTCAGGATGG - Intronic
1184059056 22:42070926-42070948 CAGTGGGGAAGGGCTTAGGGAGG - Intergenic
1184189386 22:42884868-42884890 CTGTGGGGAAGGGCTGTGCCTGG + Intronic
1184876855 22:47281781-47281803 CTGTGCAGAAGAGGTGGGGAGGG - Intergenic
1185025206 22:48405007-48405029 GTCCGGAGAAAGGCTGAGGATGG - Intergenic
1185220091 22:49624885-49624907 CTGCGGGGAGGTGCTGAGGAGGG - Exonic
1185348281 22:50320099-50320121 CTGGGCAGATGGGATGAGGAGGG - Intronic
950451363 3:13067523-13067545 CAGTGGGGAAGGGGTGGGGAGGG + Intronic
950550316 3:13662273-13662295 CTGTGGAGAAGGGCCAAAGGGGG - Intergenic
951698448 3:25469926-25469948 CTGTGGAGAGGGGCTTAAAAAGG + Intronic
952278066 3:31896782-31896804 CTGTGGAAAGGTGCTGAGTAGGG - Intronic
952555607 3:34526629-34526651 CTTTTGAGAAGGGCTGAGTAAGG - Intergenic
952582509 3:34851456-34851478 TTGTAGATAAGGGTTGAGGATGG + Intergenic
954810255 3:53243057-53243079 CTATGGACAAGGGCTGAGGAAGG + Intronic
954811386 3:53250429-53250451 CTCAGGAGTAGGGCTGGGGATGG - Intronic
954942621 3:54388528-54388550 ATGAGGAGAAGCTCTGAGGATGG + Intronic
955812864 3:62809439-62809461 CTGTGGAAAAGCTCTGAGAAAGG - Intronic
955984320 3:64557166-64557188 CTGAGGTGAAGGTCAGAGGAAGG + Intronic
956420001 3:69077904-69077926 CTGTGCAGAATGGCTGTTGATGG - Exonic
956789242 3:72668162-72668184 GGGTGGAGAAGGGCAGAGCATGG - Intergenic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
959710975 3:109385536-109385558 CTGAGGTCAAGGGCTGAGGTCGG - Intergenic
960127421 3:114015359-114015381 CTGGGAAGCAGGGCTCAGGAAGG + Intronic
960506372 3:118499795-118499817 CTGGGGAGGAAGGCTGGGGAAGG - Intergenic
960725060 3:120661740-120661762 CTGTCCAAAAGGGCTGAGCAGGG + Intronic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
960950796 3:122997381-122997403 TTCTGGAGAGGGGCAGAGGAGGG - Intronic
961467381 3:127090028-127090050 GTGTGGAGGAGGGCTGAGGCTGG + Intergenic
961756186 3:129128532-129128554 CTGTGGAAAAGGTCTGAGTGAGG - Intronic
961864491 3:129943680-129943702 CTGTGGAGCAGGGCGGAGTGGGG + Intergenic
962600839 3:136989872-136989894 CTGAGGAGATGAGCTGATGAGGG - Intronic
963084171 3:141421682-141421704 GTGGGGTGAGGGGCTGAGGACGG - Intronic
963382119 3:144543697-144543719 CTTTGGGTAAAGGCTGAGGAGGG - Intergenic
963414819 3:144982237-144982259 CTGTACTGAAGGGCTGAGGCAGG - Intergenic
964207304 3:154188774-154188796 CTGATGAGAAGGGCTGATGATGG + Intronic
964538909 3:157757131-157757153 CTGTGGGGTAGGGCGGAGGTGGG + Intergenic
967389893 3:188945348-188945370 GTGGGGAGAAGGGTTCAGGATGG - Intergenic
967942023 3:194773438-194773460 CTGGGCAGTAGGGCAGAGGAGGG + Intergenic
968133077 3:196203555-196203577 ATGTGAAGAAGGCCTGAGGCAGG + Intronic
968478764 4:824986-825008 CCGTGGAGAAGGGTTGGGGGTGG + Intronic
969249561 4:5958115-5958137 CTTTGGGAAGGGGCTGAGGAGGG - Exonic
969503918 4:7571629-7571651 AAGTGGAGGAGGGCTGAGGCAGG + Intronic
969509441 4:7609445-7609467 CAGTTGACGAGGGCTGAGGATGG - Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969989938 4:11252099-11252121 CAGAGTAAAAGGGCTGAGGAGGG - Intergenic
971202563 4:24524727-24524749 CTGTGGCTCAGGGCTGAGAAGGG - Intronic
973095353 4:46191132-46191154 CAGTGGAGAGGGACTGATGAGGG + Intergenic
973927331 4:55751947-55751969 CTGTGGTGAAGGCATGAGGGAGG + Intergenic
975180159 4:71334848-71334870 CTGTGGAGGAGAGCCGAGCAGGG + Intronic
975581915 4:75914829-75914851 TTGTGGAGAGGGGGTGAGGTGGG - Intronic
976549913 4:86381972-86381994 CTGTAGAGAAACCCTGAGGAGGG - Intronic
978334922 4:107656648-107656670 CTGGGAATCAGGGCTGAGGATGG - Intronic
978556700 4:109988727-109988749 CTGGGGAGGAGGGCAGAGGCAGG + Intronic
978610453 4:110532708-110532730 CTGTGCAGAAGGGCTTCAGAAGG - Intronic
978894173 4:113867060-113867082 CTGTGGAGAAAAGCTAAGAAGGG - Intergenic
981657110 4:147124432-147124454 CTGTGGAGTGGTGCTGAGAACGG - Intergenic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
983094185 4:163542580-163542602 ATGTGGAGAAGCCCTGGGGAGGG + Intronic
983885456 4:172975687-172975709 CTGAGGCAAGGGGCTGAGGATGG - Intronic
983891754 4:173036887-173036909 CTGAGGTGAAGGGCAGAGGAGGG + Intronic
984627415 4:182022911-182022933 AAGTGGATAGGGGCTGAGGAGGG + Intergenic
984936687 4:184896275-184896297 CCTTGGAGAAACGCTGAGGACGG + Intergenic
985139733 4:186827447-186827469 CCGTGGAGAAGGGCTGCTGTTGG + Intergenic
985314541 4:188642577-188642599 CTTTGGAGAAGGGCAGGAGAAGG + Intergenic
985317453 4:188673015-188673037 CTGGGGAGAGGGGCAGAGGTGGG + Intergenic
985348711 4:189035275-189035297 GTGTGGAGACGGGCAGGGGACGG - Intergenic
985548790 5:523044-523066 CTGCGGAGAAGGGAGGAGGCGGG + Intronic
985632519 5:1021419-1021441 CTGTGGGGAGGGGCTGGGGGGGG - Intronic
985756782 5:1724217-1724239 CTTTGCAGAAGTGGTGAGGACGG + Intergenic
986105881 5:4658925-4658947 ATGAGGAGAGGGGGTGAGGAGGG + Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
988594971 5:32582948-32582970 CTGGGAAGTAGGGCTGAGAAGGG - Intronic
989987310 5:50716151-50716173 CTATGGAGAAGGGAAGAGGCTGG + Intronic
990794231 5:59521725-59521747 CTGTAGAGATGGGTTGGGGAGGG - Intronic
992331067 5:75717711-75717733 CTGTTGAGCAGGGCTGAAGTTGG + Intergenic
993558034 5:89366538-89366560 CTCTGGAAACGGGCTGAGGCTGG - Intergenic
993596989 5:89869684-89869706 CTGGGGAGAAGGGCTAGGTATGG - Intergenic
994208461 5:97061875-97061897 GTGTGGAGTGGGGCAGAGGAGGG - Intergenic
994817828 5:104607163-104607185 CTGTGGAGAAACGCTAAGAATGG + Intergenic
996247635 5:121283599-121283621 CTGTTGAGAAGGCATGAGGTTGG + Intergenic
997370259 5:133355174-133355196 CTGTGCAGCCTGGCTGAGGAAGG + Intronic
997408219 5:133669368-133669390 CTGTGAAGAAGTGCTCAGGGAGG - Intergenic
997459174 5:134040613-134040635 CTGTGGAGGCAGGCTGAGGCAGG + Intergenic
997649308 5:135503776-135503798 CTGTAGAGATGGGCTGGGGTTGG + Intergenic
997741606 5:136259832-136259854 GTGAGGAGCAAGGCTGAGGAAGG - Intronic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
998032978 5:138889214-138889236 GTGTGGTGAAGGGCTGAGTGTGG + Intronic
998393001 5:141799702-141799724 TTGTGGAGTAGGGCTGTGGTTGG - Intergenic
998788054 5:145733974-145733996 CTATGGGGAAGGACTGAAGATGG + Intronic
999010596 5:148034425-148034447 CTGTGGACAAGGGTTGGGGGGGG - Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999726392 5:154441869-154441891 ATGTGGGGAAGGGGTGAGGTGGG - Intergenic
1000157982 5:158570602-158570624 CAGTGAAGTAGGGGTGAGGAAGG - Intergenic
1000166627 5:158655970-158655992 GAGTGGGGAAGGGCTGAGTAAGG - Intergenic
1001135466 5:169099093-169099115 CTGGGGAGAGGGGCTGGGGTAGG - Intronic
1001586532 5:172836661-172836683 CTGTGGCAGAGGGCTGAGCATGG - Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1001972760 5:175969475-175969497 CCCTGGAGAAGAGCTGAGGGGGG + Intronic
1002244678 5:177874307-177874329 CCCTGGAGAAGAGCTGAGGGGGG - Intergenic
1002357437 5:178642182-178642204 CTGTGGAAAATGGCAGATGAGGG - Intergenic
1003636863 6:7839996-7840018 CTATGAAGTAGGGCTGAAGAAGG + Intronic
1003791672 6:9553264-9553286 CAGTGGAGAGGGGATGAAGATGG + Intergenic
1004023039 6:11791515-11791537 GTGTGCAGAAGGGCTGAGTCGGG - Intronic
1004140192 6:13011024-13011046 GTGTGAAGAAGGGCCCAGGATGG - Intronic
1005249284 6:23926417-23926439 TTTTGGAGAAGGGGTGAGGGAGG + Intergenic
1006147575 6:31968613-31968635 CTGAGGACAAGGGCTGAGATGGG - Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006671940 6:35735149-35735171 CCCTGGAGAAGGGCAGAGCAAGG + Intergenic
1006705194 6:36014150-36014172 CTGTGGAGAAGAGTAGAGCATGG + Intronic
1006913131 6:37577198-37577220 CTGTGGAGTCAGGCTGAGGTTGG - Intergenic
1007036405 6:38678467-38678489 CTGGGGAGAATGGGTGAGGATGG + Intronic
1007276668 6:40679230-40679252 CTGTGGAGAAAGACTGTGGATGG - Intergenic
1007340545 6:41188579-41188601 TTGACGAGAAGGGCTGTGGAGGG - Intergenic
1007400277 6:41599177-41599199 ATGTGGGGAGGGTCTGAGGAGGG - Exonic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007780998 6:44254700-44254722 CTGTGCAGAAGGTTTGAGGGTGG - Exonic
1008944772 6:57086050-57086072 CTGTAGAGAGAGGCTGAGGCGGG - Intergenic
1011719457 6:90140123-90140145 CCATGGAAAAGGGCTGAAGAAGG + Intronic
1012135666 6:95552782-95552804 CTATGGAGAAGGAATGAGGCAGG - Intergenic
1013597378 6:111672298-111672320 CTGTGGAGGAGTGCTGGAGAGGG - Intronic
1013671662 6:112409524-112409546 TTGTGGAGTAGGGCTTAGGGTGG + Intergenic
1015070944 6:129092158-129092180 CTGTGGTGAGTTGCTGAGGAAGG - Intronic
1016380348 6:143471590-143471612 CTGTGCAGAAGGTTTTAGGAAGG + Exonic
1016505619 6:144775870-144775892 TTGAGGGGAAGAGCTGAGGAGGG - Intronic
1016989533 6:149919817-149919839 CTGTGGAGAAAGGCAGGTGAGGG + Intronic
1016993518 6:149945286-149945308 CTGTGGAGAAAGGCAGGTGAGGG - Intronic
1017004815 6:150022244-150022266 CTGTGGAGAAAGGCAGGTGAGGG + Intronic
1018021841 6:159768385-159768407 CTGGGGAGAAGGGCTGCAAAGGG + Intronic
1018236868 6:161735101-161735123 TTGTAGAGAGAGGCTGAGGAGGG + Intronic
1018362692 6:163087619-163087641 CAGAGGAGAAGAGGTGAGGATGG + Intronic
1019191366 6:170252960-170252982 CTTTGGAGACAGCCTGAGGAAGG - Intergenic
1019444201 7:1062731-1062753 CTGTGCAGCAGGGCGGAGGCAGG - Intronic
1019576438 7:1739827-1739849 CGGTGGGGCGGGGCTGAGGATGG + Intronic
1020659724 7:10967440-10967462 CTGTGGCAAAAGGCTGAGGAAGG - Intergenic
1021785807 7:24151440-24151462 CAGGGGAGAAGGGCTTTGGAAGG + Intergenic
1022055848 7:26733634-26733656 TTGTGGAGAAGGGGAGAGCAGGG + Intronic
1022372212 7:29782700-29782722 CAGTGGATCAGGGCTAAGGATGG + Intergenic
1023176375 7:37439485-37439507 ATGTGGAGAAGGGGTAGGGAGGG - Intronic
1023278579 7:38546875-38546897 GTGTGGAGAAGGGTGGAGAATGG - Intronic
1024246013 7:47471191-47471213 GTGGGGAGAAGGGGTGAGGGTGG + Intronic
1024575680 7:50762207-50762229 CTGTGCAGAAGGGCTGGGGAGGG - Intronic
1025797980 7:64757725-64757747 CTGTGGGATAGGGCTGAAGAAGG + Intergenic
1025847857 7:65216872-65216894 CTGTCGGGAAGGGGAGAGGAGGG - Intergenic
1025898104 7:65722737-65722759 CTGTCGGGAAGGGGAGAGGAGGG - Intergenic
1026598610 7:71754522-71754544 CTAGGGAGAAAGGCTGAGGCAGG - Intergenic
1027151743 7:75738587-75738609 CTGGGGAGAAGGGCAGAGGCGGG - Intronic
1027175894 7:75903247-75903269 CTGTGGAAAGGGGCTGGGCACGG + Intronic
1027775992 7:82465074-82465096 CTGAGGAGAATGGATGGGGATGG + Intergenic
1028920540 7:96305972-96305994 CTGTGGAATAGGGCCCAGGAGGG - Intronic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1030740715 7:113106267-113106289 GTGGGGAGAAGGGATGTGGATGG - Intergenic
1030762771 7:113371626-113371648 CGGCGGAGAAGGTCAGAGGAAGG - Intergenic
1030964050 7:115966854-115966876 CTGAGGAGGAGTGCTGAAGAGGG - Intronic
1032087155 7:128890514-128890536 CTGGGGAGAAGGGCAGGGGCTGG + Intronic
1032089286 7:128903223-128903245 GCTTGGTGAAGGGCTGAGGAAGG - Intronic
1032390516 7:131552600-131552622 GTCCAGAGAAGGGCTGAGGAGGG - Intronic
1032416780 7:131741612-131741634 CTGTTGGGAGGAGCTGAGGAAGG - Intergenic
1033477733 7:141706888-141706910 CTGTAGGGAAGGGCCAAGGAAGG + Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034923393 7:155101839-155101861 CTGTGGACAAAGGCAGAGGGAGG - Intergenic
1035166064 7:156990596-156990618 CTGTGGACAAGTGCTGAGATAGG + Intergenic
1035277627 7:157757511-157757533 CTTTGGATACGGGCAGAGGAAGG + Intronic
1035415711 7:158683847-158683869 CTGTTGACAAGGGCTGAGCAAGG + Intronic
1036516964 8:9453191-9453213 CAGTAGAGAAGAGCTGAGTACGG + Intergenic
1036572890 8:9997435-9997457 CACTGGAGACAGGCTGAGGAAGG - Intergenic
1036769026 8:11566094-11566116 CTGTGGGGTGGGGCTGAGGAGGG + Intergenic
1037144121 8:15552830-15552852 CTGTGGAGAATAGCTTAGGTGGG + Intronic
1037915559 8:22770721-22770743 CTGAGGAGCAGGGCTGATCAAGG - Intronic
1038027334 8:23603417-23603439 CTGAGGAGATGGGCAAAGGAGGG - Intergenic
1038054505 8:23845705-23845727 CTTTGAAGGAGGGCTGAAGATGG - Intronic
1039177013 8:34820148-34820170 CTTTGGAGAGGGGAGGAGGAAGG + Intergenic
1039704404 8:39992098-39992120 CTGTGGAGGAGCGCGCAGGATGG - Intronic
1039864633 8:41490437-41490459 CTGTGGGGCTGGGCCGAGGAAGG - Intronic
1039899878 8:41743967-41743989 CTTTGGAGAAGTGCTGAGCCAGG + Intronic
1041165756 8:55090793-55090815 CAGTGGAGAGTGGCTGAGGATGG - Intergenic
1041445784 8:57949560-57949582 CTGAGGACAAGGCCTAAGGAGGG + Intergenic
1041755958 8:61313382-61313404 CTGAGGAGGTGGGCTGAGGCTGG + Intronic
1042121269 8:65491094-65491116 CAGTGGAGCAGGGCTGAGTTTGG - Intergenic
1042138990 8:65660554-65660576 CTGATGAGAAGGCCTGAGGGAGG - Intronic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042331439 8:67584666-67584688 GAGTGGAGTAGGGCTGAGAATGG + Intronic
1042873833 8:73422906-73422928 CTGTGGAGAAGGGATAAGGCAGG - Intronic
1042879285 8:73469508-73469530 CTGAGTAGAAGGACTGAGTAAGG + Intronic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1044872682 8:96635145-96635167 CTTGGGAGAAAGGCTGAGGTAGG - Intergenic
1045347062 8:101302919-101302941 CTGGGAAGATGGGGTGAGGATGG + Intergenic
1047508795 8:125500368-125500390 CCCTGGAGCAGGGCTGAAGAAGG - Intergenic
1047934295 8:129761727-129761749 ATGAGGAGAAGGGGTGAGAATGG - Intronic
1048277830 8:133080588-133080610 CTGTGGGAAAGGGATGAAGATGG - Intronic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1048296599 8:133219285-133219307 CTGTGGGAGAGGTCTGAGGAGGG - Intronic
1048364929 8:133730254-133730276 CTGCGGAGGAGGGTGGAGGAAGG + Intergenic
1048747513 8:137631365-137631387 CTCAGGAGAGGGGCTGTGGAGGG - Intergenic
1049097984 8:140560129-140560151 CTGTGGTCAGGGGCTGAGGCGGG - Intronic
1049112074 8:140652743-140652765 GAGTGGAGATGGGCTGAGGTTGG - Intergenic
1049308985 8:141923454-141923476 CCATGTAGAAAGGCTGAGGATGG - Intergenic
1049435818 8:142585756-142585778 CTGTGGAGACGGGTGCAGGAGGG - Intergenic
1049686562 8:143941505-143941527 GTGAGGAGAAGGGCTGGGGCGGG + Intronic
1049812055 8:144580016-144580038 CAGTGGGGAAGGGCTGAGGCAGG - Intronic
1050387866 9:5110187-5110209 GAGTGGAGCAGGGCTGAGGCTGG - Intronic
1051371196 9:16360564-16360586 ATGAGGAGAAAGGCTGAGGTGGG - Intergenic
1053152344 9:35751004-35751026 CTGGAGGGAAGGGCTGGGGAAGG + Intronic
1053234994 9:36445464-36445486 TTGTGTAGAAGGTCTGATGAAGG - Intronic
1053545779 9:39021401-39021423 CTGGGGAGACGGGCTGGGCACGG - Intergenic
1053591674 9:39520922-39520944 TTGTGGAGAAGCGATGAGGTGGG - Intergenic
1053787326 9:41661638-41661660 CATTGGAGCAGGGTTGAGGAAGG - Intergenic
1053810097 9:41843051-41843073 CTGGGGAGATGGGCTGGGCACGG - Intergenic
1053849523 9:42276285-42276307 TTGTGGAGAAGCGATGAGGCAGG - Intergenic
1054157801 9:61653129-61653151 CATTGGAGCAGGGTTGAGGAAGG + Intergenic
1054328410 9:63729476-63729498 CTGTGAGGCAGGGCTGAGGCAGG - Intergenic
1054477575 9:65584134-65584156 CATTGGAGCAGGGTTGAGGAAGG + Intergenic
1054574634 9:66844367-66844389 TTGTGGAGAAGCGATGAGGCGGG + Intergenic
1054620496 9:67344377-67344399 CTGGGGAGATGGGCTGGGCACGG + Intergenic
1054982021 9:71217817-71217839 CTCAGCAGAAGGGCTGTGGAGGG - Intronic
1055357666 9:75454132-75454154 ATGGGGAGAAGGGCTAAGGCAGG + Intergenic
1055606609 9:77977227-77977249 GTGTGGAGAAGGGCCAGGGAAGG - Intronic
1056406881 9:86283090-86283112 CTGGGGAGAAGGGTGGAGGGTGG - Intergenic
1056737229 9:89220192-89220214 CTGTGGAGCAGGCCTGTGAAGGG - Intergenic
1056759507 9:89404978-89405000 CTGAGGTGAGTGGCTGAGGACGG - Intronic
1056759569 9:89405170-89405192 CTGAGGTGAGTGGCTGAGGACGG - Intronic
1057147407 9:92767611-92767633 CTGTGGGGCAGGTCTGAGGAGGG + Intergenic
1058425166 9:104869609-104869631 CTGAGGAGAAGGGGTGAGGCGGG + Intronic
1058458841 9:105163808-105163830 CTCTGGAGAGGGGATGGGGAAGG - Intergenic
1058774250 9:108268294-108268316 GTGAAGAGAAAGGCTGAGGATGG + Intergenic
1058968188 9:110056169-110056191 GTGTGTAGAAGGTGTGAGGAAGG + Intronic
1059411033 9:114132497-114132519 GTGTGGAGCAGGGCTGTGAAAGG + Intergenic
1059983119 9:119794990-119795012 CTGTGAAGAAGGCTTGAGAAGGG + Intergenic
1060225330 9:121786770-121786792 TTGTCAAGATGGGCTGAGGAGGG - Intergenic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1060931139 9:127490131-127490153 CTGTGGAGTGGGGCTGGGGCTGG + Intronic
1060962587 9:127691546-127691568 CTGTGGACACAGGCTGGGGAGGG - Exonic
1061185275 9:129049301-129049323 CAGTGGAGGAGGGCTCAGGGGGG + Intronic
1061292786 9:129661482-129661504 CTGGGGATAAGGGCTGGGGTTGG - Intergenic
1061588315 9:131582801-131582823 CTGTGGAGTTGGGCAGAGGGTGG - Intronic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062024098 9:134332514-134332536 CTGTGGAGGAGGGGTGGGGGAGG + Intronic
1062428362 9:136516346-136516368 CAGTGGAGCCGGGCTGAGAATGG + Intronic
1185600352 X:1334908-1334930 CTCTGGGGAAGGGCTGAGGTTGG + Intergenic
1185764863 X:2717054-2717076 AAGTGGAGAAGGGCTGGGCACGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187440050 X:19310170-19310192 GTGTGGAGAATGGATGAGGAGGG + Intergenic
1188310485 X:28611113-28611135 TTGTGGAGAAGGGAAGAGGTTGG + Intronic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1189112534 X:38307264-38307286 CTGTGGAAAAAGTCTGAGGCTGG - Intronic
1190062575 X:47220563-47220585 CTGCGGAATAGGGCTGAGTAAGG + Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190301195 X:49058611-49058633 CTGGGAAGAAGGGCTGAGAGTGG - Intronic
1190597262 X:52062185-52062207 CTCTGCAGGAGGGCTGCGGAGGG - Intronic
1190611562 X:52191888-52191910 CTCTGCAGGAGGGCTGCGGAGGG + Intronic
1192340079 X:70257159-70257181 CTGTAGAGTAGGGCTGGGGCTGG - Intergenic
1192560946 X:72127555-72127577 CTGTGGAGAAGTGTGAAGGACGG - Intronic
1193209138 X:78785361-78785383 CTGTGGAAAATGGATTAGGAAGG + Intergenic
1193222455 X:78942608-78942630 CTGTGGAGGAAGGCTGAGTTTGG - Intergenic
1195172876 X:102286145-102286167 CGGTGGAGGAGGGCTGCGGGAGG + Intergenic
1195185990 X:102400950-102400972 CGGTGGAGGAGGGCTGCGGGAGG - Intronic
1195328201 X:103775152-103775174 CTGGCGAGCAGGGCTGGGGAGGG + Intronic
1195451838 X:105022829-105022851 TTGTGGAGAATGGCTCAGAAAGG + Intronic
1195869614 X:109472457-109472479 CAGCTGAGAAGGTCTGAGGAAGG - Intronic
1196995760 X:121381897-121381919 CTGGGGTGGGGGGCTGAGGAAGG - Intergenic
1197422035 X:126249618-126249640 CTATGGAGAAGGGTTAAGAAAGG + Intergenic
1197765464 X:130057005-130057027 CAGTGAAGAAGGCGTGAGGAGGG - Exonic
1197899011 X:131348428-131348450 TTGTGGGGAAGGGATGAAGATGG - Intronic
1198019339 X:132642978-132643000 GCGTGGAGAAGGGATGATGAGGG - Intronic
1198089883 X:133318131-133318153 GAGTGGGGAAGGGGTGAGGATGG - Intronic
1198275471 X:135094833-135094855 CTGAGGAGTAGGGCTGGGGGAGG - Intergenic
1199084958 X:143617759-143617781 CTGAGCAGTAGGGTTGAGGAGGG - Intergenic
1199860790 X:151798921-151798943 CTGTGGAGAGGGGTGGAGGGAGG + Intergenic
1200065395 X:153502199-153502221 CTGTGGGGAGGGGCTGGGGAAGG - Intronic
1200122151 X:153796218-153796240 CTGTGAAGGAAGGCTGGGGAGGG - Intronic
1200752376 Y:6958275-6958297 AGGTGGAGAAGAGTTGAGGAAGG - Intronic
1200838490 Y:7755994-7756016 CAGTGCAGAAGGGCGCAGGAAGG + Intergenic
1200873306 Y:8126092-8126114 AAGTGGAGGAGGACTGAGGAAGG - Intergenic
1201543994 Y:15140523-15140545 CTGTGGAGAAGAGGTGGGAATGG + Intergenic