ID: 1173855997

View in Genome Browser
Species Human (GRCh38)
Location 20:46251220-46251242
Sequence CAGCAGCAGCAGCAGTAGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1328
Summary {0: 1, 1: 12, 2: 79, 3: 257, 4: 979}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173855993_1173855997 4 Left 1173855993 20:46251193-46251215 CCCCAGCAGCGTCGGCGGCGGCG 0: 1
1: 0
2: 23
3: 174
4: 421
Right 1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG 0: 1
1: 12
2: 79
3: 257
4: 979
1173855988_1173855997 14 Left 1173855988 20:46251183-46251205 CCCACAGGCGCCCCAGCAGCGTC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG 0: 1
1: 12
2: 79
3: 257
4: 979
1173855989_1173855997 13 Left 1173855989 20:46251184-46251206 CCACAGGCGCCCCAGCAGCGTCG 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG 0: 1
1: 12
2: 79
3: 257
4: 979
1173855996_1173855997 2 Left 1173855996 20:46251195-46251217 CCAGCAGCGTCGGCGGCGGCGGC 0: 1
1: 15
2: 97
3: 230
4: 658
Right 1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG 0: 1
1: 12
2: 79
3: 257
4: 979
1173855994_1173855997 3 Left 1173855994 20:46251194-46251216 CCCAGCAGCGTCGGCGGCGGCGG 0: 1
1: 2
2: 27
3: 154
4: 380
Right 1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG 0: 1
1: 12
2: 79
3: 257
4: 979
1173855987_1173855997 20 Left 1173855987 20:46251177-46251199 CCGCTGCCCACAGGCGCCCCAGC 0: 1
1: 0
2: 3
3: 61
4: 530
Right 1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG 0: 1
1: 12
2: 79
3: 257
4: 979
1173855986_1173855997 21 Left 1173855986 20:46251176-46251198 CCCGCTGCCCACAGGCGCCCCAG 0: 1
1: 0
2: 1
3: 43
4: 446
Right 1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG 0: 1
1: 12
2: 79
3: 257
4: 979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173855997 Original CRISPR CAGCAGCAGCAGCAGTAGCG CGG Exonic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900388134 1:2419891-2419913 CAGCAGGTGCAGCAGTTCCGAGG - Intergenic
900652157 1:3735003-3735025 CGGCAGCAGCAGCAGACTCGGGG + Exonic
900895297 1:5479109-5479131 CAGCAGCAGCAGCACAGGCAGGG - Intergenic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901519574 1:9772887-9772909 CAGCAACACCAGCAGTACCTAGG + Intronic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
902150763 1:14441380-14441402 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
902490109 1:16775348-16775370 CAGAAGCAGCAGGAGGGGCGTGG + Intronic
902597024 1:17516526-17516548 CAGCAGCAGCAGCAGAGGTCAGG - Intergenic
902742243 1:18446914-18446936 CACCAGGTGCAGCAGTAGAGGGG - Intergenic
902954638 1:19917157-19917179 CAGCCGCAGAAGCAGCAGCAGGG - Intergenic
902984456 1:20147158-20147180 CAGCAGCAGCTGCAGCACCCAGG + Intronic
903057385 1:20645619-20645641 CAGCAGCTGCAGCAGCATCATGG - Exonic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903510073 1:23868227-23868249 GAGCAGCAGCAGCAACAGCGCGG + Exonic
903786324 1:25863573-25863595 CAGCCGCAGCAGCAGTACCAGGG + Exonic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904093089 1:27958783-27958805 CATCAGCAGCAGCGGGAGCTGGG - Exonic
904110666 1:28123604-28123626 CAACAGGAGCAGCAGTGGAGGGG + Intergenic
904377364 1:30090281-30090303 CAGGAGCAGCAGCAGGCTCGAGG + Intergenic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
905800324 1:40838743-40838765 CAGCAGCAGCGGCCGTCCCGCGG + Exonic
905805730 1:40875904-40875926 CAGCAGCAGCAGCAATGTGGAGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905824073 1:41016137-41016159 CAGCAGCAGCTGCAGCAGCACGG - Exonic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906199975 1:43953670-43953692 AAGCAGCAGCAGCTGTGGAGGGG - Intronic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909068135 1:70961050-70961072 CAGCAGCATCAGCATTACCTGGG - Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909980637 1:82096096-82096118 CAGCAGCAGCAGCATCACCTGGG - Intergenic
911103488 1:94111902-94111924 AAGCAGCAGCAGCAACTGCGTGG - Intronic
911660769 1:100499118-100499140 CAGAAGCAGCAACAGCAACGGGG + Exonic
912108198 1:106306859-106306881 CAGCAGTAGCAGCAATAGGTGGG - Intergenic
912318976 1:108692661-108692683 CAGCAACAGCAGCAGTGCGGCGG + Exonic
912494310 1:110081611-110081633 CAGCAGCAGAAGCAACAGCTAGG + Intergenic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912776569 1:112509387-112509409 CAGCAGCAGGAGCAGAAGGCAGG - Exonic
912788633 1:112628983-112629005 CAGGAGCAACAGCAGAAGCAGGG - Intronic
913091753 1:115480834-115480856 CAGCATCAGCAGCACAAGCAGGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915325331 1:155078982-155079004 CAGCAGCGGCAGCAGCGGCACGG - Exonic
915552355 1:156642439-156642461 CAGCAGCAGCTGCAGGCGCTCGG - Intronic
915623819 1:157102348-157102370 CAGCAGCAGCAGCATCACCTAGG - Intergenic
915690901 1:157689834-157689856 CAGCAGCAGCAGCAAGGACGAGG + Exonic
915692169 1:157700469-157700491 CAGCAGCAGCCACAGAAGCATGG + Exonic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915999898 1:160605831-160605853 CATCAGCTGCAGCAGTACGGGGG + Intergenic
916028450 1:160855694-160855716 CAGTAGCAACAGCAGTGGCAGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916274900 1:162983170-162983192 CAGCAGCATCAGCATTACCTAGG + Intergenic
916456103 1:164972440-164972462 CAGCAGCAGAGGCAGAAGGGAGG - Intergenic
916482324 1:165225753-165225775 CAGCAGCAGCAGCATCACCTGGG - Intronic
916562609 1:165946154-165946176 CGGCAGCAGTAGCAGCAGCAAGG + Intergenic
916591705 1:166197340-166197362 AAGCAACAGCAGCAATAGAGTGG + Intergenic
917415010 1:174799873-174799895 AGACAGCAGCAGCAGTAGCCAGG - Intronic
917524507 1:175775063-175775085 CAGCAGTGGCAGACGTAGCGTGG - Intergenic
917809784 1:178647039-178647061 CAGCAGTAGGAGCAAGAGCGTGG + Intergenic
917820237 1:178755340-178755362 CACCACCAGCAGGAGTAGTGAGG - Intronic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
918966569 1:191357552-191357574 AAACAGCAGCAGCAGTTGAGTGG - Intergenic
919776483 1:201197427-201197449 CTGCAGCAGCGGCAGCAGCCTGG - Intronic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920335349 1:205241613-205241635 CAGCAGCATCAGCAGCAGCAGGG + Exonic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920662176 1:207924540-207924562 CAGCAGCAGCAGCATCACCTGGG - Intergenic
920763630 1:208810107-208810129 CAGCAGCATCAGCATTACCTGGG - Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921132687 1:212233171-212233193 CAGCAGCAGCAGCATCACCTGGG - Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
922167434 1:223127897-223127919 AAGCAGCAGCAGCAGCACCTGGG + Intronic
922344724 1:224686987-224687009 CTGCAGCAGAGGCAGTGGCGTGG - Intronic
922481841 1:225944769-225944791 AAGCAGCAGCAGCAGGGGCCTGG - Intergenic
922525264 1:226297173-226297195 CAGCAGCAGTCACAGTAGCCTGG - Intronic
922534295 1:226368410-226368432 CAGCAGGTCCAGAAGTAGCGTGG + Intronic
922581810 1:226703661-226703683 CCGCAGCAGAGGCAGTAGCGGGG + Intronic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
922969621 1:229725120-229725142 CAGCCGCAGCAGCAGCATCTGGG - Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
923530328 1:234807182-234807204 CAGAAGCAGCAGGAGGGGCGTGG - Intergenic
923651114 1:235874953-235874975 CAGCAGCATCAGCATTACCTGGG + Intronic
924052523 1:240092770-240092792 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
924139582 1:241008454-241008476 CAGCAGCAGCAACATTACCCGGG - Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924567401 1:245210192-245210214 CAGCAGAAGCTGCAGCTGCGGGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
924706285 1:246505432-246505454 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1063119423 10:3094225-3094247 CAACAGCCCCAGCAGGAGCGAGG - Intronic
1063349875 10:5344223-5344245 CAGTAGCAGCAGCAGCTGCTTGG - Intergenic
1063623057 10:7666872-7666894 CAGCCCCAGCAGCAGGAGCATGG + Exonic
1063652217 10:7949015-7949037 CAGCAGCGGCGGCAGCAGCCGGG - Intronic
1064027984 10:11864241-11864263 CAGCAGCAACACCAGAAGCCGGG - Intronic
1064408948 10:15088740-15088762 CAACAGCAGCAGCAACAACGCGG - Exonic
1064602760 10:17010024-17010046 CAGCACCAGCAGCATTACCCGGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066048282 10:31613311-31613333 CAGCAGCAACAGCAACAGCAGGG - Intergenic
1067560354 10:47300686-47300708 CAGCAGCAGCAGCTGGGGCCCGG - Exonic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1069331607 10:67300018-67300040 CAGCAGCATCAGCATTACCTAGG + Intronic
1069685740 10:70317296-70317318 CAGAAGCAGAAGCAGAAGCCAGG - Intronic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1070160772 10:73865577-73865599 CAGCAGCAGTGGCAGCAGAGGGG + Intronic
1070459724 10:76652288-76652310 TATCAGCACCAGCAGTAGTGAGG - Intergenic
1070742898 10:78914067-78914089 CACCAGCAGCGGCAGCAGCCGGG - Intergenic
1070786319 10:79164191-79164213 CAGCACCAACAGCGGCAGCGTGG + Intronic
1070938883 10:80325297-80325319 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
1070994105 10:80760649-80760671 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1071086739 10:81874975-81874997 CAGCAGCAGCAGCGGGCGCGGGG + Intergenic
1071120362 10:82269816-82269838 CAGCAGCATCAGCATTACCTGGG - Intronic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071444201 10:85730847-85730869 CAGCAGCAGCAGCATCACCTGGG - Intronic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072189052 10:93066011-93066033 CAGTAGCAGCAGGACGAGCGAGG - Exonic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072562199 10:96586773-96586795 CAGCAGCAGCAGCCACAGCGCGG + Exonic
1073101827 10:101010530-101010552 CAGCCGCAGCCGCAGCAGCCGGG - Intronic
1073945061 10:108740875-108740897 CAGCAGAGGCTGCAGTAGCAGGG - Intergenic
1074722673 10:116276182-116276204 CATAAGCAGCAGCAGTACTGGGG + Intergenic
1075233933 10:120709660-120709682 AAGCACCAGCAGCTGTAGTGAGG - Intergenic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1075534432 10:123258116-123258138 CAGCTGGAGCAGCAGCGGCGAGG - Intergenic
1076136313 10:128047426-128047448 CAGCAGCGGCAGTAGCAGCCAGG - Exonic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076169599 10:128308304-128308326 CAGCTGCAGCTGGAGCAGCGGGG - Intergenic
1076993634 11:288404-288426 CAGCAGCTGCACCAGGACCGAGG + Intergenic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077063350 11:627114-627136 CAGCAGCAGCAGGAGGGGCCGGG + Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077228900 11:1449960-1449982 CAGCAGCCGCCACAGGAGCGTGG - Intronic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077392188 11:2305237-2305259 CAGCAGCTCCAGCACTAGCCAGG + Intronic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1077799615 11:5524908-5524930 CAGGGGCAGCAGCTGTAGAGTGG + Intronic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078135815 11:8650520-8650542 CAGCAGCAGCAGCTGTCTCAGGG + Intronic
1078140802 11:8691650-8691672 GAGCTGCAGCCACAGTAGCGGGG + Intronic
1078467514 11:11561154-11561176 CAGCAGCAGCAGAAACTGCGAGG + Intronic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1078949588 11:16115250-16115272 CAGCAGCATCAGCAATATCTGGG + Intronic
1079620064 11:22543135-22543157 AAGCTGCAGCAGCAGAAGTGAGG + Intergenic
1080433743 11:32221270-32221292 CAGCAGCAGGAGCAGAAGACAGG - Intergenic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1080606647 11:33869671-33869693 CAGCAGCAGCTGCAGCCGCCTGG - Intronic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1080798969 11:35591624-35591646 CAGAAGCAACAGCAGCAGCATGG - Intergenic
1081354222 11:42093128-42093150 CAGAATCAGCAGCTGTAGCCAGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1083393284 11:62371277-62371299 CAGCAGCAGCAGCGGCGACGAGG + Intronic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083651527 11:64207351-64207373 CAGCAGCCGCAGCCATGGCGGGG + Exonic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1083812272 11:65112518-65112540 CAGCAGCAGTAGCAGAGCCGCGG - Exonic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1083853964 11:65383070-65383092 CAGCAGCATCAGCGGCAGCCTGG + Intronic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084144629 11:67258159-67258181 CAGCAGCAGCAGCAGAACTAGGG + Intergenic
1084178702 11:67436228-67436250 CAGCAGCAGCAGCAGGACAACGG + Exonic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084209045 11:67612526-67612548 CAGCAGCGGCAGCTGGAGGGTGG - Intronic
1084631638 11:70355675-70355697 CAGCAGTAGCAACAGTAGCCAGG + Exonic
1084687294 11:70704025-70704047 CCCCAGCAGCAGGAGTAGGGCGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084860436 11:72014504-72014526 GGGCAGCAGCAGGAGGAGCGTGG - Exonic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085192402 11:74639128-74639150 CAGCAGCATCAGCATTATCTGGG + Intronic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085808426 11:79658078-79658100 CAGAAGCATCAGCATCAGCGGGG + Intergenic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086486915 11:87315120-87315142 AAGCAGTAGCAGCAGTAGTAGGG - Intronic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087159078 11:94931589-94931611 CAGCAGCAGCACCATTACCTGGG + Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1087804958 11:102545507-102545529 CAGCCGCAGCAGCAGAGGCTAGG + Intergenic
1088323655 11:108579870-108579892 CAGCAACAGCAGTGGTAGCTGGG + Intronic
1088401267 11:109423951-109423973 CAGCGGCAGCCGCGGTGGCGGGG + Exonic
1089278517 11:117356011-117356033 CAGCAGCAGCAACAGCAACCTGG + Intronic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089609457 11:119661355-119661377 CAGCAGTGGCAGCAGCAGAGGGG + Exonic
1089922662 11:122225026-122225048 CAGCAGCAGTAGAAGTAACAAGG + Intergenic
1090105573 11:123851314-123851336 CAGCAGCAGCAGCTGTGTTGGGG + Intergenic
1090476987 11:127032017-127032039 CAGCAGCAGCAGCAACACCCGGG - Intergenic
1090914832 11:131154240-131154262 CAGCGGCACCAGCAGCACCGGGG - Intergenic
1090931129 11:131299069-131299091 CAGCAGCAGCAGCACCACCTGGG - Intergenic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091219318 11:133920793-133920815 CAGCAGCAGCAGCCCTGGGGAGG - Exonic
1091271180 11:134312978-134313000 GAGCAGCAGCACCAGCAGCAGGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091326949 11:134698345-134698367 CAGCACCATCAGCAGTGGCTGGG + Intergenic
1091594335 12:1865655-1865677 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1091850398 12:3692641-3692663 CAGCAGCAGTGGCAGCAGCATGG + Intronic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1092837088 12:12500806-12500828 TAGCATCAGCAGCTGTAGCCAGG - Intronic
1093007412 12:14065112-14065134 AACAAGCAGCAGCAGTAGCAGGG - Intergenic
1094523407 12:31216163-31216185 AAGCAGCAGCAGCAGTGAGGTGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095262698 12:40115571-40115593 TAGCAGCAGCAGTTGTAGTGGGG + Intergenic
1095466972 12:42497856-42497878 CAGCAGCCGTAGGAGTAGGGAGG - Intronic
1095726387 12:45457837-45457859 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1095906614 12:47384932-47384954 GACCAGCCCCAGCAGTAGCGGGG - Intergenic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096154908 12:49336457-49336479 CACCAGCAGCAGCAGCACCATGG + Exonic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1096848162 12:54419109-54419131 CAACAGCAGCGGCAGCAGCGGGG + Exonic
1096872710 12:54604138-54604160 CACAAGCAGCAGCAGAAGTGTGG + Intergenic
1097009000 12:55939271-55939293 CAGCAGCACTAGCAGTGGCACGG - Exonic
1097053069 12:56235211-56235233 CAGGAGCCGCAGCAGCAGCAGGG - Exonic
1097173274 12:57128972-57128994 CAGCAGCAGGAGCAACGGCGGGG - Exonic
1097561249 12:61208885-61208907 CAGCAGCAGCTGCAGAACAGCGG + Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1097708715 12:62895455-62895477 CAACAGCAGCAGCAGCACCTGGG + Intronic
1097909023 12:64949271-64949293 CAGCAGCAGCAGCAGCCACATGG - Intergenic
1098893277 12:76031125-76031147 CAGCAGCAGCAACAACAGCCCGG - Exonic
1099070264 12:78037253-78037275 AAGCAGCATCAGCAGAAGCTGGG + Intronic
1100243456 12:92732963-92732985 CACGACCAGCAGCAGCAGCGGGG + Intronic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1100784837 12:98067906-98067928 CAGCAGCAGCCGCATTACCAAGG - Intergenic
1100980560 12:100159145-100159167 CAGCAGCAGGACCAGTACCTGGG - Intergenic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102487154 12:113266283-113266305 CAGCAGCAGCAGCAGGGCCGTGG - Exonic
1102491202 12:113290550-113290572 CAGCTGCAGCAGCAGTGGTGTGG - Intronic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1102997705 12:117362432-117362454 GAGCAGCAGCAACAGCAACGGGG - Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103209548 12:119156573-119156595 CAGCAGCAGCAGTAGCCGCTCGG + Exonic
1103300963 12:119926424-119926446 TAGCAGCAGCAGCAGCACCCAGG + Intergenic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104642008 12:130473416-130473438 CAGGAGCAGCAGCAGCATCTGGG + Intronic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104857778 12:131909939-131909961 CAGGAGCAGCTGCCGCAGCGGGG - Exonic
1105306440 13:19172383-19172405 CAGCAGTGGCAGCAGCAGCAGGG - Intergenic
1105479612 13:20762300-20762322 CAGCAGCATCCCCAGTAGCTGGG + Intronic
1105602588 13:21900500-21900522 CAGCAGCAGAAGCACCAGCCTGG + Intergenic
1106005308 13:25764538-25764560 AAGCAGCAGCGGCAGCAGCCGGG + Intronic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106478359 13:30117158-30117180 CAACAGCAGCAGCAGCACCTGGG + Intergenic
1106587491 13:31069985-31070007 CAGCAGCAGCAACAGAAGACAGG + Intergenic
1106701877 13:32237861-32237883 CAGCAGCAGCTGCTGCAGCCCGG - Exonic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107058521 13:36131250-36131272 CGGCAGCAGCTGCTGGAGCGCGG + Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107702007 13:43058243-43058265 CATCAGCTGCAGCAGTATGGGGG + Intronic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108106592 13:47017209-47017231 CAGGAGCTGAAGCAGTAGCAAGG + Intergenic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108695639 13:52900201-52900223 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1109476618 13:62887320-62887342 CATCAGCAGCAGTGGTAGAGTGG + Intergenic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1110416268 13:75256549-75256571 CAGCAGCATCAGCATTACCTAGG + Intergenic
1110630147 13:77698080-77698102 CGGCAGCAGCAGCAGGTGCGGGG - Intronic
1110819527 13:79898416-79898438 TAGTAGCAGCAGCAGTATCTTGG - Intergenic
1111986488 13:95071290-95071312 CAGAAGCTGCAGCAGTGGAGGGG + Intronic
1112200338 13:97268425-97268447 CAGCAGCAGCAGCATCCGCTGGG - Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112507845 13:99985553-99985575 CGGCGGCAGCGGCAGTGGCGGGG + Exonic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1112663747 13:101544346-101544368 CAGCGGCAGCTGCAGAACCGCGG + Intronic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113462461 13:110491707-110491729 AAGCAGCAGCAGCAACAGCGTGG - Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1113831271 13:113297463-113297485 CAACAGCAGTAGCAGCAGCAGGG - Exonic
1114057406 14:18984240-18984262 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
1114105140 14:19417507-19417529 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114407053 14:22466780-22466802 CAACAGCAGCACCTGCAGCGTGG + Intergenic
1114454416 14:22845924-22845946 CACCAGGAGCAGCAGCAGCACGG - Exonic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1115713572 14:36076884-36076906 CAGCAGCAGCAACAGTGGGATGG - Intergenic
1115888579 14:38001817-38001839 CAGCAACAGCAGCATTAGCTGGG - Intronic
1116051363 14:39807454-39807476 CAGCAGCATCAGCAATATCAGGG - Intergenic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1117835587 14:59802274-59802296 CAGCAGCACCAGCATCAGCTGGG + Intronic
1118038797 14:61895662-61895684 CAGCAGCAGCATCAGTGGTGTGG - Intergenic
1118678292 14:68212431-68212453 CAACAGCAGCACCAGCAGCAAGG + Intronic
1118796172 14:69147368-69147390 CAGCAGCAGTAGCAACAGCATGG + Intronic
1118971724 14:70642791-70642813 TAGCAGCAGCAGCCATAGCCAGG - Intronic
1119260545 14:73235822-73235844 GAGGAGCAGCAGCTGTAGCGGGG - Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119466742 14:74864162-74864184 CAGCAGCATCAGCATTACCTGGG - Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119712101 14:76829775-76829797 CAGCAGGAGCACCAGGAGCCAGG - Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120788834 14:88561219-88561241 CAGCAGAAGCAGGAGTTGTGGGG - Intergenic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121070340 14:91013742-91013764 GACCAGCAGCAGCAGCAGCGTGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121223852 14:92306949-92306971 CAGCAGCAGCAGCATCACCTAGG - Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121461377 14:94081192-94081214 CAGCAGCAACTGCAGTTCCGGGG + Exonic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1122716741 14:103700688-103700710 CGACAGCAGCAGCAGTGGCCTGG + Intronic
1122723676 14:103736387-103736409 CGGCAGCAGGAGCAGCAGCTGGG - Intronic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1122975269 14:105168370-105168392 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1123498053 15:20850180-20850202 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123555284 15:21423808-21423830 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123591529 15:21861139-21861161 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1124491932 15:30163526-30163548 AAGCAGCAGCAGCAGATTCGAGG + Intergenic
1124751605 15:32374791-32374813 AAGCAGCAGCAGCAGATTCGAGG - Intergenic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1125200759 15:37099092-37099114 CAGCGGCAGCAGGAGAACCGGGG + Intronic
1125703624 15:41711188-41711210 CAGCAGCAGCAACAGCAACAGGG + Exonic
1125882157 15:43204321-43204343 CAGCAGCAGCAGCATTTAGGGGG - Intronic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1125990208 15:44099344-44099366 AAGCAGCAGCAGCATTACCTGGG - Intronic
1125999384 15:44195015-44195037 GAGCGGCAGCAGCAGGAGCCTGG - Exonic
1126144107 15:45461349-45461371 CAGGAGCAGCAGCTGTGACGGGG - Intergenic
1126317141 15:47382392-47382414 CTGCCTCAGCAGCAGTAGCTGGG - Intronic
1126468428 15:48982059-48982081 CTGCAGCATCTGCAGTATCGTGG + Intergenic
1126580672 15:50239844-50239866 CAGCAGCATCAGCAGCACCTGGG + Intergenic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1127404809 15:58631517-58631539 CAGCAGCAGCAGCATTATGTGGG + Intronic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127903307 15:63357331-63357353 CAGCAGCAGCAGCATCACCTGGG - Intronic
1128153505 15:65377714-65377736 CAGCAGCGGCAGCAGGAGCCGGG + Exonic
1128338533 15:66803677-66803699 CAGCAGCATCAGCAGCACCTGGG + Intergenic
1128585638 15:68847415-68847437 AAGAAGCAGTAGCAGTAGCAAGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1129208032 15:74048632-74048654 CAGCACCACCAGCACTACCGTGG - Intergenic
1129342632 15:74896199-74896221 CAGCTGCACCAGCAGTACCCAGG + Exonic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1129695056 15:77735725-77735747 CAGCAGCATCAGCATTACCTGGG - Intronic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129919912 15:79311275-79311297 CAGCAGCAGAAGCAGCACGGAGG - Exonic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1129977706 15:79836257-79836279 AAGCAGCAGCAGCAGCACCCAGG + Intronic
1130113914 15:80989723-80989745 CAGCAGCAGCAGCAGGTCAGAGG + Exonic
1130235772 15:82132306-82132328 CATCAGCAACAGCAGTTGCTGGG + Intronic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1132026094 15:98405537-98405559 GAGCAGCAGCAACAGCAGCCTGG - Intergenic
1132199737 15:99943275-99943297 CACGAGCAGCTGCAGCAGCGTGG + Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1202963630 15_KI270727v1_random:151017-151039 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132698549 16:1212557-1212579 GAGCAGCGGCCGCAGAAGCGGGG - Intronic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132953078 16:2575729-2575751 GAACAGCAGCAGCAGCAGCGAGG + Intronic
1132961273 16:2624439-2624461 GAACAGCAGCAGCAGCAGCGAGG - Intergenic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133268705 16:4600172-4600194 CAGCAGCAGCAGAGGTGGCAGGG - Exonic
1133288281 16:4701487-4701509 CCAGAGCAGCAGCAGCAGCGAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133456839 16:5949729-5949751 CAGCAGCAGCAGCATCAACTAGG + Intergenic
1133784313 16:8963248-8963270 CAGCAGCAGCAGCAGAAAGCGGG - Exonic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134388351 16:13795099-13795121 CTGCAGCAGGGGCAGTGGCGGGG + Intergenic
1134438339 16:14282123-14282145 CAGCTGCAGCAGCATTAACTGGG + Intergenic
1134609625 16:15598040-15598062 AAGCAGCACCAGCAGTGGGGAGG + Intronic
1134761522 16:16718951-16718973 CAGCAGCATCAGCACCAGCCTGG + Intergenic
1134984536 16:18640219-18640241 CAGCAGCATCAGCACCAGCCTGG - Intergenic
1135108394 16:19670896-19670918 CAGTAGTAGTAGCAGTAGCTGGG + Intronic
1135147435 16:19974840-19974862 ACTCAGCAGCAGCAGTAGCCTGG + Intergenic
1135183600 16:20295872-20295894 CAGCAGCATCAGCATTACCTGGG - Intergenic
1135189272 16:20341592-20341614 CAGCAGCATCAGCAGCATCCAGG - Intronic
1135228489 16:20682583-20682605 CAACAGCAGCAGCACTATCCAGG + Intronic
1135994516 16:27238121-27238143 CAGCAGCAACAGAGGTGGCGTGG + Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136296586 16:29307489-29307511 CAGCAGCATCAGCAGTGGCAGGG - Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136406468 16:30050793-30050815 CAGGAGCAGCAGCTGTGGTGAGG + Intronic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136550465 16:30979923-30979945 CAGCAGCAGCAGCGATGGGGAGG + Exonic
1137655249 16:50153524-50153546 CAGCAGCAGCAGCCGAGGCCGGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138206874 16:55131742-55131764 CTGCAGCAGCAGCATTACCTGGG + Intergenic
1139099187 16:63744634-63744656 CAGCAGCAGCAGCAGGGTCAGGG - Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139309646 16:66017786-66017808 CAGCTTCAGCAGAAGTAACGTGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139951516 16:70674500-70674522 CAGCAGCAGTAGCAGTGCCAAGG - Exonic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1140894226 16:79310991-79311013 AAGCAGCCGCAGCAGCAGCCAGG - Intergenic
1141062999 16:80892244-80892266 CAGCAGCAGCAGCCGCACCTGGG + Intergenic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141525429 16:84607993-84608015 CAGAAGCAGAAGCACAAGCGAGG + Intronic
1141623631 16:85250051-85250073 CAGGAGCTGCAGCAGGAGCCAGG - Intergenic
1141699417 16:85635619-85635641 CAACTGCAGCAGCAGGAGCTGGG - Intronic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1141989611 16:87602570-87602592 CAGCAGCAGCAGCAATGCGGCGG - Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142058208 16:88013800-88013822 CAGCAGCATTAGCAGTGGCAGGG - Intronic
1143027950 17:3951974-3951996 GACCAGCAGCAGCAGCAGCTGGG + Intronic
1143147538 17:4786311-4786333 CAGCAGCAGCGGCAGCAGCTTGG + Exonic
1143411702 17:6713253-6713275 GAGTGGCAGCAGCAGGAGCGGGG + Exonic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143585514 17:7848511-7848533 CAGCAGGAGCAGTAGTGGTGGGG - Exonic
1143946002 17:10592620-10592642 CAGCAGCATCAGCACCAGCTGGG + Intergenic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1144630701 17:16870756-16870778 CATCAGCAGCAGCAGCCCCGGGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144733404 17:17541472-17541494 CACCGGCCGCAGCAGCAGCGGGG + Intronic
1144814604 17:18025253-18025275 CAGCAGCTGCATCTGTAGCCAGG - Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145713270 17:26995341-26995363 CAGAGGCGGCAGCAGGAGCGGGG - Intergenic
1146889232 17:36494726-36494748 ATGCAGCAGCACCAGTAGCAGGG - Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147964788 17:44188715-44188737 CAACAGTAGCAGCAGCAGCAAGG + Intronic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148238398 17:45984014-45984036 CAGAAGCAGCAGGAGTCGGGAGG - Intronic
1148768845 17:50055736-50055758 CAGCAGCAGCCGCAGGAAAGCGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1149634694 17:58157219-58157241 CAGCAGCAGTAGCCGCAGGGTGG - Intergenic
1150311086 17:64130000-64130022 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151299182 17:73209708-73209730 CAGCAGCAGCATCAATAGCCCGG - Exonic
1151461770 17:74258591-74258613 CAGCAGCAGCAGCTTTACCTAGG - Intronic
1151674067 17:75589016-75589038 CGGGAGCCGCAGCAGGAGCGGGG + Intergenic
1152058682 17:78052237-78052259 GAGCAGCAGCACGAGTAGAGAGG + Intronic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152147031 17:78574596-78574618 CAGCAGCAGCTGCAGAGCCGGGG - Intronic
1152154095 17:78621758-78621780 CAGCAGCAGCAGGAGTGACAGGG + Intergenic
1152415828 17:80161167-80161189 GAGGAGCAGCAGCAGCAGCAGGG + Intergenic
1152650879 17:81492103-81492125 CAGCAGGAGCAGGTGTAGCCAGG + Intergenic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152748429 17:82051686-82051708 CAGCGGCAGTAACAGCAGCGCGG + Exonic
1152788078 17:82262262-82262284 CAGCTGCTTCAGCAGTAGCCTGG + Intronic
1152809487 17:82374842-82374864 CAGCAGCAGCGCCAGCAGCCAGG - Exonic
1152941744 17:83176441-83176463 CAGCAGCAGCAGCGGAGGCTGGG + Intergenic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1154456054 18:14526609-14526631 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1154979346 18:21489715-21489737 CACCAGCAGCAGCAGCACCTGGG - Intronic
1155457563 18:26035040-26035062 CCCCAGCAGCAGCAGTACCCAGG - Exonic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156344728 18:36246822-36246844 CACCAGCTGCAGCAGTAGAAGGG + Intronic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1156666814 18:39418594-39418616 AAGAAGCAGCAGCAGCAGCAAGG + Intergenic
1157108081 18:44793468-44793490 CAGAAGCAGCAGCATTACCTGGG + Intronic
1157113094 18:44839398-44839420 CAGCAGCAGCAGCAACACCCAGG - Intronic
1157226315 18:45868245-45868267 CAGCAGCATCAGCATTACCTGGG - Intronic
1157306407 18:46520685-46520707 CACCATCAACAGCAGTAGAGTGG - Intronic
1157610075 18:48950534-48950556 CAGCAGCAGCAGCAGGGGCCCGG + Exonic
1158312468 18:56172964-56172986 CAGCAGCATCAGCATTACCTGGG - Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160159256 18:76459158-76459180 CAGACGCTGCAGCAGTAACGGGG + Intronic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160377372 18:78423188-78423210 CGGCAGCAGCAGCAATAGCAGGG - Intergenic
1160455505 18:78996192-78996214 TCGCAGCAGCAGCGGTAGAGCGG + Intronic
1160779829 19:872787-872809 GGGCAGCAGCAGCAGAAGCAAGG + Intronic
1160796025 19:945792-945814 CAGCACCAGCAGCAGGAGCCGGG - Intronic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161084903 19:2330483-2330505 CACCAGAAGCAGCATAAGCGGGG + Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161708265 19:5832493-5832515 CAGCAGCTGAAACAGCAGCGTGG + Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162496927 19:11028594-11028616 GAGCAGCAGCTGCCGTAGAGAGG + Intronic
1162717154 19:12641374-12641396 GAGCCGCAGAAGCAGTGGCGGGG - Intergenic
1162870160 19:13580438-13580460 CAGCAGCAGCAGCATCACCTAGG + Intronic
1163158753 19:15452694-15452716 GAGCAGCAGGAGCAGCTGCGGGG - Exonic
1163186259 19:15641465-15641487 CAGCAGCAGGAGCAGCCACGGGG - Exonic
1163222824 19:15934337-15934359 CAGCAGCAGAAGCAGCCACGGGG + Exonic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1163847821 19:19647162-19647184 CAGCAGCAGCCCCTGTAGGGTGG + Exonic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1164711662 19:30361282-30361304 CAGCAGCAGTAGCAGCATCAAGG - Intronic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165357853 19:35314928-35314950 CAGCAGCATCAGCAGCACCCAGG + Intergenic
1165364834 19:35359066-35359088 CAGCAGCAGGAGCAGGTCCGAGG - Exonic
1165366653 19:35371535-35371557 CAGCAGCAGGAGCAGGTCCGAGG - Exonic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165485161 19:36091016-36091038 CAGCAGTAACAACAGTAGCCAGG - Intronic
1165907808 19:39204228-39204250 CAGCAGCAGCGGGCGCAGCGGGG + Exonic
1166141540 19:40807941-40807963 CAGAAGCAGCAGCGGTGGCAGGG - Exonic
1166218853 19:41353012-41353034 CAGCGGCAGCAGCCGCAGCCCGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167034030 19:46982715-46982737 CAGCAGCAGCAGCATCATCTGGG + Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167498964 19:49835154-49835176 AAGCTGGAGCAGCAGCAGCGAGG + Exonic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167617215 19:50541932-50541954 TAGCAGCAACAGCAGCAGAGTGG + Intronic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1167785216 19:51630306-51630328 CAGCAGGGGCAGCAGCAGCAGGG + Intronic
1167787315 19:51646730-51646752 CAGCAGGGGCAGCAGCAGCAGGG + Exonic
1167964524 19:53132501-53132523 CAGCTGCAGCCGCAGTCCCGGGG - Intronic
1168050620 19:53826932-53826954 CACCACCTGCAGCAGTGGCGTGG - Intergenic
1168649736 19:58085554-58085576 CATCTGCAGCAGCAGGCGCGGGG - Intronic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
1168721914 19:58558862-58558884 CGGCAGCAGCGGCTTTAGCGCGG + Exonic
925354389 2:3227770-3227792 CAGCTGGAGCAGCAGCAGCTGGG - Intronic
925394571 2:3523786-3523808 CAGGAGCAACAGCGGTAGCAGGG + Intergenic
925470290 2:4153713-4153735 AAACAGCAGCAGCAGCAGCCTGG - Intergenic
925568026 2:5277717-5277739 TAGCAGCAGGAGCAGCAGCAGGG + Intergenic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
925733714 2:6942483-6942505 TAGCAGTAGCAGCAGCAGCAGGG + Intronic
926021422 2:9499054-9499076 CAGCAGCAGCAGCATCACCTGGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926689911 2:15725974-15725996 CAGCAGCACCAGCAGTGGAGAGG - Intronic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
928097269 2:28412379-28412401 CCGCAGAAGCAGTAGCAGCGGGG + Exonic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928437940 2:31267935-31267957 CAACAGCACCAGCAGGAGAGTGG + Exonic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928983506 2:37158479-37158501 CAGCAGCAATGGCAGTAGCAAGG + Intergenic
929026698 2:37611707-37611729 CAGCAGCATCAGCATCAGCTGGG + Intergenic
929261732 2:39873439-39873461 GAGCAGCAGCAGCGGCAGCAAGG - Intergenic
929335301 2:40736377-40736399 GAGCAGCAGTATCAGTAGCAAGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929604396 2:43225533-43225555 CGGCAGCAGCTGCGGCAGCGCGG - Exonic
929615481 2:43303927-43303949 CAGCAGCATCAGCATTACCTGGG - Intronic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930209214 2:48617344-48617366 CAGCAGCATCAGCAGCATCTGGG - Intronic
930716104 2:54595561-54595583 GAGCAGCAGCACCAGCAGCATGG - Intronic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932593710 2:73081500-73081522 CGGCAGCAGTGGCAGCAGCGGGG + Intronic
932596246 2:73095448-73095470 CAGCAGCAGCATGGGTAGCTGGG - Intronic
932682242 2:73836319-73836341 CAGGAGCAGCAGCTGTTGCAGGG + Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933796138 2:85921308-85921330 CAGCAGCAGCAGCAGGTTCCTGG - Intergenic
933881450 2:86673967-86673989 CAGCAGCACCAGCAGCACCTGGG - Intronic
934049199 2:88196191-88196213 GAGCAGCAGGGGCAGGAGCGGGG - Intergenic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936661340 2:114547300-114547322 CAGCAGCAGCAGCCGTGACTGGG - Intronic
936712065 2:115142886-115142908 CACCACCAGCAGCAGCAGCAAGG - Intronic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
936906006 2:117536398-117536420 AAGCAGGAGCAGCAGCAGCAAGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937076277 2:119109362-119109384 CAGCAGCAAGAGCATTAGCTGGG + Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937630165 2:124092365-124092387 CAGCAGCAACAACAGTAATGGGG - Intronic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938284886 2:130103801-130103823 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
938334390 2:130477850-130477872 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
938335530 2:130492353-130492375 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
938354294 2:130628315-130628337 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
938355436 2:130642818-130642840 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
938430718 2:131235089-131235111 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
938693686 2:133815742-133815764 CAGCAGCAGTGGCAGCAGCAGGG - Intergenic
938693709 2:133815855-133815877 CAGTAGCAGTGGCAGTAGCAGGG - Intergenic
938854847 2:135298975-135298997 CATCAGCTGCAGCAGTATAGGGG + Intronic
938876053 2:135531995-135532017 CAGCAGCAGCAGCCATGGCAGGG - Intronic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939668198 2:144976798-144976820 GAGCAGCAGCAGCAGTGGGAGGG - Intergenic
939986343 2:148833153-148833175 CAGCAGCACCAGCAGCACCTGGG - Intergenic
940031023 2:149261418-149261440 CAGCAGCAACAGCAGTAGTTTGG + Intergenic
940227070 2:151410700-151410722 GCGCAGCAGCAGCAGTACCCGGG - Intronic
940575870 2:155503318-155503340 CAGCAGGGGCAGCAGTGGCACGG + Intergenic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941389571 2:164894990-164895012 CAGCAGCAGCAGCATCACCTGGG + Intergenic
941906116 2:170716873-170716895 CAGCAGCGGCCGCAGAGGCGGGG - Exonic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942139780 2:172966459-172966481 GAGCAGCAGCAGCAGCATCTGGG - Intronic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942294904 2:174507788-174507810 AATAAGCAGCAGCAGTAGCTAGG + Intergenic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
943492271 2:188569622-188569644 CAGCAGAAGCAGCAGATGCTGGG + Intronic
944599392 2:201288033-201288055 CAACAGCAGCCTCAGTAGAGGGG - Intergenic
944643784 2:201756854-201756876 CAGCAGCATCAGCAGCATCTGGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
945181573 2:207097063-207097085 CAGCAGCATCAGCATCAGCTGGG - Intronic
945251368 2:207768689-207768711 TAGGAGCAGCAGCAACAGCGAGG + Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947140451 2:227015343-227015365 CAGCAGCAGCGGCAGCACCTGGG + Intronic
947205599 2:227658288-227658310 CAGCAGCAGCAGCAACACCTGGG - Intergenic
947263493 2:228251554-228251576 CAGCAGCAGTGGCAGTGGGGTGG + Intergenic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
948006851 2:234616801-234616823 CGGCAGTAGCAGCAGAAGCGAGG + Intergenic
948174703 2:235934112-235934134 CAGCAGCAGCAGCAGCCCCTGGG + Intronic
948584385 2:239009771-239009793 CAGTGGCCGCAGCAGTAACGTGG + Intergenic
1168957543 20:1844898-1844920 CAGCAGCAGCCCCAGAAGGGTGG - Intergenic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169195917 20:3681951-3681973 TAGTAGCAGCAGCAGCAACGGGG + Exonic
1169336160 20:4759329-4759351 AAGCATCAGCTGTAGTAGCGTGG + Intergenic
1169832506 20:9839448-9839470 CAGCAGCAGCATCACCTGCGAGG - Intergenic
1169847729 20:10013783-10013805 CAGCAGCAACAGCATTACCTGGG + Intronic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1170330200 20:15201049-15201071 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1170331199 20:15212823-15212845 CAGCAGCATCAGCAGCATCTGGG + Intronic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170634902 20:18095653-18095675 CAGCAGCAGCAACAGCACCTGGG - Intergenic
1170664887 20:18378290-18378312 CAGGACCAGAAGCAGCAGCGAGG + Intergenic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1170804981 20:19621716-19621738 CAGCAGCAGCAGCAGAACCCAGG - Intronic
1170855299 20:20047704-20047726 CAGGAGCAGCAGCAGCATCCAGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171071271 20:22070645-22070667 CAGCAGCATCAGCACCAGCTAGG - Intergenic
1171180255 20:23086160-23086182 CAGCAGCAGCAGCAGGCCCATGG + Exonic
1172042296 20:32053868-32053890 CAGCAGCAGCAGCATCACCGGGG - Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172555853 20:35840661-35840683 CAGCAGCAGCAGCAACATCTGGG + Intronic
1172970930 20:38872620-38872642 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1173331778 20:42081297-42081319 CAGCAGCAGCATCATTATCTGGG - Intronic
1173563143 20:44020622-44020644 CAGCAGCAGCAGCATTGCCTGGG + Intronic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174157722 20:48527606-48527628 CAACAGCAGCAGCAATGGAGAGG - Intergenic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174428682 20:50451662-50451684 CAGCAGCAGCAGCAATAAACTGG - Intergenic
1174580349 20:51567014-51567036 CAACAGCAGCAACAGGAACGTGG + Intergenic
1174734998 20:52957392-52957414 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175420039 20:58825891-58825913 GTGCAGCAGCAGCAGTGGCAGGG - Intergenic
1175429560 20:58891842-58891864 CAGCAGCAGCAGGCGGTGCGTGG - Intronic
1175443530 20:59006351-59006373 CAGCAGGAGCCGCAGTATTGGGG + Exonic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175549085 20:59805054-59805076 CAGCAGCATCTGCAGTGGCAGGG + Intronic
1175564049 20:59958752-59958774 CACTAGAAGCAGCAGCAGCGAGG - Exonic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175668010 20:60876902-60876924 AAGCAGCAGTGGCAGCAGCGGGG - Intergenic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176818108 21:13626731-13626753 CAGCAGCAAGAGCAGGAGCGAGG - Intronic
1177174401 21:17689037-17689059 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177534786 21:22410294-22410316 CAGCAACAGCAGCTGTAACCTGG + Intergenic
1178254951 21:31043981-31044003 CAGCATCTGCAGCAGGAGCCTGG - Intergenic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1178636732 21:34310045-34310067 CAGCAGCATCAGCAGCACCTGGG - Intergenic
1178728062 21:35072773-35072795 CAACAGCAGCAGCAGTGTGGTGG + Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178973380 21:37201008-37201030 GGGCAGCAGCAGCAGGAGTGTGG + Intronic
1179163032 21:38913276-38913298 CAGCAGCAGCAGGAGTCACCTGG + Intergenic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180009501 21:45040319-45040341 CCACAGCAGCAGCAGCAGCATGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180054075 21:45348106-45348128 CAGCAGCAGCAGCCCGAGAGTGG + Intergenic
1180475895 22:15706849-15706871 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
1180614872 22:17120598-17120620 CAGCCGCAGCAGCAGCAACACGG + Exonic
1180614979 22:17120962-17120984 CAGCACCAGCACCAGCCGCGGGG - Exonic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181185771 22:21102678-21102700 CAGCAGCAGCAACAGGACCTAGG - Intergenic
1181493942 22:23277504-23277526 CAGCAGCAGCAGCAGGGGATGGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181560174 22:23695431-23695453 CAGCAGCAGCAGCAGAGGCCTGG - Intronic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1181665343 22:24391682-24391704 TGGCAGCAACAGCAGTAGCTTGG + Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182254886 22:29031044-29031066 CAGGGGCAGCGGCAGGAGCGGGG - Intronic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182445116 22:30385496-30385518 CAGCAGCAGCAGTGGCAACGGGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182509115 22:30806484-30806506 CAGCAGCCGCAGCAGTAAACAGG + Intronic
1182652217 22:31861326-31861348 AAGCAGCAGCAGCAGTTGCAAGG - Intronic
1182788062 22:32924487-32924509 CAGCAGCATCAGCAGCATCCAGG + Intronic
1182894798 22:33850212-33850234 CACCAGCAGCAGCAATAACACGG + Intronic
1183270319 22:36858219-36858241 CAGCAGGAGCAGCAAGAGCCCGG + Intergenic
1183485601 22:38086271-38086293 CAGCAGCCGCCGCAGCAGCATGG - Exonic
1183509868 22:38228415-38228437 CAGCAGCAGCAGCAGAGCCCAGG + Intronic
1183719509 22:39554343-39554365 CAGCAGCTGCTGCAGCAGCAAGG + Intergenic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184027247 22:41866952-41866974 CAGCAGCAGCAGCAATGGCAGGG + Exonic
1184235489 22:43180869-43180891 CAGCAGCTGCAGCAGGTGCCCGG - Exonic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184588448 22:45463804-45463826 CAGCAGCTTCAGCTGTAGCTGGG - Intergenic
1184601605 22:45547098-45547120 CAGCAGCAGCCCCTGTAGCCAGG + Exonic
1184696543 22:46142654-46142676 CGGCAGAAGGAGCAGGAGCGGGG - Intergenic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185045314 22:48525681-48525703 CAGCAGCAGCAGCAGCTTCTGGG - Intronic
1185141709 22:49106295-49106317 CAGCAGTAGCAGCAGATGCCTGG - Intergenic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
1185344045 22:50303765-50303787 CAGCAGCAGCATCAGAGGCAGGG - Intronic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
949376868 3:3400568-3400590 CAGCAGCAGTGGCAGTGGGGTGG + Intergenic
949604003 3:5634196-5634218 AAGCATCAGCTGTAGTAGCGTGG + Intergenic
949743507 3:7263412-7263434 CAGCAGTGGCAGCAGCAGCATGG + Intronic
949829999 3:8204109-8204131 CAGCAGCATCAGCATTACCCAGG - Intergenic
949918795 3:8985590-8985612 CAGCAGCAGCAGCTCGGGCGTGG - Exonic
950040272 3:9915554-9915576 GAGCAGCAGCAGCGGGCGCGGGG - Exonic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
951109233 3:18782426-18782448 CAGCAGCAGCAGCACTGCCTGGG + Intergenic
951337859 3:21446147-21446169 CAGCAGCAACAGCAATACCTGGG - Intronic
951372417 3:21866634-21866656 CAGCAGCATCAGCATTACCTGGG - Intronic
951477199 3:23119469-23119491 GAACAGCAGCAGCAGCAGGGGGG - Intergenic
951529179 3:23682747-23682769 CAGCAGCAACAGCAGCACCTGGG - Intergenic
951592104 3:24277513-24277535 CAGCAGCATCAGCATCACCGGGG - Intronic
951689575 3:25381712-25381734 CAGCAGCATCAGCATTACCTGGG + Intronic
951995196 3:28719729-28719751 CAGCAGCAGCAGCATCACCTGGG - Intergenic
952055118 3:29434811-29434833 CAGCAGCAACAACAGCAGCGGGG + Exonic
952192732 3:31041367-31041389 CAGCAGCAATAGCAGCAGCTGGG + Intergenic
952287298 3:31981223-31981245 CAGCAGCAGCCGCCGTGCCGGGG - Exonic
952336400 3:32407001-32407023 CAGCAGCACCCGCAGTAGCTGGG + Intronic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952662725 3:35871124-35871146 CAGCAGCAGCAGCATTGCCAGGG + Intergenic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953563449 3:44012390-44012412 GAGGAGCAGCAGCAGTAGGCTGG - Intergenic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
953886602 3:46717732-46717754 CAACAGAAGCAGCAGCAGCAGGG + Exonic
954206532 3:49063281-49063303 CAACAGCAGCAGCAGCATCCAGG + Intronic
954293280 3:49660950-49660972 CAGGAGCAGCGGCAGTGGCAGGG - Exonic
954408426 3:50358533-50358555 CAGCAGCGCCAGCAGCAGCATGG + Exonic
954409611 3:50364723-50364745 CAGGAGGAGCAGCAGTTGCAGGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954992146 3:54850690-54850712 CAGCAGCTGCAGCAATGGCAGGG + Intronic
955661829 3:61307666-61307688 CAGCAGCATCAGCATTACCTGGG + Intergenic
955811141 3:62791419-62791441 CAGCAGCATCAGCATTATCTGGG + Intronic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956339883 3:68210666-68210688 TAGTAGCAGCAACAGTAGGGTGG - Intronic
956423865 3:69112729-69112751 AAGCAGCAGCAGCATTACCAGGG + Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956716563 3:72085218-72085240 CAGCAGCAGCTGCAGCTGCATGG + Intergenic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
956813608 3:72888280-72888302 CAGCAGCGCCAGCAGCAGCGCGG - Exonic
957246970 3:77727930-77727952 CAGCAGCAATAGCAGTATCCTGG - Intergenic
957723901 3:84039441-84039463 CAGCAGCAGCAGTACTAGGAAGG + Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
958919101 3:100083351-100083373 CAGCAGCATCAGCATTACCTGGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959362529 3:105411443-105411465 TAGTAGCAGCAGCAGCAGCTGGG + Intronic
959389200 3:105752870-105752892 CAGCAGCAGCAGCAGCCTCAGGG - Intronic
959530622 3:107431138-107431160 CAGTGGCAGCAGCAGAACCGGGG + Intergenic
960198908 3:114807430-114807452 CAGCAGCAGCTGCAGGGGAGGGG - Intronic
960687417 3:120307920-120307942 GAGCAGGAGCAGCAGCAGCAAGG + Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960774781 3:121237307-121237329 CAGCAACCCCAGCAGTAGCTGGG + Intronic
961133455 3:124489724-124489746 CAGCAGCAGCAACAGCACCTGGG + Intronic
961856710 3:129878734-129878756 CAGCAGCAGCAGCAGCACCTGGG + Intronic
961994084 3:131222726-131222748 CAGCAGCATCAGCATCAGCTGGG + Intronic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
962469776 3:135695922-135695944 CAGCAGCATCAGCATTAGATAGG + Intergenic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
963100846 3:141602464-141602486 CAGCAGGAGCAGCAGTGGGTGGG - Intronic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
963258028 3:143165726-143165748 CAGCAGCAACAGCATTACCTGGG - Intergenic
963430008 3:145188614-145188636 CAGCAGCACCAGCAGCATCTGGG + Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964317804 3:155462752-155462774 TGGCAGCAGCAACAGTAGCTGGG - Intronic
964622625 3:158732329-158732351 CAGCAGCAGCGCGAGCAGCGGGG + Exonic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
965733528 3:171797402-171797424 CAGCAGCATCAGCATTATCTCGG + Intronic
966089402 3:176114400-176114422 CAGCAGCAGGGGCAGTGGCATGG - Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966860608 3:184229488-184229510 CAGCAGCAGCAGGCGTGGCCAGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967115422 3:186333192-186333214 CAGCAGCATCAGCACCACCGGGG + Intronic
967214029 3:187194921-187194943 CAGCATCCCCAGCAGTAGCAGGG + Intergenic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967681572 3:192370002-192370024 GAGCAGCACCAGCAGGAGCAAGG + Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968509608 4:989655-989677 CAGCAGCACCAGCAGCACCACGG + Exonic
968542001 4:1172545-1172567 CGGCAGGAGCAGCGGGAGCGCGG + Exonic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
970689609 4:18607415-18607437 CAGCAGCAGCGGCATCAGCTGGG - Intergenic
971183090 4:24349306-24349328 CATCAGCTGCAGTAGTAGTGTGG + Intergenic
971197446 4:24482992-24483014 CAGCAGCAGCAGCAGCCTCCAGG - Intergenic
971516308 4:27490941-27490963 CAGCAGCAGCATCAGGAACCAGG - Intergenic
972083431 4:35182705-35182727 CAGCAGCAGTAGCAGTGTGGTGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972448228 4:39167799-39167821 CAGCAGCAGCAGCACAATCTTGG - Intergenic
973160967 4:47015972-47015994 CAGCAGCTGGAGTATTAGCGAGG + Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974685725 4:65225616-65225638 CAGCAGGAGCAGCAGTGCCCAGG - Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976122650 4:81800033-81800055 CAGCAGCAGCAGCAGAGGAAAGG + Intronic
976171733 4:82311356-82311378 AATAAGCAGCAGCAGTAGCCAGG - Intergenic
976433111 4:84986523-84986545 AAGCAGCAGCAGGAGTTGAGAGG + Intergenic
976441840 4:85084980-85085002 CAGCAGGAACAGCAGCAGCTGGG - Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
978189445 4:105895514-105895536 CGGGAGCGGCAGCAGTAGCCCGG + Exonic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978441883 4:108741800-108741822 CAGCAGCAGTAGCTGAAGCAGGG - Intergenic
978442009 4:108743399-108743421 CAGCAGAAGCATTAGTAGGGAGG - Intronic
978689005 4:111484026-111484048 CAGCAGCACGAGCAGCAGCATGG - Intergenic
978833384 4:113116678-113116700 CGGCAGTAACAGCAGTAGCACGG + Intronic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979471889 4:121108705-121108727 CAGCAGCAGCAACATCAGCTGGG - Intergenic
979544732 4:121926827-121926849 CAGCAGCATCAGCAGCACCTGGG + Intronic
979678065 4:123431163-123431185 AAGAAGCAGCAGCAGCAGCAGGG - Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980532149 4:134070303-134070325 CAGCAGCAGCGGCAGTGTGGTGG + Intergenic
980550273 4:134327075-134327097 GAGAAGCAGCAGCAGGAACGAGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980920776 4:139083870-139083892 GAGCAGCAGCAGCAGCTGCCGGG - Intronic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981671094 4:147287773-147287795 CAGCAGCAGCAGCATGACCTGGG + Intergenic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
982257627 4:153466237-153466259 CAGCAGCTGCGGCAGCGGCGGGG + Intergenic
982363983 4:154555224-154555246 CTCCAGAAGCAGCAGTAGTGAGG - Intergenic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983823392 4:172225820-172225842 CAGCAGCATCAGCATTACCTGGG - Intronic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984134418 4:175917376-175917398 CAGCAGCAGCATCTGTAGCAGGG - Intronic
984144388 4:176043844-176043866 CAGCAACAGTAGCTGTAGCAAGG + Intergenic
984536539 4:180982929-180982951 TAGCTGTAGCAGCAGTAGAGGGG - Intergenic
984565111 4:181319836-181319858 CAGTGGCAGCAGCAGTACCCGGG - Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984810960 4:183796552-183796574 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985986497 5:3520851-3520873 CAGCTGCTGCAGCAGGAGCCAGG + Intergenic
986296937 5:6447072-6447094 CACCAGCAGCAGCGGCAGCAAGG + Intergenic
986447271 5:7832317-7832339 GACCAGCAGCAGCAGGAGCTGGG - Intronic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
986617847 5:9638586-9638608 CACCAGCTGCAGTAGTAGCAGGG + Intronic
987385839 5:17328530-17328552 CAGCAGCAGCAGCATCACCTGGG - Intergenic
988889494 5:35599223-35599245 CACCAGCTGCAGTAGTAGCAGGG - Intergenic
988902262 5:35745807-35745829 GAGCATCAGCTGTAGTAGCGTGG - Intronic
989267526 5:39494752-39494774 CAGCAGCTGTAGCAGTACCTGGG - Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991433402 5:66571599-66571621 CAGCAGCATCAGCAGCACCTTGG + Intergenic
991654257 5:68887278-68887300 CAGCAGCAGCAGTAGCTGCAAGG + Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
992185638 5:74241859-74241881 CAGTAGCAGCAGCATTACCTGGG + Intergenic
992690423 5:79236211-79236233 CTGCAGCAGCACCAGGGGCGGGG + Exonic
993335004 5:86646120-86646142 AAGCAGCAGCAACAGTGGGGAGG - Intergenic
994150559 5:96442783-96442805 CAACAGCAGCAGCAGTGGTAGGG - Intergenic
994320717 5:98392013-98392035 CAGCCGCAGGAGCAGTAGTCTGG + Intergenic
994353907 5:98774150-98774172 CAGCAGCAGCTCCAGCGGCGGGG - Exonic
994613811 5:102078429-102078451 CCCCAGCAGCAGCAGTATTGTGG - Intergenic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
995026228 5:107426365-107426387 CAGTAGCAGCAGCAGCATCTGGG + Intronic
995052747 5:107724809-107724831 CAGCAGCAGCAGCAGAAAGTGGG + Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
995304713 5:110631541-110631563 CAGTGGCAGCAGCAGTGGCTGGG - Intronic
995963374 5:117873008-117873030 CAGCAACAGCAGCAGTTCAGAGG + Intergenic
996167011 5:120236611-120236633 TTCCAGCAGCAGCAGCAGCGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
997182166 5:131841342-131841364 CAGCAGTAGCAGCAGTGTGGTGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998043305 5:138967225-138967247 CAGCAGCACCAGCAGTATCTGGG + Intronic
998059024 5:139104603-139104625 CAGCATCACCAGCACTAGCCTGG + Intronic
998430542 5:142066178-142066200 CAGGGGCAGCAGCAGAAGCCAGG + Intergenic
998510493 5:142709855-142709877 CAGAAGCAGCAGCATTTGAGAGG + Intergenic
998563284 5:143192331-143192353 CAGCAGCACCAGCAGGAACATGG + Intronic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
998940870 5:147280615-147280637 CCACAGCAGCAGCAGCAGCAAGG + Intronic
999062806 5:148654127-148654149 CAGCGGCGGCAGCAGAAGCTCGG - Exonic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999337549 5:150735159-150735181 AAGCATCAGCTGCAGTAGTGTGG - Intronic
999861303 5:155649618-155649640 AAACAGCAGCAACAATAGCGTGG - Intergenic
1000014694 5:157266458-157266480 GAGCCGCAGCAGCAGGTGCGCGG + Intronic
1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG + Intronic
1000782537 5:165500563-165500585 AAGCAGCAGCAGCATTTGAGAGG - Intergenic
1000839786 5:166203919-166203941 CATCAGCAGCAGCAGTATTAAGG - Intergenic
1000990171 5:167903715-167903737 CAGCAGCATCAGCAGCATCTGGG + Intronic
1001108566 5:168876307-168876329 CAGCTTCAGCAGCAGTGGGGAGG - Intronic
1001482282 5:172096527-172096549 CAGCAGCATCACCAGTAACAAGG - Exonic
1002276677 5:178108500-178108522 CAGAAGCAGTAGCAGTGGCTTGG + Intergenic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002618556 5:180470312-180470334 GGCCAGCAGCAGCAGTAGCTGGG - Intergenic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1003072055 6:2952693-2952715 CAGCAGGAGGCGCGGTAGCGGGG + Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003624158 6:7727298-7727320 CAGCAGCAGCAGCTGCCTCGCGG + Exonic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004518897 6:16344029-16344051 CAGCAGCATCAGCAGCATCTGGG - Intronic
1004520603 6:16357996-16358018 CAGAAGCAGCACCAGTACCCGGG + Intronic
1004675864 6:17841548-17841570 AAGCAGCAGCAGCAGAGGGGTGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1005033921 6:21537823-21537845 CAGCAGCTGCAGCAGTTGGAGGG - Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1005883638 6:30078233-30078255 CAGCCGCACCAGCAGTGGCTCGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006059981 6:31412362-31412384 CAGCAGCAACAGCAGAAACATGG - Exonic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1006428950 6:33983400-33983422 GAGCCCCAGCAGCAGGAGCGAGG - Intergenic
1006500840 6:34457927-34457949 CAGCAGCTGCAGCTGTACCCTGG - Intergenic
1006572497 6:35017483-35017505 GAGCAGCAGCAGCCGGAGCCAGG + Exonic
1006751724 6:36382395-36382417 CAGCAGCATCAGCATTACCCAGG + Intronic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007506320 6:42337938-42337960 CAACAGCAGCAGCAGCACCTAGG + Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1007680287 6:43629051-43629073 CGGCAGCAGCAGCGGCTGCGGGG - Exonic
1007769877 6:44183959-44183981 TACCAGCAGCAGCAGCAGCGAGG + Exonic
1007774512 6:44217476-44217498 CAGCAGCGGGAGCAGTGGCGTGG - Intergenic
1007886189 6:45232897-45232919 CAGGAGCAGCAACAGTGGCTGGG + Intronic
1008036461 6:46750024-46750046 CAGCAGCAGCAGCAGCCCCTGGG - Intronic
1008383662 6:50862172-50862194 CAGCAGTAGCAGCAGAAGCAAGG + Intergenic
1008469373 6:51866040-51866062 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1008662581 6:53683347-53683369 CAGCAGCAGCAACAGTATCTGGG - Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1009908759 6:69901546-69901568 AAACAGCGGCAGCTGTAGCGTGG - Intronic
1010083140 6:71886860-71886882 CAGCAGCAGCAGCAGAGCCGGGG - Intronic
1010741724 6:79514069-79514091 CAGCATCATCAGCATTAGCATGG + Intronic
1011016912 6:82767153-82767175 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1011019902 6:82801336-82801358 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011530228 6:88312892-88312914 CAGCAGCAGCAGCTGCACCTGGG + Intergenic
1011744153 6:90393079-90393101 TAGTAGCAGCAGCAGTAGCTAGG + Intergenic
1012228963 6:96737737-96737759 CAGCAGCAGCAGGGCTAGAGGGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012548893 6:100449952-100449974 CAACAGCAGCAGCAGTTCCCTGG + Intronic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012668918 6:102015653-102015675 AAGCAGTAGCAGCAGCAGCACGG - Intronic
1012964401 6:105657686-105657708 CAGCAGGAGCAGCAGAGGGGTGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014010249 6:116467321-116467343 CAGCCCCAGCAGCAGCAGCCAGG + Intergenic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014592146 6:123286841-123286863 CAGCAGCAGCAGCAGCACCTGGG + Intronic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1017327082 6:153151983-153152005 CTGCAGCAGCAGCAGTACTCTGG - Intergenic
1017647765 6:156554942-156554964 CAGCAGCAGCCACAGTAGCAAGG - Intergenic
1017840905 6:158222295-158222317 CAGCAGCAGAAGCAGTCATGGGG - Intergenic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018238704 6:161751949-161751971 CAGCATCTGCAGGATTAGCGAGG + Intronic
1018826560 6:167412150-167412172 CAGCAGCAGCAGCATTGCCTGGG + Intergenic
1018934851 6:168267058-168267080 CCGCAGCAGCAGCAGCTGCTAGG - Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019724113 7:2591515-2591537 CAGCAGCAGCAACAAGAGCTAGG + Intronic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021429412 7:20543185-20543207 CAGCAGCAGCAGCATCACCTTGG + Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1021564996 7:22008202-22008224 CAGGAGAAGCAGCAGTAGACAGG + Intergenic
1021570149 7:22056915-22056937 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1021731292 7:23597710-23597732 CCGCAGCAGCGGCCCTAGCGGGG - Intronic
1022174797 7:27862721-27862743 AGGCAGCAGCAACAGAAGCGTGG - Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1023418304 7:39951436-39951458 CAGCAGCAGTAGCAGCCGCAAGG + Exonic
1024004151 7:45212946-45212968 CAGCAGTAGCAGCACTAGAAGGG + Intergenic
1024101504 7:46037128-46037150 CAGCAGCAGCAGCACCAACAGGG + Intergenic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024306947 7:47937391-47937413 CAGGAGCAGCAGAAGTCTCGTGG + Intronic
1024607946 7:51038278-51038300 CAGGTGCTGCAGCAGCAGCGAGG + Intronic
1025014485 7:55427903-55427925 CAGCAGCAGCAGCTGTGGAGGGG + Intronic
1025106556 7:56175493-56175515 CAGCTGCAGCGGGAGGAGCGCGG + Intergenic
1025207876 7:57003949-57003971 CAGCAGCAGCAGCAGTGGCTCGG + Intergenic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026402368 7:70027498-70027520 CAGCAGCAGCAGCATCACCTGGG + Intronic
1026734915 7:72943233-72943255 CAGCAGCGGGAGCAGCAGCTCGG + Exonic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026785248 7:73298148-73298170 CAGCAGCGGGAGCAGCAGCTCGG + Intergenic
1026822177 7:73557258-73557280 CAGCAGCCGCAGCAGGTGGGCGG + Intronic
1027041458 7:74964575-74964597 CAACAGCAGCAACAGCACCGGGG + Intergenic
1027082182 7:75237792-75237814 CAACAGCAGCAGCAGCACCGGGG - Intergenic
1027108826 7:75421776-75421798 CAGCAGCGGGAGCAGCAGCTCGG - Exonic
1027427905 7:78080725-78080747 CAGCAGTAGAAGCAGTAGACAGG + Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028774677 7:94663739-94663761 CAGCAGCTGCTGCAGCACCGCGG - Exonic
1028849059 7:95515833-95515855 CAGCAACAGCAGCAAAAGCAAGG - Intronic
1028962545 7:96765491-96765513 GAGCAGCAGCAGCAGCAGCTGGG - Intergenic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029152133 7:98488207-98488229 CAGGAGCAGCAGCAGAACCTGGG + Intergenic
1029331410 7:99859255-99859277 CAGCAGCACCAGCAGCATCTGGG - Intronic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029547322 7:101217230-101217252 CGGCAGCAGCAGCAGGAACCGGG + Exonic
1030058909 7:105607544-105607566 CAGTAGCAGCATCAGGAGCTAGG + Exonic
1030861052 7:114629967-114629989 CAGCAGCAGCAACAGCATCCTGG + Exonic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031596847 7:123658784-123658806 CAGCAGCATCAGCATTACCTGGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033280924 7:140005901-140005923 CAGCAGCAGCAGCATCACCCGGG - Intronic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1033885840 7:145943502-145943524 CAGCAGTGGCAGCAGTAGATTGG - Intergenic
1034261958 7:149762860-149762882 CAGCAGCATCAGGAGCAGCTGGG - Intergenic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034366351 7:150551805-150551827 TAGCAGCAGCAGCAGAACAGTGG - Intergenic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034454004 7:151155031-151155053 CAGCAGGAGCTGCAGTAATGGGG - Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1035530157 8:345111-345133 CAGCAGCAGCAACAGGGGCTGGG - Intergenic
1035686674 8:1528486-1528508 CACCAGGAGCAGCAGCAGCTAGG + Intronic
1036422127 8:8606854-8606876 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036612211 8:10360116-10360138 CAGCAGCAGCAGCACACGCAAGG - Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037823527 8:22147365-22147387 CAGCAGCAGAAGCAATCCCGGGG - Exonic
1037882889 8:22581503-22581525 CAGCTGCAGCCGCAGGGGCGAGG - Exonic
1038260558 8:25989834-25989856 CAGAAGCAACAGCAGCAGCAAGG + Intronic
1038455440 8:27669545-27669567 CAGCAGCAGTGGCAGCAGCCTGG - Intronic
1039467982 8:37797303-37797325 CAGCGGCAGCAGCAGGCGCGCGG - Exonic
1039475539 8:37837640-37837662 CAGCAGCAGCAGCAGTGACAGGG - Intronic
1040470046 8:47729392-47729414 CAGCTGCAACAGCAGAAGCAGGG - Exonic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041787046 8:61646947-61646969 CAGCAGCAGGAGCAGGTGTGTGG - Intronic
1042395973 8:68292591-68292613 CCGCAGCAGCACCGGTAGCGGGG - Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042704216 8:71649699-71649721 AAGCAGCAGCAACAGTAGAATGG - Intergenic
1042915868 8:73875581-73875603 CAGCAGCAGCAGCAACATCCTGG + Intronic
1043019648 8:74984605-74984627 GAGCAGTAGCTGCAGGAGCGAGG - Exonic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044559738 8:93601428-93601450 GAGCAGCAGCTGCAGGAACGGGG + Intergenic
1044900700 8:96941174-96941196 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1045183430 8:99811525-99811547 CAGCAGCATCAGCAGCACCTGGG - Intronic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045438700 8:102189175-102189197 CAGCAGCATCAGCATCACCGTGG - Intergenic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1045852904 8:106724535-106724557 CATCAGCAGCAGCAGCACCTGGG + Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046868693 8:119179616-119179638 CAGCAGCAGTAGCAGTGCCAAGG + Intronic
1046934565 8:119873888-119873910 CAGCACCAGCGGGAGTGGCGGGG + Exonic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047645527 8:126866118-126866140 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1047799257 8:128291964-128291986 CAGCAGCAGCACCACTAGGCTGG + Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048472925 8:134719441-134719463 GCCCAGCAGCAGCAGCAGCGAGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048876125 8:138838056-138838078 AGGCAGCAGAAGCAGTGGCGTGG + Intronic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1049791082 8:144473032-144473054 CACCTGCAGCAGCAGCACCGCGG - Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1049802584 8:144524939-144524961 CAGCAGCGGCAGCAGTGCGGGGG + Exonic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1049923773 9:389605-389627 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1050501906 9:6307454-6307476 CAGCAGCAGCAGCATTGCCTGGG + Intergenic
1050733242 9:8733808-8733830 GAGGAGCAGCAGCAGCAGCCTGG + Exonic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051253346 9:15185503-15185525 CAGCAGCAGCAGCATCACCTGGG + Intronic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051774894 9:20622463-20622485 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052342374 9:27376725-27376747 CAGCAGCACCAGCAATATCTGGG + Intronic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1052981669 9:34454622-34454644 CAACAGCAGCAGCAATAACAGGG + Intronic
1053053113 9:34977585-34977607 CAGCAGCAGCAGCAAGAGTCAGG + Exonic
1053119940 9:35538884-35538906 CAGCAGCCGCGGCAGCAGCACGG + Exonic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1054776757 9:69130534-69130556 CAGCAGCAGCAGCATGACCTGGG - Intronic
1054782032 9:69174313-69174335 CAGGAGCAGAAGCAGAAGCGGGG + Intronic
1054828714 9:69599663-69599685 CAGTAGCACCAGCAGTACCCAGG + Intronic
1055107469 9:72527666-72527688 CAACAGCAGCAGCGGTCGCAGGG - Intronic
1055391505 9:75826772-75826794 CCTCAGCAGCATCAGTAGCAAGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056322694 9:85451901-85451923 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1056364253 9:85887242-85887264 CAGCAGCATCAGCAGCATCTGGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056464487 9:86840251-86840273 CAGCAGCATCAGCATTACCTGGG - Intergenic
1056556920 9:87697281-87697303 CAGCAGCAGTGGCAGGAGCAGGG - Intronic
1056716919 9:89039007-89039029 CAGCAGCAAAAGAAGTAGCCAGG + Intronic
1056756013 9:89382585-89382607 CAGCAGCAGCAGCAGAGACCTGG + Intronic
1057043177 9:91862360-91862382 GAGCAGCAGGAGCAGCAGCCAGG + Intronic
1057869700 9:98708657-98708679 CAGTAGCAGTAGCAGGCGCGCGG + Exonic
1057903661 9:98967977-98967999 GACCAGCAGCAGCAGTATCTGGG - Intronic
1059249633 9:112877114-112877136 CAGCAGCAGCAGCATCACCTGGG - Intronic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1059404869 9:114093302-114093324 CAGCAGGGGCAGGAGTAGAGGGG + Exonic
1059780700 9:117523284-117523306 CAGCAGCACCAGCAGTACCTGGG - Intergenic
1060367632 9:123034418-123034440 GAGCAGCAGCATCAGGAGCTTGG + Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060723282 9:125992160-125992182 CAGGAGGAGCAGCAGAAGCCCGG + Intergenic
1061089959 9:128420894-128420916 CAGCAGCTGGAGCAGCGGCGCGG - Exonic
1061506974 9:131036948-131036970 CAGCAGCACCAGCACCAGCTGGG - Intronic
1061688891 9:132308206-132308228 CATCAGCAGCAGCAGGTACGTGG - Intronic
1062084618 9:134642237-134642259 CAGCAGCGGGGGCAGCAGCGGGG - Exonic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062271489 9:135711844-135711866 CAGCTACAGCAGGTGTAGCGTGG - Intronic
1062307330 9:135915542-135915564 CAGCAGCATCAGCAGTGTCCGGG + Intergenic
1062347494 9:136122102-136122124 CAGCAGCAGCAGGGTTAGCCCGG - Intergenic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062467394 9:136687313-136687335 CAGCAGCAACAGCAGCGCCGCGG + Exonic
1062580953 9:137229021-137229043 CAGCCCCAGCAGCAGTATCTGGG - Exonic
1062673998 9:137729209-137729231 CAGCAGCAGCAGCATTCACGAGG - Intronic
1203529251 Un_GL000213v1:122773-122795 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186750261 X:12614415-12614437 CAGCAGCATCAGCAGCACCTGGG + Intronic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1186896487 X:14009231-14009253 CAGCAGCAGCAGCACTCACTGGG - Intronic
1186974504 X:14886706-14886728 CAGCAGCATCAGCAGTATGTAGG + Intronic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187274851 X:17808232-17808254 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1187830800 X:23379382-23379404 CAGCAGCAGCAGCATAACCTGGG - Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189211929 X:39290980-39291002 CAGCAGCATCAGCAGCAGCTGGG - Intergenic
1189318570 X:40073500-40073522 CAGTAGCAGCACCAGCAGCAAGG - Exonic
1189558046 X:42165715-42165737 CAGCAGTGGCAGCAGCAGCACGG + Intergenic
1189959200 X:46308303-46308325 GAGCAGCAGGAGCAGCAGCTAGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190459504 X:50658259-50658281 CACCAGCACCAGCAGAAGAGTGG - Intronic
1190887076 X:54539716-54539738 CAGCAGTAGCAGCAGCACCTGGG - Intronic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191840849 X:65512834-65512856 CAGCAGCAGCAGCAACTTCGAGG - Exonic
1191961142 X:66703271-66703293 CACCAGCAGCAGTGGTAGCAGGG - Intergenic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193823606 X:86195598-86195620 TGCCAGCAGCAGCAGTAGCATGG - Intronic
1193924128 X:87464561-87464583 CACCAGCAGCAGTAGTAGAAGGG - Intergenic
1194081023 X:89465419-89465441 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1194085685 X:89524960-89524982 CAGCAGCTGCAGCAGTGTGGCGG + Intergenic
1194353299 X:92849654-92849676 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1194425393 X:93731340-93731362 CAGCAGCAGCAGCAGCACCCTGG - Intergenic
1195019441 X:100812265-100812287 AAGCATCAGCTGTAGTAGCGTGG + Intergenic
1195671145 X:107471066-107471088 TGGCAGCAGAAGCAGTAGAGGGG + Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196117576 X:112014128-112014150 CAGCAGCACCAGCAGCACCTGGG - Intronic
1196193255 X:112815539-112815561 CAGCAGCCACAGCAGCAGCCAGG - Exonic
1196467713 X:115990372-115990394 CACCCGCAGCAGCAGTGGCCTGG + Intergenic
1196473688 X:116058404-116058426 TAGCAGCAGCATCAGTAGTATGG + Intergenic
1196893838 X:120313988-120314010 TAGCAGCAGCTGCAGCAGCTTGG + Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1197855914 X:130913742-130913764 TAGCAGCAGCAGCAGTAATCAGG - Intergenic
1198044944 X:132892325-132892347 CAGTAGCAGCAGCAGCACCTTGG + Intronic
1198242083 X:134796806-134796828 CAGCCGCAGCATCTGTAGCCCGG - Intronic
1198270401 X:135051562-135051584 CAGGAGCTGCAGCAGGAGCCTGG + Exonic
1198502647 X:137267315-137267337 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1199612713 X:149631682-149631704 CAGTAGCGGGAGCAGCAGCGTGG - Exonic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200110078 X:153736547-153736569 CAGCACCTGCAGCAGCAGCAGGG - Intronic
1200138502 X:153886158-153886180 CGGCAGCAGCGGCTGTGGCGGGG + Intronic
1200433695 Y:3121622-3121644 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1200438331 Y:3180843-3180865 CAGCAGCTGCAGCAGTGTGGCGG + Intergenic
1200661657 Y:5966727-5966749 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1200795876 Y:7340866-7340888 CAGTACCAGCAACAGTAGCAAGG + Intergenic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic