ID: 1173856063

View in Genome Browser
Species Human (GRCh38)
Location 20:46251451-46251473
Sequence CCTGAACGCCGCCCAGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173856051_1173856063 8 Left 1173856051 20:46251420-46251442 CCCCGACGGGGCACCCGGACGGG 0: 1
1: 0
2: 0
3: 9
4: 484
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1173856054_1173856063 6 Left 1173856054 20:46251422-46251444 CCGACGGGGCACCCGGACGGGCC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1173856043_1173856063 23 Left 1173856043 20:46251405-46251427 CCGCCGGGATGTCGCCCCCGACG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1173856056_1173856063 -5 Left 1173856056 20:46251433-46251455 CCCGGACGGGCCCGCGGCCCTGA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1173856053_1173856063 7 Left 1173856053 20:46251421-46251443 CCCGACGGGGCACCCGGACGGGC 0: 1
1: 0
2: 6
3: 328
4: 5188
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1173856046_1173856063 20 Left 1173856046 20:46251408-46251430 CCGGGATGTCGCCCCCGACGGGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1173856049_1173856063 9 Left 1173856049 20:46251419-46251441 CCCCCGACGGGGCACCCGGACGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1173856057_1173856063 -6 Left 1173856057 20:46251434-46251456 CCGGACGGGCCCGCGGCCCTGAA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173856063 Original CRISPR CCTGAACGCCGCCCAGCCGC GGG Exonic
900116909 1:1032949-1032971 CCTGGCCGCTGCCCAGCCGGGGG - Intronic
900401945 1:2476267-2476289 CCTCAGCCCCGCCCAGCCCCAGG - Intronic
900663150 1:3796098-3796120 CCTGGGCCCCGCCGAGCCGCCGG - Exonic
903597111 1:24503096-24503118 CCTGCACGCCCCGCCGCCGCAGG - Exonic
905291590 1:36925418-36925440 CCTGAAAGCTGCCCAGCTTCTGG + Intronic
907248004 1:53120386-53120408 CCTGCAGGCTGCCCAGCTGCCGG + Intronic
912512356 1:110198054-110198076 CCTTAAGGCAGCCCACCCGCAGG + Exonic
913646890 1:120865533-120865555 CCTGAAGACTGCCCAGTCGCAGG - Intergenic
914079757 1:144397330-144397352 CCTGAAGACTGCCCAGTCGCAGG + Intergenic
914174658 1:145265868-145265890 CCTGAAGACTGCCCAGTCGCAGG + Intergenic
914529385 1:148507356-148507378 CCTGAAGACTGCCCAGTCGCAGG + Intergenic
915486613 1:156225628-156225650 CCTGCACGCCGCCCAACTGAAGG - Exonic
921840114 1:219819437-219819459 CCGGAAGGCTGCTCAGCCGCTGG + Intronic
923007866 1:230066905-230066927 CCTGGGCGCCGCCCCGCCCCCGG - Intronic
1063664712 10:8054452-8054474 CCTGCCCGCCGCCCCTCCGCCGG + Intronic
1063979808 10:11444334-11444356 CCTGAACGGGGCCCAGCTGTGGG + Intergenic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1065555256 10:26908722-26908744 CCTGGACGCCGCCCATCTCCAGG + Intergenic
1065595596 10:27308084-27308106 CCTGGACGCCGCCCATCTCCAGG - Intergenic
1067508053 10:46873130-46873152 CCTCAACGGCCCCCAGCCCCAGG - Intergenic
1067654198 10:48178715-48178737 CCTCAACGGCCCCCAGCCCCAGG + Intronic
1069691634 10:70357187-70357209 CCTGATCTCCGCCCAGCCCCAGG - Intronic
1070139785 10:73730564-73730586 CCTGAAAGTCGTCCAGGCGCCGG - Intergenic
1070785390 10:79159446-79159468 CCTGAACCCTGCCCAGCCCTGGG - Intronic
1071298139 10:84237425-84237447 CCTGAGCGCCGCCCAGGGGAAGG + Exonic
1071511373 10:86264527-86264549 CCTGAACACCTCCCAGAGGCTGG + Intronic
1071997700 10:91163392-91163414 CCTGGCCGCGGCCCCGCCGCGGG + Intronic
1075031930 10:119029711-119029733 CCTGCCCGCCGGCCTGCCGCGGG - Exonic
1076117025 10:127907639-127907661 CACGTACGCCGCCCTGCCGCCGG - Intronic
1078761834 11:14257921-14257943 CCTGAACTCCTGCCAGCCCCTGG - Intronic
1080387051 11:31816582-31816604 CCTGCTCGCCGCCCAGCTCCAGG + Intronic
1083387777 11:62324669-62324691 CCTGAAGGCAGGCCAGCCGCTGG + Intergenic
1084551586 11:69846453-69846475 ACTGAACCCCTCCCAGCCTCTGG - Intergenic
1085046969 11:73359349-73359371 CCTGAACACTGCCAAGCAGCTGG - Intronic
1085477431 11:76797026-76797048 CCTGAACTCTGCCCTGCAGCAGG - Exonic
1090890218 11:130916449-130916471 GCTGACCGCCGGCCGGCCGCCGG + Exonic
1092727619 12:11500422-11500444 CCCCACCGCCGCCCAGGCGCAGG + Intronic
1096586813 12:52628276-52628298 CCTGAACCCAGCCCACCCTCAGG + Intergenic
1097052461 12:56231466-56231488 CCTGAACTCGGCCTAGCCCCAGG - Exonic
1097052985 12:56234826-56234848 TCTGAACGGCTCCCAGCTGCTGG + Exonic
1101146542 12:101846046-101846068 GCTGCACCCAGCCCAGCCGCAGG + Intergenic
1101998369 12:109541135-109541157 GCTGAAGGCCACTCAGCCGCAGG - Intergenic
1102223473 12:111210868-111210890 CCTGAACACCCCCCAGCTGATGG + Intronic
1102890157 12:116552584-116552606 CCTGGACTCCGCCCAGCCCTGGG - Intergenic
1104602357 12:130162323-130162345 CCTCCCCGCCGCCCCGCCGCGGG - Intergenic
1104619441 12:130299847-130299869 CCTGAACTCCTCACAGCAGCAGG - Intergenic
1105264415 13:18803425-18803447 GCTGAACGCTGCCAAGCCACAGG - Intergenic
1108363831 13:49691316-49691338 CCTGCCCGCGGCCCAGGCGCAGG + Exonic
1112091707 13:96090510-96090532 CCTGAGCGCCTGCAAGCCGCCGG + Intergenic
1118992403 14:70808934-70808956 CCACCACGTCGCCCAGCCGCAGG + Exonic
1125508852 15:40282277-40282299 CCTGGACGCCGTGCAGCTGCTGG - Exonic
1126467324 15:48972969-48972991 GCTGGAGGCCGCCCAGCAGCGGG + Intergenic
1128742743 15:70095467-70095489 CCCCACCACCGCCCAGCCGCAGG - Intronic
1129423742 15:75450863-75450885 CCTGCACCCCGCCCAGGCCCCGG - Intronic
1132743902 16:1428856-1428878 CCTGAACCCCAGGCAGCCGCAGG + Intergenic
1132945331 16:2529028-2529050 CCTGCACCCCGCCCAGTTGCTGG + Exonic
1133010998 16:2911847-2911869 CCTGCGCGGCGCCGAGCCGCAGG - Intergenic
1142256976 16:89018761-89018783 CCTGAGCCCAGCCCAGCCTCCGG + Intergenic
1142350076 16:89575765-89575787 CCTGAACGCCTGCCGGGCGCGGG - Exonic
1145874536 17:28307071-28307093 CCGGGACCCCGCCCGGCCGCTGG + Intergenic
1145881771 17:28357491-28357513 GCGGAACGCCGCCCGGCCGCGGG - Exonic
1148899591 17:50866088-50866110 GCTGCTCCCCGCCCAGCCGCGGG - Exonic
1151821932 17:76501302-76501324 ACTCACGGCCGCCCAGCCGCAGG - Intronic
1153929206 18:9863913-9863935 CATGAAGGCCTCCCAGCCTCAGG - Intergenic
1154423978 18:14258136-14258158 GCTGAACGCTGCCAAGCCACAGG + Intergenic
1154975638 18:21454901-21454923 CCTGAACTCCTCCCACCTGCAGG + Intronic
1157675982 18:49569005-49569027 CCTGACCTCCACCCAGCCCCAGG - Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1161048817 19:2151367-2151389 CCCTCACGGCGCCCAGCCGCGGG - Exonic
1163516441 19:17766819-17766841 CGTGGGCGCCGCCCAGCGGCTGG + Intronic
1164713386 19:30375100-30375122 CCGAGACGCCGCCCAGCCCCGGG + Intronic
1164881700 19:31738402-31738424 CATGAACGCTTCCCAGCCACCGG + Intergenic
1167414204 19:49361816-49361838 CCTGAACGCCGCAGCGCCACTGG - Intronic
925303677 2:2834716-2834738 CATGAACGCAGCACAGCTGCAGG - Intergenic
925388448 2:3479621-3479643 GCTGAACGCCGACCAACTGCGGG - Intronic
937145341 2:119639347-119639369 CCTGCACTCAGCCCAGCCGGGGG + Intronic
939748515 2:146009617-146009639 CCTGACTGCAGCCCAGCAGCTGG - Intergenic
1169498269 20:6134974-6134996 CCTGAAGGCCCTCCAGCCTCGGG + Intergenic
1170629649 20:18056494-18056516 CCTGGCCGCCGCCCAGGGGCAGG + Intronic
1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG + Exonic
1176849491 21:13901867-13901889 GCTGAACGCTGCCAAGCCACAGG - Intergenic
1179511892 21:41878996-41879018 CCTGCGCGCCGCCCGCCCGCCGG - Exonic
1183414534 22:37674976-37674998 CCTGAACGCGGCCAAGCCCGAGG + Intergenic
1183710868 22:39502464-39502486 CCTCCCCGCCGCCCAGCCGCCGG - Intronic
1184341681 22:43889656-43889678 GCTGAACGCCCCCCAGGAGCAGG + Intronic
1184728964 22:46362861-46362883 CCTGAACTCTGGCCAGCCTCTGG + Exonic
1185349494 22:50327125-50327147 CCTGGGCGGCGCCCGGCCGCTGG - Intergenic
949790027 3:7782576-7782598 CCTGAATCCTGCCCAGCCTCTGG - Intergenic
952416247 3:33093631-33093653 TCTGAATGCCGCGCAGCCCCCGG - Exonic
961450289 3:126999509-126999531 CCGGCACGCGCCCCAGCCGCCGG - Intronic
966449101 3:180037233-180037255 CCTGAACGCCGCGCTGCTGCGGG - Intergenic
968078474 3:195830105-195830127 CCTGGACGGGGCCCAGCCGGGGG - Intergenic
968093209 3:195910372-195910394 CCTGCAGGCTGCCCCGCCGCTGG - Intronic
969214532 4:5711385-5711407 CTTGCAGGCCGCCCCGCCGCGGG - Exonic
969570883 4:8007609-8007631 CCTGAACGAGGCACAGCCTCAGG - Intronic
971230894 4:24799731-24799753 GCTGGACGCCGCGCAGCCCCGGG + Exonic
980305931 4:131061477-131061499 CCTGAACTCAGCCCATCAGCAGG - Intergenic
985542850 5:494817-494839 CCTGGAGGCTGCCCAGCCGCTGG + Intronic
985961479 5:3306310-3306332 CCAGAACGCTGCCCACTCGCAGG + Intergenic
988908121 5:35810734-35810756 GCTGAAAGCCACCCAGCAGCAGG + Intronic
988922289 5:35954408-35954430 CCTGAGCCCCGCACAGCGGCTGG - Exonic
989977746 5:50607210-50607232 CCTGAAGACTGCCCAGTCGCAGG - Intergenic
996124196 5:119706362-119706384 GCTGACCGCCTCCCAGCTGCGGG + Intergenic
1002409150 5:179060524-179060546 GCTGCACGCCGCCCACTCGCTGG - Exonic
1004643997 6:17542098-17542120 CCTGCACCCCTCCCAGCCCCTGG + Intronic
1006403298 6:33830077-33830099 GCTGAAAGCAGCCCAGCCTCCGG + Intergenic
1006451825 6:34109781-34109803 CCTGAAAGCCTGGCAGCCGCAGG - Intronic
1011515078 6:88144923-88144945 CCTGAACCCCAGCCAGCAGCTGG - Exonic
1014724791 6:124962048-124962070 CCGGAGCGCTGGCCAGCCGCAGG - Intergenic
1019211120 6:170405918-170405940 CCTGATGGCAGCCCAGCCGCTGG - Exonic
1019431033 7:999856-999878 CCAGCCCGCCGCCCAGCAGCCGG + Intronic
1019602115 7:1889958-1889980 CCTGAAGGCTGCCCACCCACAGG + Intronic
1020056532 7:5121389-5121411 CCCGCACTCCGCGCAGCCGCAGG + Intergenic
1029425884 7:100493848-100493870 CCGGCACCCCGCCCTGCCGCCGG + Exonic
1035557889 8:580001-580023 CCTGACCGCCGCCCACATGCCGG + Intergenic
1036693638 8:10960590-10960612 CCTCAACACAGCCCAGCCACAGG + Intronic
1049585650 8:143431279-143431301 CCTGAACGCGTCTGAGCCGCGGG - Intergenic
1049988467 9:972321-972343 CCTGAACAAAGCCCAGCCGCGGG - Intergenic
1057478669 9:95426860-95426882 TCTGAGCCCCGCCCCGCCGCGGG - Intergenic
1061487990 9:130929938-130929960 CCTGAACCACGCCCACGCGCCGG - Exonic
1061866752 9:133495196-133495218 CCTGAAGGGCGTCCACCCGCAGG - Intergenic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1062339058 9:136085885-136085907 CCTGCACGGCGCCCGGCCTCTGG - Intronic
1062526510 9:136980073-136980095 CGTGGACGCCGCCCACACGCAGG + Intronic
1062542744 9:137048785-137048807 CCTGATCCCCGCCGACCCGCCGG - Exonic
1199713087 X:150486088-150486110 CCTGAAGTCCACCCAACCGCTGG - Intronic