ID: 1173861952

View in Genome Browser
Species Human (GRCh38)
Location 20:46289682-46289704
Sequence TGCCTGGGGCGATATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173861952 Original CRISPR TGCCTGGGGCGATATGAGGG AGG Intronic
900947366 1:5838639-5838661 GGCTGGGGGCAATATGAGGGTGG + Intergenic
902822411 1:18951357-18951379 TGCCTGGGGTGATTGGAGGGTGG - Intronic
904762919 1:32818101-32818123 TCCCTGGGGAGATCTGAGGACGG + Exonic
904965009 1:34365146-34365168 TCCATGGGGCGATATGAGAAGGG + Intergenic
905446987 1:38034027-38034049 CGCCTGGGATGAGATGAGGGTGG + Intergenic
911298520 1:96146918-96146940 TGCGTTGGGAGATATGATGGTGG + Intergenic
911819005 1:102392186-102392208 TGTCTGGGACTAGATGAGGGAGG + Intergenic
913233652 1:116762474-116762496 TACCTGGGGAGAGATTAGGGTGG + Intronic
914252869 1:145936283-145936305 AGCCTGGGGAGTTATGTGGGTGG + Exonic
922674329 1:227541750-227541772 TGCCAGAGGCGATGTCAGGGAGG - Intergenic
1063031924 10:2244129-2244151 TGCCAGGTGAGAGATGAGGGTGG + Intergenic
1068166078 10:53334151-53334173 TGCATATGGGGATATGAGGGAGG + Intergenic
1070222927 10:74469792-74469814 TGCCTGGGGCTGTATGAAGGGGG - Intronic
1071404503 10:85317223-85317245 TGGCTGGGGCAATGTGAAGGAGG + Intergenic
1074969008 10:118520340-118520362 TGCCTGGGGAAAGAGGAGGGAGG + Intergenic
1075313204 10:121431738-121431760 TGCCTGGGGCCATAGGAGAGTGG + Intergenic
1075544331 10:123343058-123343080 TGCCTGGGGTGCTGTGTGGGTGG + Intergenic
1075553814 10:123414165-123414187 GGCCTGGGCCCATATGATGGGGG + Intergenic
1076087443 10:127647457-127647479 TGCCTGGGGGCAGAGGAGGGAGG + Intergenic
1077000721 11:320936-320958 TGGCCGGGGCCAGATGAGGGCGG + Exonic
1077659800 11:4057418-4057440 TGCTTGGGGTGAAGTGAGGGTGG + Intronic
1079875630 11:25853528-25853550 TGACTGGGGCCAAATGAGGCAGG + Intergenic
1085270912 11:75269305-75269327 TGGCTGTGGCGATTTGAGGTGGG - Intronic
1087370637 11:97279595-97279617 TGCCTGGGGCTGTGGGAGGGAGG - Intergenic
1091389483 12:117433-117455 AGCCTGGGAGGCTATGAGGGAGG + Intronic
1091752955 12:3033839-3033861 AGTGTGGGGGGATATGAGGGTGG + Intronic
1091887480 12:4027180-4027202 TGCCAGGGGCCATAGGAGGCAGG + Intergenic
1092837305 12:12502903-12502925 TGCATGGGGCGGTGTGAGGGTGG - Intronic
1094807869 12:34108711-34108733 TGCCGGAGGCGATATCAGAGAGG + Intergenic
1096494178 12:52029803-52029825 TGCCTGGAGAGACATGAGGCAGG - Intronic
1112498860 13:99926823-99926845 TGGCTGGGATGATATGCGGGTGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1121114068 14:91331376-91331398 TGCCTGGGGCCAGAGGAGGGTGG + Intronic
1123707876 15:22963671-22963693 TGCCCGGGGCCATAGGAGTGAGG - Intronic
1123991385 15:25686068-25686090 TGCCTGGGACTATCTGAGGAAGG - Intronic
1129534799 15:76304274-76304296 TACCTGGGCCTATTTGAGGGTGG + Intronic
1131584019 15:93673970-93673992 TGACTGGGGTGATCTGAGCGGGG + Intergenic
1136070864 16:27786249-27786271 TGCCTGGGAGGATGTGAGGATGG - Intergenic
1136453284 16:30366636-30366658 TGCCTGGGGTGATTTCAGGGAGG - Intronic
1140692797 16:77500382-77500404 TCCCTGGGGTGGTATCAGGGAGG + Intergenic
1144577048 17:16435930-16435952 TGCTTGGGGCAAGATGAGGGAGG - Intronic
1147242108 17:39097200-39097222 TGCCTGGGGCAGTGTGAGGAGGG - Intronic
1150693618 17:67385482-67385504 TGCCTGGGGGGAGGGGAGGGGGG - Intronic
1151528779 17:74690615-74690637 TAGCTGGGGCGAGAGGAGGGAGG - Intronic
1152069272 17:78127021-78127043 TACCTGGGGTGATAGGGGGGTGG - Intronic
1152203638 17:78961747-78961769 AGCCTGGGGCGATCTGAGGGAGG - Intergenic
1154123693 18:11671636-11671658 TGCCTGGGTCCAGATGTGGGGGG + Intergenic
1155177045 18:23310041-23310063 TCCCTGGAGAGAGATGAGGGCGG - Intronic
1157714459 18:49873864-49873886 TGACTGAGGCGCTGTGAGGGTGG - Intronic
1160747988 19:720492-720514 GGCCTGGGGAGAGGTGAGGGGGG + Intronic
1160863661 19:1248252-1248274 GGCCTGGGGCGACAGGAAGGGGG + Intergenic
1162054823 19:8056257-8056279 TGCCTGCTGCGATGTGAGTGGGG + Exonic
1166886104 19:45961928-45961950 TGCCTGGGGCTGAATGAGAGAGG + Intronic
1167324090 19:48813346-48813368 TGGCTGGGGAGAAAAGAGGGGGG + Exonic
927266462 2:21158104-21158126 TGCCTGTGGGGAGATGAGGATGG + Intergenic
927758765 2:25731409-25731431 TGCCTGGGATGGTGTGAGGGAGG + Intergenic
929326411 2:40616747-40616769 TGTTTGGGGAGATAAGAGGGGGG - Intergenic
929896239 2:45963122-45963144 GGCCTGGGTCGATAGAAGGGAGG + Intronic
931793705 2:65689595-65689617 TGCCTTGTTCAATATGAGGGCGG + Intergenic
932183782 2:69673883-69673905 CACCTGGGGAGATATGAGGCTGG + Intronic
936596247 2:113851107-113851129 TTCATGGGGTGATATAAGGGAGG + Intergenic
936735967 2:115444024-115444046 TGCCTGGGGCAATGTGGGGGAGG - Intronic
938555867 2:132423657-132423679 TCCCTGGGGAGATCTGAGAGAGG - Intronic
938697688 2:133849296-133849318 TCCCAGAGGGGATATGAGGGAGG + Intergenic
938734959 2:134177360-134177382 GGCCTGGGGGGATCTGATGGAGG + Intronic
941903916 2:170703229-170703251 TTCCTGAGGAGATATCAGGGAGG - Intergenic
942070411 2:172311060-172311082 TGCCTGGAGAGATATGAGGGAGG + Intergenic
946690709 2:222306522-222306544 AGCCTGGGGCGAAATGACAGAGG + Intergenic
1169330154 20:4709945-4709967 TGCCATGGGCGCTATGAGGTAGG - Intergenic
1169464633 20:5826895-5826917 TGAAGGGGGGGATATGAGGGAGG - Intronic
1169624369 20:7547277-7547299 TGACTGGGGGGATATGGGGAGGG + Intergenic
1170127299 20:12978170-12978192 TGCCTGGGGAGAGATGAGAAGGG + Intergenic
1172775051 20:37402425-37402447 TGCCTGAGGCGATCTGCAGGCGG - Exonic
1173861952 20:46289682-46289704 TGCCTGGGGCGATATGAGGGAGG + Intronic
1176661070 21:9635255-9635277 GGTGTGGGGCGATATGAGTGAGG + Intergenic
1178354243 21:31897404-31897426 TGCCTGGGGCTATCAGAGGCTGG - Intronic
1179476316 21:41648447-41648469 TGCCTGGGGCCACAGGACGGAGG + Intergenic
1179873892 21:44257816-44257838 TGCCTGGCGCCTTCTGAGGGAGG - Intronic
1184200093 22:42962671-42962693 TGCCTGAGGGCATGTGAGGGTGG - Intronic
1184529734 22:45047458-45047480 GGCCTGGGGGGATAAGGGGGTGG - Intergenic
1185245256 22:49769874-49769896 TGCCTTGGGCCACATGGGGGTGG - Intergenic
953727477 3:45412878-45412900 TGCCTGGGGCAATTGGAGGCAGG + Intronic
954407878 3:50355545-50355567 TGCCTGGGGCCAGAGGAGAGAGG + Exonic
954862927 3:53705211-53705233 AGGCTGGGGCGATGTGAGGAAGG + Intronic
955409460 3:58646417-58646439 TGCCTGGGGGGAGATGCTGGTGG + Intronic
961091286 3:124114703-124114725 AGCATGGGGAGATATGAGTGGGG + Intronic
965670542 3:171143295-171143317 TGCATGGAGCCGTATGAGGGAGG + Intronic
966984173 3:185164652-185164674 CACCTGGGGTGAAATGAGGGTGG + Intergenic
967284273 3:187853402-187853424 GGCCTGGGGAGAAATGTGGGGGG - Intergenic
967688138 3:192441314-192441336 TGACTGGGGGAATCTGAGGGAGG + Intronic
968359759 3:198138747-198138769 TCCCTGGGGAGAGACGAGGGAGG - Intergenic
969365548 4:6692260-6692282 TGGCTGGGGTGGTATGATGGTGG + Intergenic
969590224 4:8117820-8117842 TGCGTGGGGGGATAGGAGAGAGG - Intronic
984206473 4:176792792-176792814 TGCCGGGGGCGGGAGGAGGGCGG + Intergenic
984806550 4:183757073-183757095 TGGCTGGGGAGAGATGAGCGCGG + Intergenic
992104382 5:73437506-73437528 TGCTTGGGGCTTTAGGAGGGGGG + Intergenic
994409717 5:99391450-99391472 TGCCTCAGGTTATATGAGGGAGG + Intergenic
994484101 5:100373833-100373855 TGCCTCAGGTTATATGAGGGAGG - Intergenic
997209575 5:132069546-132069568 GGCCTGGGAGGATCTGAGGGTGG - Intergenic
999398884 5:151249260-151249282 TGCAAGGGGCTATATGGGGGTGG + Intronic
1006082503 6:31575511-31575533 TCCCTGGGGCGAGAGGAGGGCGG - Intergenic
1008563237 6:52742558-52742580 TGCCTGGGGCTAAAGGAGTGGGG - Intergenic
1008564480 6:52753884-52753906 TGCCTGGGGCTAAAGGAGTGGGG - Intronic
1010165820 6:72914048-72914070 TGCTTCAGGGGATATGAGGGAGG + Intronic
1013757799 6:113481676-113481698 TTCCTTGGGTGATATGAGGAAGG + Intergenic
1017467166 6:154705371-154705393 TTCCTTGGGAGATACGAGGGAGG + Intergenic
1017770391 6:157639728-157639750 TGCCTGGGGAGGGGTGAGGGCGG + Intronic
1018085396 6:160297382-160297404 TACCTGGAGCGGTCTGAGGGAGG + Intergenic
1019260229 7:77903-77925 TCCCTGGGGAGAGACGAGGGAGG + Intergenic
1020470645 7:8530631-8530653 TGCCTGGAGGGGCATGAGGGAGG + Intronic
1022407999 7:30110183-30110205 TGCCTAGGGCCATAGGAGGGAGG - Intronic
1024611282 7:51066373-51066395 TTCCTGGGGAGATATGAGCAGGG + Intronic
1024616940 7:51123831-51123853 TGCCTGGGGTGATGTGGGTGAGG - Intronic
1030151236 7:106407292-106407314 TTCCTGGGGCGGGAGGAGGGGGG + Intergenic
1031923975 7:127620765-127620787 TCCCTGGGGCGTTCAGAGGGAGG - Intergenic
1033633147 7:143181359-143181381 TTCCAGGGGCGATCTGAGGGGGG - Intergenic
1037589556 8:20301780-20301802 TGCCTGGGTCGATGTGGGGCAGG - Intronic
1038414835 8:27387307-27387329 TGCCTTGGGAGATATCAGTGAGG + Intronic
1041263101 8:56038670-56038692 TGCCTGGGGTGGGATAAGGGTGG - Intergenic
1054730566 9:68698773-68698795 TTCCTGGGGCCATTTCAGGGAGG - Intergenic
1055055717 9:72022157-72022179 TGCATAGGAAGATATGAGGGTGG + Intergenic
1055679011 9:78695338-78695360 AGCCTGGGGCGGGAGGAGGGTGG + Intergenic
1056233657 9:84571032-84571054 TGCTTAGCCCGATATGAGGGAGG - Intergenic
1058611047 9:106775815-106775837 TGCATGGGGCTATATAAGGATGG + Intergenic
1062744462 9:138202568-138202590 TCCCTGGGGAGAGACGAGGGAGG - Intergenic
1203638638 Un_KI270750v1:137099-137121 GGTGTGGGGCGATATGAGTGAGG + Intergenic
1186064397 X:5746129-5746151 TGGCTAGGGAGATATGAGGTAGG + Intergenic
1189772161 X:44437596-44437618 TGCATGGGGCCATCTAAGGGTGG + Intergenic
1190060313 X:47206575-47206597 TGCCTGGTGGGAAGTGAGGGAGG - Intronic
1190063185 X:47223779-47223801 AGCCTGGGGCCATATGGGAGAGG - Intronic
1190441221 X:50476226-50476248 TGTGTGGGGGGATCTGAGGGAGG + Intergenic
1190981267 X:55458356-55458378 TGCTTGGGGTGAAATGTGGGGGG + Intergenic
1190987431 X:55514824-55514846 TGCTTGGGGTGAAATGTGGGGGG - Intergenic
1197015098 X:121615160-121615182 TGCCTGGGGTTAAATGTGGGAGG - Intergenic
1197024330 X:121729177-121729199 TGCAGGGGGCAATCTGAGGGAGG + Intergenic
1199188221 X:144940389-144940411 GCTCTGGGGCCATATGAGGGTGG + Intergenic
1200130740 X:153843287-153843309 TGCCAGGGGCTAGAGGAGGGGGG - Intergenic
1201901432 Y:19048574-19048596 TGTCTGGGGAGAAATGGGGGAGG - Intergenic