ID: 1173865461

View in Genome Browser
Species Human (GRCh38)
Location 20:46309625-46309647
Sequence GTGATTAAATGGCTGGTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173865461_1173865466 3 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865466 20:46309651-46309673 CAAGCAGCTGCTGAAGTTCATGG No data
1173865461_1173865470 14 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865470 20:46309662-46309684 TGAAGTTCATGGCAAAGAGGGGG No data
1173865461_1173865467 11 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865467 20:46309659-46309681 TGCTGAAGTTCATGGCAAAGAGG No data
1173865461_1173865472 19 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865472 20:46309667-46309689 TTCATGGCAAAGAGGGGGCAGGG No data
1173865461_1173865473 28 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865473 20:46309676-46309698 AAGAGGGGGCAGGGCCCTCCAGG No data
1173865461_1173865471 18 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865471 20:46309666-46309688 GTTCATGGCAAAGAGGGGGCAGG No data
1173865461_1173865469 13 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865469 20:46309661-46309683 CTGAAGTTCATGGCAAAGAGGGG No data
1173865461_1173865468 12 Left 1173865461 20:46309625-46309647 CCAATGACCAGCCATTTAATCAC No data
Right 1173865468 20:46309660-46309682 GCTGAAGTTCATGGCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173865461 Original CRISPR GTGATTAAATGGCTGGTCAT TGG (reversed) Intergenic
No off target data available for this crispr