ID: 1173866268

View in Genome Browser
Species Human (GRCh38)
Location 20:46314322-46314344
Sequence CAGCCCTCCTGGTGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173866268_1173866273 -7 Left 1173866268 20:46314322-46314344 CCTGCTGAGCACCAGGAGGGCTG No data
Right 1173866273 20:46314338-46314360 AGGGCTGGGGCCAACATGCCAGG No data
1173866268_1173866280 20 Left 1173866268 20:46314322-46314344 CCTGCTGAGCACCAGGAGGGCTG No data
Right 1173866280 20:46314365-46314387 CCGGACCTTCCTTCACCTGAAGG No data
1173866268_1173866274 -6 Left 1173866268 20:46314322-46314344 CCTGCTGAGCACCAGGAGGGCTG No data
Right 1173866274 20:46314339-46314361 GGGCTGGGGCCAACATGCCAGGG No data
1173866268_1173866275 1 Left 1173866268 20:46314322-46314344 CCTGCTGAGCACCAGGAGGGCTG No data
Right 1173866275 20:46314346-46314368 GGCCAACATGCCAGGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173866268 Original CRISPR CAGCCCTCCTGGTGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr