ID: 1173866542

View in Genome Browser
Species Human (GRCh38)
Location 20:46316172-46316194
Sequence GGTCAGATGAGATGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173866536_1173866542 5 Left 1173866536 20:46316144-46316166 CCTGGCCTCAGTTTTGCCATCTC No data
Right 1173866542 20:46316172-46316194 GGTCAGATGAGATGACAAGCAGG No data
1173866531_1173866542 26 Left 1173866531 20:46316123-46316145 CCTTGGGCAAGTCTCGCCTCCCC No data
Right 1173866542 20:46316172-46316194 GGTCAGATGAGATGACAAGCAGG No data
1173866533_1173866542 10 Left 1173866533 20:46316139-46316161 CCTCCCCTGGCCTCAGTTTTGCC No data
Right 1173866542 20:46316172-46316194 GGTCAGATGAGATGACAAGCAGG No data
1173866535_1173866542 6 Left 1173866535 20:46316143-46316165 CCCTGGCCTCAGTTTTGCCATCT No data
Right 1173866542 20:46316172-46316194 GGTCAGATGAGATGACAAGCAGG No data
1173866537_1173866542 0 Left 1173866537 20:46316149-46316171 CCTCAGTTTTGCCATCTCTCAGG No data
Right 1173866542 20:46316172-46316194 GGTCAGATGAGATGACAAGCAGG No data
1173866534_1173866542 7 Left 1173866534 20:46316142-46316164 CCCCTGGCCTCAGTTTTGCCATC No data
Right 1173866542 20:46316172-46316194 GGTCAGATGAGATGACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173866542 Original CRISPR GGTCAGATGAGATGACAAGC AGG Intergenic
No off target data available for this crispr