ID: 1173866667

View in Genome Browser
Species Human (GRCh38)
Location 20:46316920-46316942
Sequence CTGAGGCCACAGATGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173866659_1173866667 2 Left 1173866659 20:46316895-46316917 CCTGGTGTGTCTGGAACCCAGTG No data
Right 1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173866667 Original CRISPR CTGAGGCCACAGATGGGACA AGG Intergenic
No off target data available for this crispr