ID: 1173869328

View in Genome Browser
Species Human (GRCh38)
Location 20:46331746-46331768
Sequence GAGGGTTGCAGGGAGGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173869316_1173869328 1 Left 1173869316 20:46331722-46331744 CCAGCCACACCCTTCACTGGCTG No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data
1173869314_1173869328 7 Left 1173869314 20:46331716-46331738 CCTTTTCCAGCCACACCCTTCAC No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data
1173869323_1173869328 -9 Left 1173869323 20:46331732-46331754 CCTTCACTGGCTGGGAGGGTTGC No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data
1173869311_1173869328 26 Left 1173869311 20:46331697-46331719 CCTTGGGCTGGACTGGGCCCCTT No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data
1173869313_1173869328 8 Left 1173869313 20:46331715-46331737 CCCTTTTCCAGCCACACCCTTCA No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data
1173869312_1173869328 9 Left 1173869312 20:46331714-46331736 CCCCTTTTCCAGCCACACCCTTC No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data
1173869322_1173869328 -8 Left 1173869322 20:46331731-46331753 CCCTTCACTGGCTGGGAGGGTTG No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data
1173869319_1173869328 -3 Left 1173869319 20:46331726-46331748 CCACACCCTTCACTGGCTGGGAG No data
Right 1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173869328 Original CRISPR GAGGGTTGCAGGGAGGCCTC GGG Intergenic
No off target data available for this crispr