ID: 1173870380

View in Genome Browser
Species Human (GRCh38)
Location 20:46338022-46338044
Sequence CGACATCCACAGCTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173870369_1173870380 25 Left 1173870369 20:46337974-46337996 CCAAGGGACCAGAGGAGGAGCGG No data
Right 1173870380 20:46338022-46338044 CGACATCCACAGCTGATGCAGGG No data
1173870368_1173870380 28 Left 1173870368 20:46337971-46337993 CCTCCAAGGGACCAGAGGAGGAG No data
Right 1173870380 20:46338022-46338044 CGACATCCACAGCTGATGCAGGG No data
1173870373_1173870380 17 Left 1173870373 20:46337982-46338004 CCAGAGGAGGAGCGGGGAGAGCA No data
Right 1173870380 20:46338022-46338044 CGACATCCACAGCTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173870380 Original CRISPR CGACATCCACAGCTGATGCA GGG Intergenic
No off target data available for this crispr