ID: 1173871136

View in Genome Browser
Species Human (GRCh38)
Location 20:46342870-46342892
Sequence ACCTTCTTTGAACTTGCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173871136_1173871141 17 Left 1173871136 20:46342870-46342892 CCTTAGGCAAGTTCAAAGAAGGT No data
Right 1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG No data
1173871136_1173871138 11 Left 1173871136 20:46342870-46342892 CCTTAGGCAAGTTCAAAGAAGGT No data
Right 1173871138 20:46342904-46342926 CACTTTGCTTATCTGTAGAATGG No data
1173871136_1173871139 12 Left 1173871136 20:46342870-46342892 CCTTAGGCAAGTTCAAAGAAGGT No data
Right 1173871139 20:46342905-46342927 ACTTTGCTTATCTGTAGAATGGG No data
1173871136_1173871142 28 Left 1173871136 20:46342870-46342892 CCTTAGGCAAGTTCAAAGAAGGT No data
Right 1173871142 20:46342921-46342943 GAATGGGGACGGTCTCCAGCTGG No data
1173871136_1173871140 13 Left 1173871136 20:46342870-46342892 CCTTAGGCAAGTTCAAAGAAGGT No data
Right 1173871140 20:46342906-46342928 CTTTGCTTATCTGTAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173871136 Original CRISPR ACCTTCTTTGAACTTGCCTA AGG (reversed) Intergenic
No off target data available for this crispr