ID: 1173871141

View in Genome Browser
Species Human (GRCh38)
Location 20:46342910-46342932
Sequence GCTTATCTGTAGAATGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173871136_1173871141 17 Left 1173871136 20:46342870-46342892 CCTTAGGCAAGTTCAAAGAAGGT No data
Right 1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173871141 Original CRISPR GCTTATCTGTAGAATGGGGA CGG Intergenic
No off target data available for this crispr