ID: 1173873423

View in Genome Browser
Species Human (GRCh38)
Location 20:46355551-46355573
Sequence CTTCCTAGACCCAGCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 234}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173873415_1173873423 21 Left 1173873415 20:46355507-46355529 CCCTGGGCCTAACACACAGGGCT 0: 1
1: 0
2: 3
3: 40
4: 240
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873417_1173873423 14 Left 1173873417 20:46355514-46355536 CCTAACACACAGGGCTACTGCCT 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873422_1173873423 -10 Left 1173873422 20:46355538-46355560 CCACAGCAGGGTGCTTCCTAGAC 0: 1
1: 0
2: 0
3: 25
4: 140
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873410_1173873423 30 Left 1173873410 20:46355498-46355520 CCACCTCCTCCCTGGGCCTAACA 0: 1
1: 1
2: 2
3: 59
4: 620
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873411_1173873423 27 Left 1173873411 20:46355501-46355523 CCTCCTCCCTGGGCCTAACACAC No data
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873421_1173873423 -9 Left 1173873421 20:46355537-46355559 CCCACAGCAGGGTGCTTCCTAGA 0: 1
1: 0
2: 0
3: 28
4: 162
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873412_1173873423 24 Left 1173873412 20:46355504-46355526 CCTCCCTGGGCCTAACACACAGG 0: 1
1: 0
2: 5
3: 18
4: 233
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873416_1173873423 20 Left 1173873416 20:46355508-46355530 CCTGGGCCTAACACACAGGGCTA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234
1173873420_1173873423 -6 Left 1173873420 20:46355534-46355556 CCTCCCACAGCAGGGTGCTTCCT 0: 1
1: 0
2: 2
3: 26
4: 260
Right 1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173873423 Original CRISPR CTTCCTAGACCCAGCTCTGC TGG Intronic
900081584 1:862575-862597 CTCCCTAGACCTGGGTCTGCAGG + Intergenic
900193342 1:1360652-1360674 CCTCCTAGCCCCACCTCTGGGGG + Intronic
900871495 1:5307263-5307285 CTGCCTCGTCCCAGCCCTGCAGG + Intergenic
903951395 1:26997923-26997945 CTTCCTAGACCTTGAGCTGCAGG + Intronic
904412900 1:30335762-30335784 CCTCCTACCCCAAGCTCTGCTGG + Intergenic
905083781 1:35350651-35350673 CTTCCCACTCCCAGCACTGCTGG + Intronic
905789933 1:40784339-40784361 CGTTGTAGACCCAGTTCTGCAGG - Exonic
905868793 1:41391350-41391372 CTGCCTAGACCCTGCTTTGAGGG - Intergenic
906212477 1:44019851-44019873 CTTCTCAGTCCCAGCTCAGCGGG - Intronic
906710877 1:47929150-47929172 CATCCTAGTCCCAGTTCTGCAGG - Intronic
906725861 1:48043737-48043759 CTGCCTAGCCCCTGCTGTGCAGG - Intergenic
907930198 1:58991954-58991976 CTTTTTAGACCCAGCAGTGCTGG + Intergenic
912387752 1:109280806-109280828 CTTCCAAGACCAAGCACTGCAGG - Exonic
912843403 1:113059103-113059125 CTCCCTAGGCCCAGGTCTCCTGG + Intergenic
914043073 1:144066769-144066791 CTACCTAGACCTACCCCTGCCGG + Intergenic
914135013 1:144893719-144893741 CTACCTAGACCTACCCCTGCCGG - Intronic
914227040 1:145729186-145729208 CTTCCAAGACCCATATCTGAGGG - Intronic
915148824 1:153812499-153812521 CTTCTTAGAGCCAGCTTTCCTGG - Intronic
915535816 1:156534685-156534707 CTTCCTGAACCCAGCTGTGGTGG - Exonic
916933642 1:169605305-169605327 CTCTCCAGACCCAGCTCTGAAGG + Intronic
919772727 1:201173002-201173024 CTTCCCAGGCCCATCCCTGCTGG - Intergenic
920450820 1:206059886-206059908 CTTCCTAGCCGTAGCTCTACTGG + Intronic
920497205 1:206463686-206463708 CCTACTAAACCCAGCTCTGGGGG + Exonic
1069728531 10:70596573-70596595 CTTCCTGGACACGGCTGTGCAGG - Intergenic
1072230650 10:93411563-93411585 CTTCCTGGAACCAGCTATGGGGG + Intronic
1073117183 10:101097841-101097863 GATCCTGGACCCAGCTCTGTTGG + Intronic
1073445466 10:103577724-103577746 CTTCCTTGTACCAGCACTGCTGG - Intronic
1075725350 10:124608099-124608121 CTCCCTAGTGCCAGGTCTGCTGG + Intronic
1076467109 10:130690534-130690556 CTTCATGGCTCCAGCTCTGCTGG + Intergenic
1077464785 11:2728573-2728595 CTCCCAAGGCCCGGCTCTGCTGG - Intronic
1078374028 11:10777814-10777836 GTTCCTAGACCGAACTCTGTGGG + Intronic
1078539263 11:12200201-12200223 TTCCCCAGAACCAGCTCTGCGGG - Intronic
1078579434 11:12527119-12527141 CTTACTAAACCCAGCTATGCTGG - Intronic
1080969365 11:37252417-37252439 CTTGCTAGAACTAGTTCTGCTGG + Intergenic
1081021096 11:37948343-37948365 CACGCTAGACCCAGCTCAGCAGG + Intergenic
1083605947 11:63979016-63979038 CTTCCTAGCTCCTGTTCTGCAGG + Intronic
1083842777 11:65314511-65314533 CTTCCCCGACGCAGCCCTGCAGG + Intergenic
1084501496 11:69538177-69538199 CTGCCGAGTCCCTGCTCTGCTGG - Intergenic
1088595552 11:111437922-111437944 CATCCTCAACCCAGATCTGCAGG + Intronic
1089065943 11:115662105-115662127 ATTCCTATACCCAGCTGTTCTGG - Intergenic
1089752058 11:120659133-120659155 CTGCCGACAGCCAGCTCTGCTGG - Intronic
1091148132 11:133298968-133298990 GTTCTTAGACCCAGATCAGCAGG + Intronic
1091205634 11:133818963-133818985 CTGTCTAGTCCCATCTCTGCTGG + Intergenic
1091208506 11:133836467-133836489 GATCCTTCACCCAGCTCTGCTGG + Intergenic
1091255709 11:134183191-134183213 AGTTCTAGTCCCAGCTCTGCCGG + Intronic
1091973843 12:4809847-4809869 CTCCCCAGACCCAGCCTTGCAGG + Exonic
1092114874 12:5993054-5993076 CATCCTAGTCCCAGCTCAGCTGG - Intronic
1096503749 12:52080612-52080634 GGTCCTAGGCCCAACTCTGCGGG + Intergenic
1102298251 12:111753677-111753699 CTGCTTCCACCCAGCTCTGCAGG + Intronic
1102904234 12:116662152-116662174 CCTCCTTAACCCAGCTCTTCAGG - Intergenic
1106139694 13:27001907-27001929 CCTCCTAGACCCACGTCTACTGG + Intergenic
1106235278 13:27856170-27856192 GTCCCTACACCCTGCTCTGCAGG - Intergenic
1111439045 13:88254103-88254125 CTTCCAATACCCAGCTTTGTTGG - Intergenic
1111797257 13:92938282-92938304 CTTTCTAGTCCCAGCTCTTGTGG + Intergenic
1113386931 13:109857521-109857543 TTCCCTAGGCTCAGCTCTGCAGG - Intergenic
1113749134 13:112766479-112766501 CCTTCTGGACGCAGCTCTGCAGG - Intronic
1113976200 13:114229312-114229334 CTTCCTCTGCCCAACTCTGCAGG + Intergenic
1114542103 14:23468647-23468669 ATTTCTAGACCCAGCTCTGTTGG + Intergenic
1114576519 14:23719339-23719361 CTTCATAGTCCCAGCCCTGAGGG - Intergenic
1118238593 14:64035654-64035676 AGTTCTAGTCCCAGCTCTGCTGG - Intronic
1118783679 14:69027767-69027789 CTTCAAAGACACAGCTCTTCTGG - Intergenic
1119655286 14:76413105-76413127 CTACCCAGACCCAGCATTGCAGG + Intronic
1119706584 14:76786694-76786716 CTTCCTAGGCCTACCTCTGTTGG - Intergenic
1120342696 14:83242588-83242610 CTTCCCAGACCCTGCTTTCCTGG + Intergenic
1120502275 14:85311171-85311193 CTTCCTAGATACAGTTCTCCTGG + Intergenic
1120835509 14:89035399-89035421 CTTCATAGCCCCTGCTCTGTGGG + Intergenic
1121382898 14:93489861-93489883 CTTCCTGGGCCCCACTCTGCAGG + Intronic
1121408321 14:93732824-93732846 CTTCCCAGCCCCAGCCCCGCCGG - Intronic
1122730645 14:103794776-103794798 CTTCCTAGATCCAGCTTCGTTGG + Intronic
1124118787 15:26870449-26870471 CTTCCTTAGCTCAGCTCTGCTGG - Intronic
1124155909 15:27225289-27225311 CTTCCCAGACACCGCCCTGCAGG + Intronic
1124208147 15:27740754-27740776 GTGCCTATGCCCAGCTCTGCTGG - Intergenic
1124259793 15:28178354-28178376 CCTCATAGACACAGCCCTGCTGG + Intronic
1124365804 15:29070789-29070811 CTTCCTCCACCCAGCTCAGAAGG - Intronic
1125541628 15:40472911-40472933 GCTCCAGGACCCAGCTCTGCAGG + Exonic
1127530517 15:59839168-59839190 CTTCCTTCACACTGCTCTGCTGG + Intergenic
1128407781 15:67360775-67360797 CTATCTAGGCACAGCTCTGCAGG - Intronic
1128606490 15:69040069-69040091 CCTCCCAGACCCAGCCCAGCAGG + Intronic
1128783001 15:70375267-70375289 CCTACTAGACCCACCCCTGCCGG + Intergenic
1128802626 15:70506320-70506342 CCTGCTGGACCCAGCTCTGGAGG + Intergenic
1129136309 15:73555353-73555375 CTTCCTAGCCACATGTCTGCAGG - Intronic
1130403575 15:83579218-83579240 GTTCCTAGCCCAAGCTCCGCAGG + Intronic
1130891226 15:88135576-88135598 CTTCCTAGATCCACCTTAGCTGG + Intronic
1132599894 16:768746-768768 CTTGCTGGCCCCAGCCCTGCTGG + Exonic
1132837478 16:1961572-1961594 CTTCCTTGATACAGTTCTGCTGG - Exonic
1133087930 16:3379652-3379674 AATCCAAGTCCCAGCTCTGCGGG - Intronic
1134076083 16:11292492-11292514 CTTCCTGGACCCAGGTCTCTTGG - Intronic
1134772857 16:16825359-16825381 CTTCGTAATCCCAGCTCTTCAGG - Intergenic
1139937653 16:70582979-70583001 CTCCCTACATCCAGCCCTGCAGG - Intronic
1140196559 16:72860224-72860246 CATCCCAGAACCAGCTCTGCAGG - Intronic
1141441970 16:84034888-84034910 CTTCCTAAACCCAGCGTTCCCGG + Intronic
1142107940 16:88316217-88316239 ATTCCTGGACCCAGCCCTGCGGG - Intergenic
1147163254 17:38579765-38579787 CTCCCCAGGCCCAGCCCTGCTGG + Intronic
1147184859 17:38707574-38707596 CTTCCCAGACCCTGCTCAGGGGG - Intronic
1147925249 17:43941814-43941836 CCTCCTAGACACTGCTCTGAAGG + Intronic
1149459322 17:56814305-56814327 GTTACTAGACCCTGCTATGCTGG - Intronic
1152527191 17:80895175-80895197 CTCGCTGCACCCAGCTCTGCTGG + Intronic
1154191758 18:12236159-12236181 CTTCCAAGACCCAGCTCAAGAGG - Intergenic
1157501912 18:48196693-48196715 TTTTCTAGACCCAGCTCTATGGG + Intronic
1157687872 18:49657378-49657400 CTGCCTATTCCCAGCGCTGCTGG + Intergenic
1157712198 18:49857832-49857854 CCTCCTCCACCCAACTCTGCTGG - Intronic
1160876707 19:1299938-1299960 GTTCCTAGTCCCAGCCCCGCAGG + Exonic
1161514620 19:4689707-4689729 CCTCATTGACCCAGATCTGCAGG + Exonic
1162801446 19:13112911-13112933 CTTCCTGGATGCAGCTGTGCAGG - Exonic
1163468244 19:17482078-17482100 CGCCCAAGACCCAGCTCTCCTGG - Intronic
1165097353 19:33416925-33416947 GTTCCCAGACCCAGATCTGCAGG + Intronic
1165749264 19:38250442-38250464 CTTCCCTGATCCAGCTCTGGGGG + Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166716879 19:44974106-44974128 CTTCCTGGTCAGAGCTCTGCAGG - Intronic
1167633354 19:50639342-50639364 CTTCATAGACCCGGCGCTGCAGG + Intronic
1168092553 19:54095567-54095589 CTTCCTGGACCCAGGACTCCAGG - Exonic
1168583746 19:57576515-57576537 CTTCAGAGACCCTGCTCTGAAGG + Intronic
925037182 2:697187-697209 CTCCCTGGACCCCCCTCTGCTGG + Intergenic
925250464 2:2432199-2432221 CTTGCTAGTCCCAGGTCTTCCGG + Intergenic
926195156 2:10759262-10759284 CTTCCTGCTCCCAGCTCTGCTGG - Intronic
927955340 2:27203911-27203933 CTTCCCAGGGCCGGCTCTGCAGG + Intronic
928120537 2:28580846-28580868 CTTCCTAAACCTCACTCTGCTGG - Intronic
928552036 2:32382194-32382216 CTTCCTAGTCCCAGATCCACGGG - Intronic
931461524 2:62454263-62454285 CTCCACAGACCCAGCTCTGGGGG + Intergenic
931744339 2:65278849-65278871 CTTCCTACACTCAGCTCCCCAGG - Intergenic
932335465 2:70928574-70928596 CTTGCTACACCCAGAGCTGCAGG + Intronic
933608941 2:84414382-84414404 CTTTTTAGACCCAACTCTGCAGG - Intergenic
933679701 2:85089026-85089048 CTTCCCACACCCAGATGTGCTGG + Intergenic
933758978 2:85661580-85661602 CTCCCCACACCCAGCTCTTCCGG + Intronic
933987109 2:87601343-87601365 CTCCCTAGCCCCAGCCCTCCAGG + Intergenic
934677440 2:96259628-96259650 CTTCCTAGAGCAGGCTCTGATGG - Intronic
936306733 2:111349465-111349487 CTCCCTAGCCCCAGCCCTCCAGG - Intergenic
940246847 2:151628301-151628323 CTTCCCAAATCCAGCTCTGCTGG + Intronic
948123091 2:235545381-235545403 CCTCCTAGTCACAGTTCTGCAGG + Intronic
948515230 2:238499285-238499307 ATTCCTACACCCAGCATTGCAGG - Intergenic
1173168493 20:40703299-40703321 CTTCCCAGTCCCATCTCTGTGGG - Intergenic
1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG + Intronic
1174068584 20:47883701-47883723 GCTCCGAGACCCAGCTCTGAAGG - Intergenic
1176307701 21:5132819-5132841 CTGCCTAGTCCCGGCTCTGCAGG + Intronic
1178929748 21:36807039-36807061 CTCCCTACCCCCAGCTCTGAGGG - Intronic
1179849359 21:44129211-44129233 CTGCCTAGTCCCGGCTCTGCAGG - Intronic
1180645406 22:17334517-17334539 CTTTCTAGACGCAGCAATGCAGG + Intergenic
1180858867 22:19065418-19065440 CTTCCAATGCCCAGCTCTCCTGG + Intronic
1181031146 22:20149366-20149388 CTTCTGAGACCCTGCTCAGCTGG + Intronic
1181512189 22:23394030-23394052 CTTCCGAGACCCTGCTCAGCTGG - Intergenic
1181626119 22:24123372-24123394 CTTCCAGGAGGCAGCTCTGCAGG + Intronic
1181895052 22:26099841-26099863 CTATCCAGATCCAGCTCTGCTGG - Intergenic
1182214536 22:28704946-28704968 CTTCCAAGACCCATCTATGGTGG - Intronic
1182354937 22:29718692-29718714 CTTCCTGGGCCCTGCTCTGGAGG - Intergenic
1182721961 22:32410255-32410277 CTTCAAAGAACCAGCTCTACAGG - Intronic
1182745917 22:32605404-32605426 CTTCCTAAAGCCTGCTCTACAGG - Intronic
1183236204 22:36620110-36620132 CTTCCTAGACTCAGCAGTCCAGG - Intronic
1183618830 22:38960917-38960939 CACCCCAGACCCAGCCCTGCAGG - Intronic
1183624033 22:38990862-38990884 CACCCCAGACCCAGCCCTGCAGG - Intronic
1183786119 22:40030124-40030146 CTTCCTGGCCCCATCCCTGCAGG + Exonic
1184659409 22:45958997-45959019 CATCCTGGACCCAGCTATGGGGG - Intronic
949931704 3:9083723-9083745 CATCCTAGAGGCAGTTCTGCTGG + Intronic
950014272 3:9744858-9744880 CTGCCCAGAGCTAGCTCTGCTGG + Intronic
951281880 3:20760680-20760702 CTTCCTGGAGCCATCTCTTCTGG - Intergenic
951634874 3:24762633-24762655 CTTTCTAGACCCAGGTTTGAGGG + Intergenic
952898407 3:38094423-38094445 CTTTCTGGACACAGCTCTCCTGG + Intronic
953462790 3:43095052-43095074 CTTCCTTGCCCCTGCTCAGCAGG + Intronic
954372579 3:50176543-50176565 CTTCCTAGTCCCAGGTCTTAGGG - Intronic
956139261 3:66129060-66129082 CTGGCTAGACCCAACTCAGCAGG + Intergenic
961639824 3:128358128-128358150 GTGCCTAGCCCCAGCTCTCCCGG - Intronic
961793062 3:129390328-129390350 CTTAAAAGGCCCAGCTCTGCTGG - Intergenic
961806942 3:129496224-129496246 CTTAAAAGGCCCAGCTCTGCTGG - Intronic
962202404 3:133412652-133412674 CTACCAAGCGCCAGCTCTGCCGG + Intronic
963769754 3:149378201-149378223 CTGCCTACAGCAAGCTCTGCAGG + Intergenic
964695080 3:159498513-159498535 CTTCCTCCACTCAGCTCTGTTGG - Intronic
965093537 3:164193086-164193108 CTTGCTAGACAAGGCTCTGCTGG + Intergenic
968547569 4:1206643-1206665 CTCCCCAGGCTCAGCTCTGCAGG + Intronic
968759089 4:2432901-2432923 CGGCCTAGGCCCATCTCTGCTGG + Intronic
969235103 4:5860062-5860084 TTTCCCAGACCGAGCACTGCTGG + Intronic
969708726 4:8830730-8830752 CTTCCTAGTCCCTGGTCTGGGGG - Intergenic
978947223 4:114514805-114514827 CTTACCAGACACAGATCTGCTGG + Intergenic
979609455 4:122673818-122673840 ATTCCAAGACACATCTCTGCTGG - Intergenic
981155939 4:141435118-141435140 CTTCCTTGACCCACCTCCTCTGG + Intergenic
981799742 4:148641587-148641609 AATCCAAGACCTAGCTCTGCTGG - Intergenic
983204966 4:164902359-164902381 GTTCCTAGAGGCAGCTCAGCAGG + Intergenic
985844585 5:2334825-2334847 CTTCAAAGTCCCAGCCCTGCTGG - Intergenic
986359223 5:6959890-6959912 CTTCAGTAACCCAGCTCTGCAGG - Intergenic
986438104 5:7755165-7755187 CGCCCTCGGCCCAGCTCTGCAGG - Intronic
986438810 5:7760261-7760283 CTTCCAAGATCCAGCTCCCCAGG + Intronic
989138242 5:38176499-38176521 CTTCCAAGACACAGCTTTTCAGG + Intergenic
989142004 5:38210827-38210849 CTTCCTCCACCCTGCGCTGCTGG + Intergenic
989413659 5:41148923-41148945 CTTCCGAGTCCCAGCTTTGGAGG - Intronic
990541056 5:56772568-56772590 CTTCCTGGTTTCAGCTCTGCAGG - Intergenic
990980591 5:61599522-61599544 CTTCCTACAGGAAGCTCTGCAGG - Intergenic
992308357 5:75466717-75466739 CTTCTGAGTCCCACCTCTGCAGG + Intronic
992762094 5:79959609-79959631 CTTCCAACACGCAGCTGTGCTGG + Intergenic
993194468 5:84722979-84723001 CAGCCAAGACCAAGCTCTGCGGG - Intergenic
994498175 5:100539688-100539710 CTGCCCAAACCCAGCTCTGCTGG + Intronic
994726621 5:103443925-103443947 CTTCCCAGACATGGCTCTGCAGG + Intergenic
998669518 5:144338115-144338137 TTTCCCAGACCTAGCCCTGCTGG + Intronic
999609688 5:153355321-153355343 CTTCCCTGACCCTGGTCTGCTGG + Intergenic
1000579024 5:163012362-163012384 CTTGCTGCACCCAGCCCTGCAGG + Intergenic
1004110709 6:12715970-12715992 CTCCCTATACACAGCTCGGCTGG - Intergenic
1006001743 6:30970501-30970523 CTTCCTGGACCCAGGAATGCTGG - Intergenic
1006069409 6:31487368-31487390 CTTCCAAGTCCCCTCTCTGCAGG - Intergenic
1006284381 6:33081525-33081547 CTTCCAAGACTCTTCTCTGCGGG - Intronic
1008451567 6:51657146-51657168 ATTCCTAGACTCATTTCTGCTGG + Intronic
1011170200 6:84497022-84497044 CTCCCCAGACCAAGCTCTGTTGG - Intergenic
1011682963 6:89800681-89800703 CTTCCTTGACTCACCTCTTCAGG - Intronic
1016057606 6:139594785-139594807 CTTACTAGGCCCATCTCTTCTGG - Intergenic
1016285596 6:142469082-142469104 CTTCTGAAACCCAGCTCTGATGG + Intergenic
1019567806 7:1693244-1693266 CTTCCTAACCCCACGTCTGCTGG - Exonic
1020097410 7:5376729-5376751 CTCCCCAGCCCCAGATCTGCCGG + Intronic
1022380995 7:29859867-29859889 CTTCCAAGGCCCAGCTATGAAGG - Intronic
1022645964 7:32228827-32228849 CTTTCTAGCCCCAGCTCTCCTGG + Intronic
1022750677 7:33221082-33221104 ATTCTGAGGCCCAGCTCTGCTGG + Intronic
1023255229 7:38306241-38306263 CTGTCTTGACCTAGCTCTGCAGG + Intergenic
1023895859 7:44432371-44432393 CTTCCTAGACAAAACTCTTCAGG - Intronic
1026037027 7:66837215-66837237 CTTCCCAAACCCAGCCCGGCAGG - Intergenic
1028026321 7:85845169-85845191 CTTACTAGTCCCTGCACTGCTGG + Intergenic
1029611459 7:101628725-101628747 CTGCCTGAACCCAGCACTGCCGG - Intronic
1031729758 7:125284767-125284789 CTTCCCTGACCCAGCTCCCCAGG - Intergenic
1033209976 7:139453482-139453504 CTTCCTGGACCCAGTTATCCAGG - Exonic
1034240643 7:149608302-149608324 AGACCAAGACCCAGCTCTGCCGG - Intergenic
1035075847 7:156176817-156176839 CCTCCTGGCCACAGCTCTGCAGG - Intergenic
1035523683 8:294975-294997 CTCCCTAGACCTGGGTCTGCAGG - Intergenic
1035682884 8:1501413-1501435 CTACCTAGATCCTCCTCTGCCGG - Exonic
1036707483 8:11056103-11056125 CCTCCTGGACCCAGTGCTGCTGG + Intronic
1036975806 8:13410992-13411014 TTTCCAAGAATCAGCTCTGCAGG - Intronic
1037769282 8:21789365-21789387 CTTCCCAGACCCAGCGGCGCAGG - Intronic
1037946413 8:22992410-22992432 CTTCTCACTCCCAGCTCTGCAGG + Intronic
1039589311 8:38733612-38733634 ATTCCTAGCACCAGCTCAGCAGG + Intronic
1040532250 8:48275405-48275427 CTTACTCAACCCAGCTCTCCCGG + Intergenic
1043110419 8:76172873-76172895 CTTTGTAGTCCCAGCTCAGCGGG + Intergenic
1044506851 8:93030608-93030630 AACCCTAGCCCCAGCTCTGCAGG + Intergenic
1044749473 8:95402326-95402348 CTTCCTAGTCCACGCTCTGATGG + Intergenic
1045234097 8:100334697-100334719 CTTTCAAGACCCAGCCCCGCTGG + Intronic
1048091292 8:131243227-131243249 TGTTCTAGTCCCAGCTCTGCTGG + Intergenic
1048430878 8:134369447-134369469 CATCCTAGACCCAGTTCAGTCGG - Intergenic
1049649495 8:143758743-143758765 CCTCCAAGAACCAGCACTGCCGG + Intergenic
1051968143 9:22854660-22854682 GTTCCTAGACCCATTGCTGCTGG - Intergenic
1053177915 9:35942694-35942716 CCTTCTAGAGCCAGCTCTTCTGG + Intergenic
1057785635 9:98085497-98085519 CTTCCCAGACCCACAGCTGCAGG - Exonic
1058485238 9:105436978-105437000 CTTCCAAGTCCAAGCTCTCCTGG + Intronic
1060780641 9:126409710-126409732 CATTCTAGTCCCAGCTCCGCAGG - Intronic
1060829467 9:126704600-126704622 CTTCCCAGACCCAGCCCACCTGG + Intergenic
1060916736 9:127396610-127396632 ATGCCTGGGCCCAGCTCTGCAGG - Intergenic
1062116644 9:134813032-134813054 CCTCCAAGACTCAGCTCTGGTGG + Intronic
1185736617 X:2500808-2500830 CTTCCTGGAGCCAGGTCAGCGGG - Exonic
1186370162 X:8938294-8938316 TTTCCTTGGCCTAGCTCTGCAGG + Intergenic
1186485165 X:9929099-9929121 GTTCCAAGAGGCAGCTCTGCAGG - Intronic
1186851928 X:13589005-13589027 TTCCCAACACCCAGCTCTGCTGG + Intronic
1186869620 X:13757652-13757674 CTTCTTAGGCCTAGCTCAGCCGG + Exonic
1191103509 X:56758391-56758413 CTTTCTCGACCCTGTTCTGCTGG - Intergenic
1194087598 X:89548095-89548117 CTGGCAAGTCCCAGCTCTGCTGG + Intergenic
1194110881 X:89833171-89833193 CTGCCTAGAACCATCACTGCTGG + Intergenic
1195543731 X:106091871-106091893 CTTCCTAGACCCATCTAGGAAGG + Intergenic
1198055832 X:132993894-132993916 ATTCCTAGACCCATCTATTCTGG + Intergenic
1199248142 X:145630856-145630878 CTTCCTGGATGCAGCTGTGCTGG + Intergenic
1199495239 X:148445611-148445633 CTTCTTAGACCTAGTCCTGCAGG + Intergenic
1200440242 Y:3203965-3203987 CTGGCAAGTCCCAGCTCTGCTGG + Intergenic
1200463541 Y:3487908-3487930 CTGCCTAGAACCATCACTGCTGG + Intergenic