ID: 1173874450

View in Genome Browser
Species Human (GRCh38)
Location 20:46361403-46361425
Sequence GAGACTCCTGCAGTCATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173874450_1173874455 20 Left 1173874450 20:46361403-46361425 CCCCAAATGACTGCAGGAGTCTC 0: 1
1: 0
2: 1
3: 9
4: 146
Right 1173874455 20:46361446-46361468 CTCCTGCAACCACCACCATCAGG 0: 1
1: 0
2: 3
3: 61
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173874450 Original CRISPR GAGACTCCTGCAGTCATTTG GGG (reversed) Intronic
902149015 1:14427182-14427204 AGGACACCTGCAGACATTTGAGG - Intergenic
908268030 1:62397416-62397438 GAGAGTCCTGCAGTGTCTTGGGG - Intergenic
910712006 1:90191831-90191853 GAGACTCCTGTGGTCACTTTGGG - Intergenic
912508012 1:110169938-110169960 GAGAGACCTGCAGTCACTTCAGG + Intronic
912578950 1:110703294-110703316 GAGATCCCTGCAATCAGTTGTGG + Intergenic
913438807 1:118875549-118875571 CAGGCTCCTGCAGTCTTTTCTGG + Intergenic
915702189 1:157806624-157806646 GAGAATCCTCCAGACATGTGTGG - Intronic
915890960 1:159773482-159773504 CAGACTCCAGCACTCATGTGGGG - Intergenic
918128718 1:181606508-181606530 GAGGCTGCTGCAGTCATCAGGGG - Intronic
919789553 1:201282259-201282281 GTCACTCTTGCTGTCATTTGAGG - Intergenic
1068743518 10:60502024-60502046 GGGTATCCTGTAGTCATTTGGGG - Intronic
1068743522 10:60502044-60502066 GGGTATCCTGTAGTCATTTGGGG - Intronic
1070440174 10:76435392-76435414 GAGGCTGATGCAGTCATCTGAGG + Intronic
1070733148 10:78845529-78845551 GAGACTCCTGCCATCCTCTGAGG + Intergenic
1076220985 10:128733156-128733178 GAGACTCCTGCAGTCTCTCCAGG - Intergenic
1076585668 10:131546025-131546047 GAGATTCCTGCAGGCATTCAGGG - Intergenic
1080420814 11:32109073-32109095 GAGAGTTCTGGAGTCATCTGGGG - Intergenic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1084727161 11:70949413-70949435 GAGACTCCGCCCGTCATGTGGGG + Intronic
1086678593 11:89640580-89640602 GGGAATCCTGCAATCATTAGAGG - Intergenic
1089060678 11:115623486-115623508 AAGGCTACTGCAGTCCTTTGGGG + Intergenic
1090217519 11:124983325-124983347 GGAACTAGTGCAGTCATTTGAGG + Intronic
1092191513 12:6524725-6524747 TAGACTCCTGAAGTCATTCAGGG - Intronic
1094258474 12:28464239-28464261 TAGACTTCTGCATTCATTTTGGG - Intronic
1100799849 12:98219662-98219684 GAGACAGCTGCCTTCATTTGGGG + Intergenic
1101826309 12:108223091-108223113 GAGCCTCATGCAATCAGTTGAGG - Intronic
1103137234 12:118518214-118518236 GAGACTAATACAGTCATTTATGG - Intergenic
1103147320 12:118606860-118606882 GGGATTCCTGCAATCATTTCGGG + Intergenic
1112602372 13:100869102-100869124 GAGACTCCTGCAGTCCTCACAGG - Intergenic
1113225263 13:108152626-108152648 GAGACACATTCAGTCAGTTGGGG + Intergenic
1113336834 13:109384674-109384696 GAGACTCCAGCAGTGCCTTGTGG - Intergenic
1116297587 14:43133251-43133273 GGCACTCTTGCAGTCATTTGTGG - Intergenic
1116701359 14:48246919-48246941 GAGCCTCGGGCAGTCATTAGAGG - Intergenic
1117356387 14:54927472-54927494 GAGACTCCTGCATCCACATGAGG - Intergenic
1118669279 14:68104595-68104617 GAGACTCCTGCAGTGATGAAAGG - Intronic
1122051131 14:99060849-99060871 GAGGCTGATGCAGACATTTGGGG - Intergenic
1122262679 14:100532032-100532054 GCCACGCCTGCAGTCACTTGTGG - Intergenic
1125357242 15:38829279-38829301 GAAACTCATACAGTCATTGGAGG + Intergenic
1127551053 15:60038707-60038729 AAGACTCCTACAGTCATTTCTGG + Intronic
1127638313 15:60892086-60892108 AAGACTGCTGCAGTCAGTTACGG + Intronic
1129030072 15:72611579-72611601 GAGTCTCCTGCAGTTTTTGGTGG - Intergenic
1129828319 15:78650311-78650333 CTGACTCCTGCTGTCATTTGTGG - Intronic
1130923201 15:88366159-88366181 TAGCCACCTCCAGTCATTTGTGG + Intergenic
1143809247 17:9457384-9457406 GAGACTCGAGCAGTCATTGCTGG - Intronic
1146895283 17:36536256-36536278 GTGACCCCTGCAGTGATTTCTGG - Intronic
1147281477 17:39364701-39364723 CAGACTCCTGCAGCCATCTAAGG + Intronic
1149570571 17:57669463-57669485 GAAACTCCTCCAGGCAGTTGGGG - Intronic
1152263656 17:79280858-79280880 GGGTCTCCTGCAGGCATGTGGGG + Intronic
1152264871 17:79288382-79288404 GAGACTCCTCCAGTCATGGGAGG - Intronic
1155538966 18:26847093-26847115 GTGATTCCTGCAGTCAATCGAGG + Intergenic
1157801533 18:50625445-50625467 GTGACTCCTGCGGTCTTTGGAGG - Intronic
1158563660 18:58536157-58536179 CAGACTCCTGGAGTCATCCGTGG - Exonic
1158587093 18:58749582-58749604 GGCACTTTTGCAGTCATTTGTGG - Exonic
1158844599 18:61428475-61428497 GAGACCCCAGCAGCCATCTGTGG - Intronic
1158886498 18:61832523-61832545 GAAACTCAAGCAGTTATTTGTGG - Intronic
1161299213 19:3534779-3534801 CAGACTCCTGCAGACACATGGGG - Exonic
925942068 2:8830303-8830325 GAGAATCCTCCTGGCATTTGAGG - Intronic
927893503 2:26766942-26766964 GGGACTTCTCCAGTCATTTTGGG + Intronic
932718564 2:74121479-74121501 GAGCCTCCTGGAGACATCTGAGG + Intergenic
933986184 2:87594129-87594151 GACACTCCAGCTGTCATTTTTGG + Intergenic
935430180 2:102967572-102967594 GACTCATCTGCAGTCATTTGAGG - Intergenic
936307651 2:111356674-111356696 GACACTCCAGCTGTCATTTTTGG - Intergenic
938377565 2:130818864-130818886 GACAGCCCTGCAGTGATTTGAGG + Intergenic
942421782 2:175815252-175815274 CAGAATCCTGTAGTCATGTGGGG - Intergenic
945056223 2:205871590-205871612 GAGACTCCAGCACTCACTTGTGG + Intergenic
945875550 2:215274426-215274448 GAGACTCCTACAACCATTTCAGG - Intergenic
946123162 2:217534512-217534534 GAGACTCCTGTTCTCATGTGTGG + Intronic
947463536 2:230322994-230323016 GACACTCCTGCAGTCCTTGCAGG - Intergenic
1169673485 20:8130412-8130434 ATGACTCTTGCTGTCATTTGAGG - Intergenic
1169681108 20:8214854-8214876 GCTACTCCTGAAGTTATTTGCGG + Intronic
1171019451 20:21572060-21572082 TAGGCCCCTGCAGCCATTTGGGG - Intergenic
1171036827 20:21719517-21719539 GAGTTTCTTCCAGTCATTTGCGG + Intergenic
1171136835 20:22702260-22702282 AAGAATCTTGCAGTCATTTATGG + Intergenic
1173042619 20:39478558-39478580 CACACTCCTGCAGTCATTCAAGG + Intergenic
1173560300 20:44000294-44000316 GAGACTGCTGCAGTCATCCAGGG + Intronic
1173874450 20:46361403-46361425 GAGACTCCTGCAGTCATTTGGGG - Intronic
1175138373 20:56841808-56841830 GAGAGTCATGGAGTCATTGGGGG + Intergenic
1176342032 21:5708018-5708040 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1176474286 21:7140170-7140192 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1176502795 21:7616438-7616460 GAGTCTCCTGCTTACATTTGTGG + Intergenic
1176536353 21:8106087-8106109 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1178072141 21:28979994-28980016 CAGTGTCTTGCAGTCATTTGTGG + Intronic
1178711669 21:34922659-34922681 GGGACTCCAGCAGGCAATTGTGG - Intronic
1179576158 21:42309833-42309855 GTGACTCCAGCAGTCAGTAGAGG + Intergenic
1181805356 22:25371486-25371508 GAGACTCCTGTACTCAGGTGTGG - Intronic
1184226721 22:43133030-43133052 GAGCCCCCTGCAGTCATCTCGGG + Exonic
1185119552 22:48957823-48957845 GAGAAACCTGCAGTCTTTTTGGG - Intergenic
949304838 3:2628157-2628179 GAGGCTCCTCCAGGCATTTGTGG - Intronic
950825737 3:15818707-15818729 GAAACACCTGCAGTCAATTATGG - Intronic
951885896 3:27524116-27524138 GAGACTGCTCCAATCTTTTGAGG - Intergenic
954755626 3:52837933-52837955 GTGCCTCCTGCAGTCACTGGGGG - Exonic
954959411 3:54550955-54550977 GAGGCTCCTGCAGTCATCCATGG - Intronic
955408657 3:58642019-58642041 GAGGCTCCTACAGTCTTCTGGGG + Intronic
962942456 3:140138193-140138215 GAGAAATCTGCTGTCATTTGGGG - Intronic
963936869 3:151062737-151062759 GAAACTCCAGCAGTCATTTGGGG - Intergenic
964567953 3:158078030-158078052 GAGACACCTGAATTCATTGGGGG - Intergenic
967387863 3:188928391-188928413 GAGATTCAAGCAGTAATTTGGGG - Intergenic
971226146 4:24753084-24753106 GAGATTCATTCAGTTATTTGAGG - Intergenic
972412867 4:38810593-38810615 GGGGCTGCTGCAGTCATTTTGGG + Intronic
972840958 4:42929548-42929570 GAAACTCCTGTATTTATTTGGGG + Intronic
976964054 4:91012826-91012848 GGGACCCCTGCAGTCCTTTCAGG - Intronic
976981025 4:91229390-91229412 GAGAATTCTCCAGTCATCTGAGG + Intronic
977738349 4:100444903-100444925 GAGACTTCTGCAGTCCTTATAGG - Intronic
978624614 4:110670414-110670436 GAGAGCCCTGCAGTCATTCAAGG + Intergenic
978655118 4:111056554-111056576 GTGATTCCTCCAGTCTTTTGTGG - Intergenic
981797108 4:148608092-148608114 GACACTTTTGGAGTCATTTGTGG - Intergenic
982470391 4:155782574-155782596 GAGACTGTTGCAGTAATTTAGGG - Intronic
982818574 4:159917999-159918021 CACATTCCTGCTGTCATTTGAGG + Intergenic
984928622 4:184827171-184827193 GAAAGTCCTTCAGTTATTTGTGG - Intergenic
987086798 5:14477718-14477740 GAGGCTCCTGCAGCCATGCGCGG + Intronic
988236658 5:28554494-28554516 GTGTATCCTGCAGCCATTTGAGG + Intergenic
989121395 5:38008049-38008071 GAGACTCCTGAAATGATTAGGGG - Intergenic
989199589 5:38750347-38750369 CAGAGTCCGGCTGTCATTTGAGG + Intergenic
990878077 5:60509397-60509419 GGCGCTTCTGCAGTCATTTGTGG - Intronic
994454831 5:99992298-99992320 GCCACTTGTGCAGTCATTTGTGG - Intergenic
995238367 5:109857097-109857119 GAGACTCCTGCAGATTTCTGGGG + Intronic
998135580 5:139672701-139672723 GTGACTTCTGCAGTAGTTTGGGG + Intronic
1001788315 5:174432828-174432850 TGGAGTCCAGCAGTCATTTGTGG - Intergenic
1002256734 5:177963211-177963233 GAGAGTCCTGCAGCAATCTGGGG + Intergenic
1004923744 6:20400650-20400672 GAGACCCCTGCAGGAATGTGGGG - Intergenic
1006525247 6:34599017-34599039 GAGACCTCTTCATTCATTTGTGG - Intronic
1006992422 6:38226801-38226823 GAGGCTTCTAAAGTCATTTGTGG + Intronic
1011788941 6:90877130-90877152 GAGCTGCCTGCAGTCCTTTGCGG - Intergenic
1014284071 6:119476588-119476610 CAGACTCCTCCAGTGAATTGGGG - Intergenic
1015230365 6:130908193-130908215 GGGACTCTTGGAGTCATTTTGGG + Intronic
1017575036 6:155792853-155792875 GAGAAGCCTGCAGGCAGTTGGGG + Intergenic
1018250230 6:161862263-161862285 GAGACTTGTGCATTCATTTCAGG - Intronic
1021093420 7:16509219-16509241 AAGACTCCTGGAGTGATTTGAGG - Intronic
1023089817 7:36607426-36607448 GAGACTCCTGCTGGTGTTTGAGG + Intronic
1027876081 7:83770488-83770510 GAGATTCCTGCATTGTTTTGTGG - Intergenic
1029223199 7:99006520-99006542 GTGTGTCCTGGAGTCATTTGGGG + Intronic
1030930369 7:115516267-115516289 AAGACTCCTGAACACATTTGGGG - Intergenic
1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG + Intergenic
1031971904 7:128070862-128070884 GGTACTTTTGCAGTCATTTGTGG + Intronic
1032684147 7:134213585-134213607 GAGGCTCCTGAAGGCATTTGGGG + Intronic
1034487039 7:151372593-151372615 AAGACTCCTGCTGGCATGTGTGG + Intronic
1034949274 7:155285989-155286011 AAGACTCCTCCACTCATATGAGG - Intergenic
1035938908 8:3874389-3874411 GTGACTCCTACAGTCATTATAGG + Intronic
1036122024 8:6028959-6028981 GACACTTCTGAAGGCATTTGGGG + Intergenic
1036941059 8:13052422-13052444 GGGACTCGTTCAATCATTTGAGG - Intergenic
1038021817 8:23557494-23557516 GGGCCTCCTGCTGTGATTTGTGG + Intronic
1040787692 8:51185359-51185381 GAGAGTCCAGCAGTCATGTCGGG - Intergenic
1048576367 8:135693358-135693380 GAGATTCCTGCAGGTATTTCAGG + Intergenic
1050280961 9:4049495-4049517 GACACTCCTGCCGGCATCTGTGG - Intronic
1050654314 9:7809610-7809632 GAGACACCTGCAGAAATTTAGGG - Intronic
1054925377 9:70583677-70583699 GAGAATCCTCTAGCCATTTGGGG + Intronic
1055651931 9:78414724-78414746 GAGGCTCCTGCAGCCAGTGGTGG + Intergenic
1057856604 9:98605576-98605598 GGGACTGCTGCTGCCATTTGGGG + Intronic
1057987636 9:99733329-99733351 AAAACTCCTACAGGCATTTGAGG + Intergenic
1058705977 9:107638067-107638089 GAGACTGTTGCAGTAATTGGTGG + Intergenic
1062093778 9:134692336-134692358 GAAACCGCTGCAGTCCTTTGCGG - Intronic
1203457621 Un_GL000220v1:5572-5594 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1187047161 X:15658349-15658371 GAGACGTCTGCTATCATTTGGGG + Intronic
1191700079 X:64033014-64033036 AAGACTCCTGCAGTCATCACAGG + Intergenic
1192052045 X:67733237-67733259 GGGATTCTTGCAGTCTTTTGAGG - Intergenic
1192521350 X:71804200-71804222 GAGACTCCTTCCTTCACTTGAGG + Intergenic
1201460075 Y:14212720-14212742 GTGACACCTGCAGACCTTTGAGG - Intergenic