ID: 1173875102

View in Genome Browser
Species Human (GRCh38)
Location 20:46365304-46365326
Sequence CCCTGGCCCCTCTGAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173875099_1173875102 1 Left 1173875099 20:46365280-46365302 CCTTACAAGTGACTCAGCTGGGA No data
Right 1173875102 20:46365304-46365326 CCCTGGCCCCTCTGAACAGAAGG No data
1173875096_1173875102 19 Left 1173875096 20:46365262-46365284 CCAGCTGCAAACATGGATCCTTA No data
Right 1173875102 20:46365304-46365326 CCCTGGCCCCTCTGAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173875102 Original CRISPR CCCTGGCCCCTCTGAACAGA AGG Intergenic
No off target data available for this crispr