ID: 1173876839

View in Genome Browser
Species Human (GRCh38)
Location 20:46378105-46378127
Sequence TGCCCTGATGTTTCTTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173876839_1173876842 8 Left 1173876839 20:46378105-46378127 CCAACTTAAGAAACATCAGGGCA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1173876842 20:46378136-46378158 ATTAATTATCCTAGCATCAATGG 0: 1
1: 0
2: 0
3: 6
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173876839 Original CRISPR TGCCCTGATGTTTCTTAAGT TGG (reversed) Intronic
901971533 1:12912513-12912535 TGTCCTGCTTTTTTTTAAGTTGG - Intronic
902013635 1:13289227-13289249 TGTCCTGCTTTTTTTTAAGTTGG + Intergenic
902560903 1:17276924-17276946 AGCCATGATGTGTCTTAATTTGG - Intronic
903286396 1:22279607-22279629 GGCCCCGATGTTTCTTAATGGGG - Intergenic
904390283 1:30180524-30180546 TGCTCTGATGGTTAGTAAGTTGG - Intergenic
906935030 1:50207347-50207369 AGCTCTGATGGTCCTTAAGTTGG - Intergenic
906980246 1:50621701-50621723 AGCCCCGATCTTTCTTAGGTTGG + Intronic
907771612 1:57470991-57471013 TGTGCTGATGGTTTTTAAGTAGG - Intronic
908015293 1:59826360-59826382 TGCCCTGAGATTTCTGAGGTTGG + Intronic
908411956 1:63875492-63875514 TGCCCTCAAGGTTCTTAATTAGG - Intronic
913067506 1:115269994-115270016 TTGACTAATGTTTCTTAAGTTGG + Intergenic
913567847 1:120090961-120090983 TGCCCTGATGTTCCTCTATTTGG + Intergenic
914288597 1:146251670-146251692 TGCCCTGATGTTCCTCTATTTGG + Intergenic
914372726 1:147043916-147043938 TGCTCTGAAGTTTCTTACTTTGG - Intergenic
914549632 1:148702414-148702436 TGCCCTGATGTTCCTCTATTTGG + Intergenic
914617051 1:149369302-149369324 TGCCCTGATGTTCCTCTATTTGG - Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
921642594 1:217572956-217572978 TGTCCTAACGTATCTTAAGTAGG - Intronic
922951321 1:229560244-229560266 ATCCTTGATGTTTCTTTAGTTGG + Intergenic
923109334 1:230878794-230878816 TGCCCTGACATTTGTTAAATTGG + Intergenic
1064406184 10:15065822-15065844 TGCTCTGAGGTTGCTTATGTGGG + Intronic
1064726395 10:18284235-18284257 AGCCCTGATGGTTTTTAAGAGGG - Intronic
1068494647 10:57771906-57771928 TTGCCTGATGTGTATTAAGTTGG - Intergenic
1073281322 10:102356447-102356469 AGCCCTGATGTTTTCTCAGTTGG - Intronic
1073532994 10:104250005-104250027 TTCCCTTCTGTTTCTTCAGTTGG - Intronic
1074135010 10:110618381-110618403 AGGCATGATGTTTCCTAAGTGGG + Intergenic
1074398990 10:113126461-113126483 TGCCTTTATGTTTGCTAAGTCGG + Intronic
1074563299 10:114553646-114553668 TGCCTAGATGTTTACTAAGTGGG + Intronic
1074807500 10:117068092-117068114 TGGCCTGATGACTCTTAAATGGG - Intronic
1074820129 10:117172046-117172068 TGCCTTGATGTTTATTTATTAGG - Intergenic
1076166818 10:128288956-128288978 TGCCCAGATGTTTCTTGGGTGGG + Intergenic
1078204521 11:9216617-9216639 TGCCCTGCTGGTTCTTAAACAGG - Intronic
1081562633 11:44231964-44231986 TGCCCTGATTTGTATTAAATTGG - Intronic
1084410265 11:69002697-69002719 TGCCCTGATGGATCCTAAGGCGG - Intergenic
1085564666 11:77502612-77502634 TGCCCTGAAGTGTCTTCAGATGG + Intergenic
1090550992 11:127819815-127819837 TGCCCAGTTTTTTCTCAAGTTGG - Intergenic
1093459162 12:19392803-19392825 GGCCCTGAGGTATTTTAAGTAGG + Intergenic
1097934456 12:65229619-65229641 TTCCCTGATGATTCATATGTTGG + Intronic
1098434297 12:70452311-70452333 TGTTCTAATGTTTCTTAAGGAGG + Intergenic
1108485995 13:50925746-50925768 TGCACTGATCCTACTTAAGTAGG + Intronic
1112724958 13:102292735-102292757 TGTCCTGCTGTTTATTATGTGGG - Intronic
1113009106 13:105743141-105743163 TGCCCTGATGTTACCTGACTAGG + Intergenic
1115102709 14:29722421-29722443 GGCCCTGATTTCTCTTATGTGGG + Intronic
1118765839 14:68908787-68908809 TGCAGTGATTTTTCTTGAGTGGG - Intronic
1119950591 14:78740023-78740045 TGCCCTGGCATCTCTTAAGTTGG + Intronic
1120503241 14:85323201-85323223 TGACATGGTGTTTTTTAAGTGGG - Intergenic
1121013405 14:90534711-90534733 TGCCCTGAAATTCCTTCAGTAGG + Exonic
1123021888 14:105402310-105402332 TGTACTCATGTTTCTTAAATTGG - Intronic
1130242535 15:82209697-82209719 TAACCTGATGTTTATAAAGTTGG - Intronic
1130457857 15:84131159-84131181 TAACCTGATGTTTATAAAGTTGG + Intergenic
1137863900 16:51873834-51873856 TTACCTGGTGTTTCTTAAGCTGG + Intergenic
1149958353 17:61078844-61078866 TTTCCTGATCTTTCTGAAGTTGG + Intronic
1151043858 17:70896207-70896229 TGACCTGATGTCCCTTCAGTCGG - Intergenic
1154942551 18:21129118-21129140 TGCACTTCTGTTTCTTAATTTGG + Intergenic
1155130421 18:22929091-22929113 GGCCCTGATGTTTCTTACCTAGG - Intronic
1155783748 18:29873506-29873528 CCCCCTGATGTTTCTTACCTTGG - Intergenic
1166597884 19:44066647-44066669 TTCTCTGATGTTTCTGAAGCTGG - Exonic
930228348 2:48817680-48817702 TGAGCAGATGTTTCTTCAGTGGG + Intergenic
933222131 2:79702597-79702619 TGCCTTCATATTTCTTAGGTTGG + Intronic
933789320 2:85871399-85871421 TGCCCTTATATTTCTTCATTAGG - Intronic
934907006 2:98213780-98213802 TGCCTAGATGTCTCTCAAGTCGG - Intronic
936801781 2:116278215-116278237 GGTCCTGATGTTTCTTTTGTTGG + Intergenic
938160612 2:128981680-128981702 TGCCCTGAAGCTTCCTGAGTGGG + Intergenic
939889338 2:147718221-147718243 GGCCCAGATCCTTCTTAAGTTGG - Intergenic
941153436 2:161943415-161943437 TGCCATGCTCTTTCTTGAGTGGG - Intronic
941339467 2:164288699-164288721 TTTCTTGATGTTTCTTAAGAAGG - Intergenic
941357087 2:164507190-164507212 TACCCTGATATCTCTTAAGTTGG + Intronic
943679687 2:190755255-190755277 TCCCCTGATGTGGCCTAAGTGGG - Intergenic
944330896 2:198465140-198465162 TGGCGTGATGTGTCTTCAGTGGG + Intronic
944779415 2:203002787-203002809 TGCCCTGGTTATTTTTAAGTGGG - Intronic
944838612 2:203604228-203604250 TTCCCTGCTGTTTCAAAAGTGGG + Intergenic
944976528 2:205059400-205059422 TGCCCAGATGTTTCTTCTGCTGG + Intronic
948656557 2:239480062-239480084 TGCCCTGCTAGTTCTTAGGTTGG - Intergenic
1169406066 20:5322264-5322286 TGCCCTGAGGTGTCTTGGGTTGG + Intergenic
1169734134 20:8819071-8819093 TACCAAGATGTTTCTGAAGTGGG + Intronic
1170912076 20:20582647-20582669 TGCCCTGCTAGTTCTTAAGTTGG + Intronic
1170945577 20:20888192-20888214 AGCCCTCCTGTTTCTTCAGTAGG + Intergenic
1171310767 20:24143117-24143139 TGCCCTCATGGTTCTCAGGTGGG - Intergenic
1173876839 20:46378105-46378127 TGCCCTGATGTTTCTTAAGTTGG - Intronic
1176338780 21:5623468-5623490 TGCCCTGTGGTTTCCTGAGTTGG + Intergenic
1176340188 21:5686541-5686563 TGCCCTGTGGTTTCCTGAGTTGG + Intergenic
1176472442 21:7118694-7118716 TGCCCTGTGGTTTCCTGAGTTGG + Intergenic
1176496003 21:7500472-7500494 TGCCCTGTGGTTTCCTGAGTTGG + Intergenic
1176504639 21:7637915-7637937 TGCCCTGTGGTTTCCTGAGTTGG - Intergenic
1178474217 21:32922257-32922279 TCCCCTGTTGTTGCTTTAGTGGG - Intergenic
1179123513 21:38570690-38570712 TGCTCTGATGTTTACTAACTTGG - Intronic
1182300909 22:29336398-29336420 TGCCCTGATGACTCTTGACTAGG + Intronic
1203239454 22_KI270733v1_random:999-1021 TGCCCTGTGGTTTCCTGAGTTGG + Intergenic
950633079 3:14297268-14297290 TTCCATTATTTTTCTTAAGTGGG + Intergenic
950672638 3:14536440-14536462 TGCCCTGATGCTTCTCATTTGGG - Intronic
951168592 3:19511522-19511544 TGCCCTGTTGTGTCTTTAGCTGG + Intronic
951481798 3:23169254-23169276 GGCCCTGTCTTTTCTTAAGTAGG + Intergenic
952467600 3:33606523-33606545 CTCCCTGAAGTTTCATAAGTTGG - Intronic
952599031 3:35056343-35056365 TGCCCAGTTGTTTCTTTATTGGG - Intergenic
952844586 3:37676675-37676697 TGCAATAATGTATCTTAAGTTGG + Intronic
953406264 3:42661327-42661349 AGCTCTGATGTTTCTAAGGTTGG - Intronic
954177715 3:48857727-48857749 TGCCATGAAGTTCCTTAATTGGG - Exonic
955806566 3:62741886-62741908 AGCCCAGAAGTTTCTTAAGCTGG + Intronic
960247620 3:115416896-115416918 TTCACTGATGGTTTTTAAGTAGG + Intergenic
967469382 3:189844111-189844133 TGACCTGATGTTTATTAGGATGG + Intronic
967711799 3:192716981-192717003 TGCTCTTATGTGCCTTAAGTTGG - Intronic
970698850 4:18710609-18710631 TGAGCTGATGTTTCTGAAGGAGG + Intergenic
970774590 4:19657795-19657817 TTCCATGATGTTTCAGAAGTAGG + Intergenic
973910829 4:55578568-55578590 TTCCCTGATGTGTCATCAGTGGG + Intronic
979443861 4:120787238-120787260 TTCCGTGATGTTTCTTGACTAGG - Intronic
989166403 5:38437240-38437262 TTCACTTTTGTTTCTTAAGTGGG + Intronic
989522689 5:42420432-42420454 CTCCCTGCTGTTTCTTAAGCAGG - Intergenic
989619884 5:43373660-43373682 TGCCCTGTTGATTCTTTACTTGG - Intergenic
990679199 5:58222146-58222168 TGCCCTGGTGTTTCTTACACTGG - Intergenic
991498852 5:67255788-67255810 TGCCCTTCTGTCTCTTAAGCAGG + Intergenic
996662184 5:126017529-126017551 TGGCCTAATGGTTCTTCAGTAGG - Intergenic
997937782 5:138129657-138129679 GGCCATAATTTTTCTTAAGTAGG - Intronic
1000297233 5:159922565-159922587 TGCCCTGATATGTCATAGGTTGG - Intronic
1001549174 5:172589877-172589899 TGCCTTGATGTTTGCTAATTCGG + Intergenic
1003844267 6:10156434-10156456 TGCACTGATGCTTCTTGAGGAGG - Intronic
1005903499 6:30240259-30240281 TGGCCTGATGTTTCTTTAGCAGG - Intergenic
1008507768 6:52247322-52247344 TGCCATGAAGTTTCTTAATTGGG + Intergenic
1008599675 6:53078956-53078978 TGCCCTGTTGACTCTTAAGATGG + Intronic
1010540918 6:77091147-77091169 TGCACTGATGATTGTTCAGTTGG - Intergenic
1011437388 6:87352835-87352857 TGCTCTGAGGTTTCATAACTAGG - Intronic
1011903226 6:92327002-92327024 TTCCCCGATATTTCTTATGTGGG + Intergenic
1013658282 6:112268282-112268304 TGCTCAGCTGTTACTTAAGTTGG - Intergenic
1017429459 6:154356426-154356448 TGCTTTTATGTTTCTTAAATGGG - Intronic
1017643429 6:156516473-156516495 TCCACTGCTGTTTCTTAAATAGG + Intergenic
1020395532 7:7712928-7712950 TGGCCTCGTGTTTCTTTAGTGGG + Intronic
1021368392 7:19810308-19810330 TGCCTTGAAGTTTATTAACTGGG + Intergenic
1022109084 7:27216989-27217011 TACACTGGTGGTTCTTAAGTGGG - Intergenic
1023249222 7:38239510-38239532 TGCCATGTTGTTTCTTACCTTGG + Intergenic
1023250868 7:38259574-38259596 TGCCATGCTGTTTCTTACCTTGG + Intergenic
1024291353 7:47806897-47806919 TGCCCTGAAGTTTCATAAGCTGG - Intronic
1026107394 7:67432074-67432096 TTTCCTGGTGTTTCTTATGTGGG + Intergenic
1027694905 7:81398297-81398319 TGCCCGGATTTTTCTTATTTAGG + Intergenic
1028202413 7:87976931-87976953 TCCCCCGATCTTTCTAAAGTTGG - Intronic
1028954233 7:96671494-96671516 TACCCTGAAGTTTCTTTTGTGGG - Intronic
1030842189 7:114369099-114369121 TGCCTTGATTTCTCTCAAGTTGG + Intronic
1030998317 7:116385357-116385379 TGCACTGATGTTGGTGAAGTAGG - Intronic
1032606461 7:133360005-133360027 TACCCTAATGTTTATCAAGTTGG - Intronic
1033283322 7:140021329-140021351 TGGCCTGAAGTTTCTAAAGGTGG - Intergenic
1038869327 8:31477091-31477113 TGCCCTGATTATTTTTATGTTGG - Intergenic
1038941239 8:32308190-32308212 TGTATTGATGTTTATTAAGTTGG - Intronic
1041344223 8:56879168-56879190 TGACATGATTTTTCTTAAGATGG - Intergenic
1042890790 8:73608300-73608322 TCACCTAATGTTTTTTAAGTTGG - Intronic
1048223712 8:132565709-132565731 TGCCTTCATCTTTCTTCAGTGGG + Intergenic
1048417120 8:134239810-134239832 TGAGAAGATGTTTCTTAAGTGGG + Intergenic
1049342645 8:142121405-142121427 TGCCCTGCTGGTCCTCAAGTGGG - Intergenic
1051408129 9:16760942-16760964 GGCCCTGAAAATTCTTAAGTGGG - Intronic
1052047663 9:23813298-23813320 TGCCCTGCTGCTTCTGGAGTGGG + Intronic
1056822893 9:89856080-89856102 TGCCCTGGTGATTCTTAACAAGG - Intergenic
1061651012 9:132050048-132050070 CGCCCTGATATTTGTTGAGTTGG - Intronic
1203422879 Un_GL000195v1:11452-11474 TGCCCTGTGGTTTCCTGAGTTGG - Intergenic
1185524015 X:762977-762999 TGCCCTGATTTTTCTATACTTGG - Intergenic
1187091057 X:16097173-16097195 TCCACTGATGTTTCTTAAAATGG - Intergenic
1187281781 X:17862889-17862911 TGCCCAGCTGTGTCTTTAGTTGG - Intergenic
1189001424 X:36951421-36951443 TCACCTGAAGTTTCTAAAGTTGG + Intergenic
1189284658 X:39843039-39843061 GGCCCTGCTGTTTTCTAAGTTGG + Intergenic
1190737537 X:53265620-53265642 TTCCATGATGTGTCTGAAGTGGG - Intronic
1197118474 X:122862092-122862114 TGCACTCTTGTTTCTTTAGTGGG + Intergenic