ID: 1173877111

View in Genome Browser
Species Human (GRCh38)
Location 20:46380297-46380319
Sequence TTATTTTCCTCCACAGGATA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173877111_1173877116 -3 Left 1173877111 20:46380297-46380319 CCATATCCTGTGGAGGAAAATAA 0: 1
1: 1
2: 3
3: 19
4: 252
Right 1173877116 20:46380317-46380339 TAAGCAAATATAAGGCAGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 248
1173877111_1173877115 -6 Left 1173877111 20:46380297-46380319 CCATATCCTGTGGAGGAAAATAA 0: 1
1: 1
2: 3
3: 19
4: 252
Right 1173877115 20:46380314-46380336 AAATAAGCAAATATAAGGCAGGG 0: 1
1: 0
2: 3
3: 88
4: 914
1173877111_1173877118 28 Left 1173877111 20:46380297-46380319 CCATATCCTGTGGAGGAAAATAA 0: 1
1: 1
2: 3
3: 19
4: 252
Right 1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1173877111_1173877117 1 Left 1173877111 20:46380297-46380319 CCATATCCTGTGGAGGAAAATAA 0: 1
1: 1
2: 3
3: 19
4: 252
Right 1173877117 20:46380321-46380343 CAAATATAAGGCAGGGTGGCAGG 0: 1
1: 0
2: 4
3: 53
4: 376
1173877111_1173877114 -7 Left 1173877111 20:46380297-46380319 CCATATCCTGTGGAGGAAAATAA 0: 1
1: 1
2: 3
3: 19
4: 252
Right 1173877114 20:46380313-46380335 AAAATAAGCAAATATAAGGCAGG 0: 1
1: 0
2: 5
3: 117
4: 1366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173877111 Original CRISPR TTATTTTCCTCCACAGGATA TGG (reversed) Exonic
901248351 1:7751704-7751726 TTTTTTTCCTAAACAGGAAATGG - Intronic
902969817 1:20039191-20039213 TGATTTTGCTCCAGAGGAGAGGG + Intronic
907415614 1:54311993-54312015 TGATTTGCCTCCACAGAAAAGGG + Intronic
908669360 1:66529632-66529654 TAATTTTTCTCCACATGATCAGG - Intergenic
908802451 1:67894120-67894142 TTATTTACCTTCAAAGGATGTGG - Intergenic
909242235 1:73229032-73229054 TTATTTTCTTCCAAAGGAGATGG + Intergenic
909256082 1:73424169-73424191 TTATCATCCTGCCCAGGATATGG - Intergenic
910038198 1:82814196-82814218 TTCATTTCCTCCAGAGGATGCGG - Intergenic
910115933 1:83731779-83731801 GCATTTTATTCCACAGGATAAGG - Intergenic
912317547 1:108679988-108680010 TTCTTTTCCTAAACAGGAAATGG - Intergenic
912663802 1:111561053-111561075 TTATTTTCTTCTTCAGGGTATGG - Intronic
913406318 1:118496421-118496443 TTATTTTCTTTCATAGCATATGG - Intergenic
916740164 1:167640554-167640576 TTTTTTTCCTCCTCAAGACAGGG + Intronic
917084136 1:171288805-171288827 TCATTTCCCTACAGAGGATAAGG - Intergenic
917411545 1:174764536-174764558 TTATTTTGCTCCTGTGGATAAGG + Intronic
918705535 1:187657151-187657173 TTATTTTCTTCTTCAAGATAGGG + Intergenic
918787847 1:188787962-188787984 TTATTTTCTTCCACTGGCTTTGG + Intergenic
920555095 1:206898836-206898858 TTTTTCTCCTCCCCAGGAGACGG - Intronic
923911390 1:238448058-238448080 TTAGTTTCCTTCACAGCATTGGG + Intergenic
924009919 1:239653648-239653670 TTATTTTCTGCTACTGGATAAGG - Intronic
924067465 1:240239583-240239605 ATGTCTTCCTCCATAGGATAGGG + Intronic
924737598 1:246772323-246772345 GTACTTGCCTCCACAGGTTAGGG - Intergenic
1063571722 10:7221229-7221251 TCATTTTCCTTTACAGGAAATGG + Intronic
1064092476 10:12396491-12396513 TACTTTTCCCCCACAGCATATGG - Intronic
1064884880 10:20100445-20100467 TTTTTTTCCTCCAAGGGAAAGGG + Intronic
1066322639 10:34319450-34319472 TTGTCTTCCTCCAAAGGACATGG + Intronic
1069080582 10:64084286-64084308 TTTTTTTCCTACACAGCATTTGG + Intergenic
1069083760 10:64115899-64115921 TAATTTTTCTCAACAGGTTAAGG + Intergenic
1069161201 10:65094339-65094361 TTGTTTTCCTACACAGAATATGG - Intergenic
1070114700 10:73517145-73517167 TTAGTTTTCTGCACAGGATCAGG + Exonic
1070347073 10:75554973-75554995 TTGTTCTCCTCCATAGGAGATGG + Intronic
1071782899 10:88866441-88866463 GTATTTTCCTCCAGAGCAAAGGG - Intergenic
1072154093 10:92708031-92708053 TTATTTTGCTCCACAATATCAGG + Intergenic
1072367072 10:94722698-94722720 TTGTTTTTCTCCACAGAAAAGGG + Intronic
1075555466 10:123427884-123427906 TTTTTTTCCTCCCAAGGAAATGG - Intergenic
1075978229 10:126715362-126715384 TTTGTTTCCTGCCCAGGATATGG - Intergenic
1077633177 11:3824720-3824742 TTCTTTTCCCCCACAGTATTTGG + Intronic
1078087068 11:8240236-8240258 TTGTACTCCTCCACAGGAAATGG - Intronic
1080923759 11:36734477-36734499 TTATTTTCTTCCACTGGGTTTGG - Intergenic
1083424617 11:62576743-62576765 TTATTTACTTTCACAGGAGAGGG - Exonic
1085665109 11:78407979-78408001 TTATTTTCCTTCACCTGAGAAGG - Intronic
1087765044 11:102141759-102141781 TTATTCTCCTCCACTAGATGTGG + Intronic
1088785652 11:113179322-113179344 TTATTTTGCTCCATAGCAAAAGG - Intronic
1090076735 11:123584479-123584501 TTATTTTCTTCAGCAGGACAGGG + Intronic
1093964012 12:25306174-25306196 TTATTTTCTTCTACTGGATTTGG - Intergenic
1094317889 12:29152010-29152032 TTATTTTCCACCAAACTATAAGG - Intronic
1094505881 12:31060764-31060786 TTCTTTTCCTCCTCAGGTAATGG - Intergenic
1096314249 12:50550104-50550126 TCATTTTCCTTCACTGGACAAGG - Intronic
1097522034 12:60681372-60681394 TTCTTTTCCACCACATGATCAGG + Intergenic
1097882335 12:64697730-64697752 TTATTTTTCCTCAGAGGATAAGG - Intergenic
1099186148 12:79517360-79517382 TTATTTTCATCCACTGTATTGGG - Intergenic
1100650299 12:96580259-96580281 TCATTTTGCTTCACAGGAAATGG - Intronic
1100787424 12:98093476-98093498 TATTTTTCCTACACAGGATAAGG + Intergenic
1102244797 12:111348380-111348402 TTACTCTCCTCAACAGGATGGGG + Exonic
1102573048 12:113839227-113839249 TTATTTTTCTCCATGGGAAAAGG + Intronic
1103218179 12:119219824-119219846 CTATTTCCCTCCTCAGGACATGG - Intronic
1105236283 13:18556255-18556277 TCTTTCTCCTCCACAGGATCTGG + Intergenic
1105568468 13:21575870-21575892 TTATTTTCCTCCACAGGAGAAGG + Intronic
1107635861 13:42392201-42392223 TTATTTTCCTCCCCAGTTAATGG + Intergenic
1108704135 13:52969739-52969761 TTATTTTCCACCTCAGGTAAGGG + Intergenic
1109642104 13:65203905-65203927 TAGTTTTACTCCACAGGCTAAGG + Intergenic
1111067605 13:83116984-83117006 TCATTTACCTCCACAGAAGAAGG - Intergenic
1111200605 13:84930699-84930721 TTATTTTCCTTCTAATGATAGGG + Intergenic
1112542168 13:100325526-100325548 TTTTTTTCCCCCTCAGAATAAGG - Intronic
1112659124 13:101487312-101487334 TTATTTTAGGTCACAGGATAAGG - Intronic
1112844370 13:103620328-103620350 TTATTTACATCCTCAGGCTAAGG - Intergenic
1112996109 13:105576829-105576851 TTATTTTCCTGCACAGAGAAAGG - Intergenic
1113278030 13:108756066-108756088 TTATTTTTCTGCTCAGTATAAGG + Intronic
1114563784 14:23613017-23613039 TTATTTTCCTACTCTAGATAAGG - Intergenic
1115057182 14:29143199-29143221 TTTTTTTCCTTAATAGGATAAGG + Intergenic
1115105975 14:29762703-29762725 TTATTTTCCACCACAGGCATAGG - Intronic
1116338517 14:43691360-43691382 ATATTTTGATCTACAGGATAGGG + Intergenic
1117373501 14:55100175-55100197 TTATTTTATTCAACGGGATAAGG - Intergenic
1117538723 14:56726067-56726089 GTACTTACCTCCAAAGGATATGG + Intronic
1118935057 14:70280191-70280213 TTCTTTTCCTCCACAGGATTTGG - Intergenic
1119578673 14:75754133-75754155 TTTATTTCCCACACAGGATAGGG + Intronic
1120697708 14:87662669-87662691 TTTTTTTCCTCCTCAGGACCTGG + Intergenic
1121069823 14:91008079-91008101 TCATTTTCCTCCATAGGAGTGGG - Intronic
1121700836 14:95952995-95953017 TTATTTTCCTGCACACGAAGTGG - Intergenic
1122021100 14:98838761-98838783 TGATTTTCTTCCACAAGCTAGGG + Intergenic
1122364206 14:101184879-101184901 TTATTTTCCTTCACGGCATCTGG + Intergenic
1123180707 14:106467518-106467540 TTTTTTTCCACCACAGGACAAGG - Intergenic
1202946192 14_KI270726v1_random:29140-29162 TTTTTTTCCACCACAGGACAAGG + Intergenic
1124926703 15:34077005-34077027 GTATTGTCCTCCAGAAGATAAGG + Intergenic
1126437962 15:48655245-48655267 TTATTTTCCTAAAGAGGAAAGGG - Intergenic
1126949251 15:53862181-53862203 TCATTTTCCTGCACAGAATGAGG + Intergenic
1126981225 15:54245886-54245908 ATTATTTCCTCCACAGGATGAGG + Intronic
1127079236 15:55360047-55360069 CTATTTACATCCACAGTATAAGG - Exonic
1127263372 15:57342240-57342262 TTTTTTTCCTAAACAGGAAAAGG - Intergenic
1129020844 15:72516216-72516238 GTATTTTCTACCACTGGATAGGG - Intronic
1133519677 16:6544932-6544954 TTATTTTCTTACAGAGGATTAGG + Intronic
1135063255 16:19288550-19288572 TTTTTTTCCTCCAAAACATAGGG - Intronic
1136239607 16:28936154-28936176 TTCTTTTCCTCCTCAGGACCAGG - Exonic
1140542641 16:75772112-75772134 TTATTTTACTCATCAGGAAAAGG - Intergenic
1140606096 16:76540407-76540429 TTATTTTTCTCCACTGGATAAGG - Intronic
1140779389 16:78280690-78280712 TTTTTTTCCTAAACAGGAAAAGG - Intronic
1144095923 17:11900659-11900681 TTATTTTCTTCCCCAGTATCTGG + Intronic
1144965373 17:19073996-19074018 TTATTTTCCTCTACAGTAAGAGG - Intergenic
1144982594 17:19178187-19178209 TTATTTTCCTCTACAGTAAGAGG + Intergenic
1144985629 17:19200052-19200074 TTATTTTCCTCTACAGTAAGAGG - Intergenic
1145104050 17:20100194-20100216 TCATTTTCCTGCACAGAATCAGG - Intronic
1145889066 17:28402315-28402337 GTTTGTTTCTCCACAGGATATGG - Exonic
1148688743 17:49514743-49514765 TTATTTTCCTCCCCAGCAGGTGG + Exonic
1151099841 17:71544303-71544325 TTTTTTTCCTGTAGAGGATAGGG + Intergenic
1152583496 17:81179231-81179253 TTCTCTTCATCCACAGGACAAGG + Intergenic
1158924718 18:62243295-62243317 TTATTTTCTTCTACAGAATCAGG + Intronic
1159086515 18:63798350-63798372 TTAGCTTCCTCAACAGGAAATGG + Intronic
1159856368 18:73594436-73594458 ATGTTTCCCTCCAAAGGATAAGG + Intergenic
1160022637 18:75192380-75192402 ATATTTGCCTCCACAGGACTGGG + Intergenic
1164410398 19:27999771-27999793 TTATTTTCCTTCACATGGGATGG - Intergenic
1168419036 19:56188936-56188958 TTATTTTTCTCTTTAGGATAGGG + Intergenic
926735916 2:16073205-16073227 TCATTTTCCTGCACAGGCCAGGG + Intergenic
927187333 2:20491234-20491256 TCAGTGTTCTCCACAGGATAGGG - Intergenic
929173787 2:38957701-38957723 TTGTTCTCCTCCACAGGAGTTGG - Intronic
929559816 2:42949264-42949286 TTACTTTCCTCCTCGTGATAAGG - Intergenic
930145758 2:48002655-48002677 TTAAATTCCTCCACAGAATAGGG + Intergenic
930381759 2:50638728-50638750 TCATTTTCCTTGACAGTATATGG + Intronic
930434673 2:51325572-51325594 TACTTTTCCTCCACATCATAAGG - Intergenic
931906139 2:66845951-66845973 TGATTTTCCTCAACAGGAAAGGG + Intergenic
932962245 2:76427007-76427029 GTATCTTCCTCAACATGATAAGG - Intergenic
933001834 2:76934953-76934975 TTTTTTTCCTCCAAAGAATATGG - Intronic
933499869 2:83097623-83097645 TAATTTTCCTACCCAAGATACGG + Intergenic
933500593 2:83106110-83106132 TTATTTCCCTTTATAGGATAAGG - Intergenic
935704386 2:105842983-105843005 TTATTTTCTTCAACAGCATGTGG + Intronic
936850081 2:116885628-116885650 TAATTTTCATACACAGTATAAGG - Intergenic
938160868 2:128983419-128983441 TTCTTCCCCTCCACAGTATAGGG - Intergenic
941399308 2:165011048-165011070 TTTTTTTCTGCCACAGGAAATGG + Intergenic
941926619 2:170901820-170901842 GTGTCTTCATCCACAGGATAAGG - Intergenic
943224312 2:185149376-185149398 TTATTTTCTTCCCCAGGAATAGG - Intergenic
943318541 2:186417557-186417579 GTACCTTCCTCCACAGGTTATGG - Intergenic
944337230 2:198549749-198549771 TTTTTTTCCTAAACAGGACATGG + Intronic
945196371 2:207240913-207240935 ACCTTTTCCTCCACAGGAAAAGG - Intergenic
945426556 2:209711879-209711901 TTATTCTCCTCAACTAGATATGG + Intronic
945941910 2:215958949-215958971 TTGCTTTCCTCCCCAGAATAGGG - Intronic
948233885 2:236372551-236372573 TTTTTTTCCTAAACAGGAAAAGG + Intronic
948416953 2:237814835-237814857 TTATTTTCCTCTTTAGCATAAGG - Intronic
948997190 2:241587568-241587590 TTATTTTACGCCCCAGTATATGG - Intronic
1170068004 20:12335471-12335493 TTATTTTTCTGCAAAGGAAATGG - Intergenic
1170596347 20:17808821-17808843 TCAATTTCCTCCCCAAGATAAGG + Intergenic
1170807184 20:19642507-19642529 TCATTTTCCTCCACATTTTAGGG - Intronic
1173877111 20:46380297-46380319 TTATTTTCCTCCACAGGATATGG - Exonic
1174024249 20:47559547-47559569 TTTTTTTCTTCCCCAGAATAGGG + Intronic
1174077756 20:47950313-47950335 TTTGTTTCCTCCATAGGAGATGG + Intergenic
1176780276 21:13184540-13184562 TCTTTCTCCTCCACAGGATCTGG + Intergenic
1177977945 21:27873562-27873584 TCTTTCTCCTCCACAGGATCTGG + Intergenic
1179004144 21:37495045-37495067 TTATTTTCTACCACTGAATATGG + Intronic
1184366998 22:44058030-44058052 TTCCTTTCCTCCACTGGACAGGG - Intronic
1184609260 22:45592140-45592162 TCATTTTTCTCCCCAGGAGAAGG + Intronic
949769224 3:7560328-7560350 TCATTTTCCTCCACAGGGGCCGG - Intronic
952202239 3:31142580-31142602 TGAATTTCCTCCACAAGAGATGG - Intergenic
952691549 3:36212017-36212039 TGTTTTTCCTCCATAGGATTAGG - Intergenic
953823692 3:46232038-46232060 ACATTTTTCTCCCCAGGATATGG - Intronic
955012106 3:55027839-55027861 TTACTTTCCTCCACAAGCAATGG + Intronic
955543821 3:60005835-60005857 TCATTTTCATCCTCAAGATAAGG + Intronic
956346718 3:68287484-68287506 TTCTTTGCCTTCACAGGACAGGG + Intronic
956379655 3:68652409-68652431 TTATTTTTCTAAACAGGAAAAGG + Intergenic
957124733 3:76144002-76144024 TGATTGTCCTCCACAGTGTAGGG - Intronic
957397891 3:79667057-79667079 TTATTTTACTCCTCTGGATTCGG + Intronic
958157164 3:89770392-89770414 TTATTTTCCTTCCCAGGCTTGGG - Intergenic
959019583 3:101173868-101173890 TTATCTTCCGCCACAAGATAAGG + Intergenic
959158119 3:102691806-102691828 TTATTTTCCTCCAAATGACTTGG - Intergenic
959345457 3:105189085-105189107 TTCTTTTCCTCCAGAGGCAAAGG + Intergenic
959682319 3:109109593-109109615 TTATTTTACTCTATTGGATATGG + Intronic
962140766 3:132788430-132788452 ATATTTTCCTCCCTGGGATAAGG + Intergenic
964299645 3:155274078-155274100 TTATTTTCTTCCACTGGGTTTGG - Intergenic
965344651 3:167533738-167533760 CTTTGTTCCTCCACAGGACATGG - Intronic
965564149 3:170093475-170093497 TCAGTTTCATCCACTGGATATGG + Exonic
966937977 3:184726442-184726464 GACTTTTCCTCCACAGGATCTGG - Intergenic
967247977 3:187507596-187507618 TTATTTTCCTCCACCAGTTTAGG - Intergenic
967857171 3:194127037-194127059 TGATTTTCCTCCACAAGAAAAGG + Intergenic
967943641 3:194785495-194785517 CAATTTTCCTCCAAAGGAAAGGG - Intergenic
971165760 4:24181907-24181929 ATACGTTCCTTCACAGGATAAGG - Intergenic
971276818 4:25206109-25206131 TAATTTTCCTTCCCAGGTTAAGG - Intronic
971734044 4:30423265-30423287 TAATTTTCCTGCATAGTATAGGG + Intergenic
973048319 4:45565044-45565066 TTTTTTTCATCCACAGCATAAGG - Intergenic
973973580 4:56240191-56240213 TTATTTCCCACCTCAGGAAATGG + Intronic
974310429 4:60201174-60201196 TTATTTTTCTACACAAGATGTGG - Intergenic
974380776 4:61137245-61137267 TTATTTCCCCCTTCAGGATATGG + Intergenic
976991489 4:91372379-91372401 TAATTTTGTTTCACAGGATATGG - Intronic
977201639 4:94122992-94123014 GAATTTTCCTCCACTGTATACGG - Intergenic
977291179 4:95166295-95166317 TTACTTTACTCCAAAGGAGAAGG + Exonic
977340841 4:95755457-95755479 TTATTTTCCACCATAGCTTAGGG + Intergenic
978052646 4:104221461-104221483 TTATTTTCCTCCAAAAGAATAGG + Intergenic
978221674 4:106283743-106283765 TTTTTTTCCCCCAGAGGAAAAGG - Intronic
978987644 4:115034067-115034089 TCACTTTGCTCCAGAGGATAAGG + Intronic
979696973 4:123623309-123623331 TTCTGTTCCTCCAGAGGATATGG + Intergenic
981009855 4:139914482-139914504 TTTTTTTCCTCCCCACAATATGG - Intronic
981230549 4:142349242-142349264 TTATTTCCCCCCAGAGAATAAGG + Intronic
982857100 4:160397365-160397387 TTTTTTTCCTAAACAGGAAAAGG + Intergenic
983482113 4:168287797-168287819 TTATTTTTTTCCAAAAGATAAGG - Intronic
983696022 4:170532066-170532088 TTATCTTCATCCTCAAGATAGGG - Intergenic
984291666 4:177803191-177803213 TTATTTGCATCTACAGTATATGG + Intronic
984878130 4:184387442-184387464 TTCATTTCCTCCACATGAAATGG + Intergenic
986463926 5:8001866-8001888 TTCTTTTTCTCCCCAGGACAGGG - Intergenic
988507310 5:31834640-31834662 TTTTTTTCCTCCACAAGCTGAGG - Intronic
988660220 5:33258263-33258285 TTATTTTCATTCACAGGCTGTGG - Intergenic
988990770 5:36668597-36668619 TTATTCTCTTTCAAAGGATAAGG + Intronic
989243184 5:39223279-39223301 ATATTTTCCTCTAAATGATAGGG - Intronic
990043635 5:51401513-51401535 TTACTTTCCTCCATAACATATGG + Intergenic
990194513 5:53299134-53299156 TTTTTTTCCTCCAAATGATTTGG - Intergenic
990273023 5:54166195-54166217 TTTTTTTCCCCCACAAGAGATGG + Intronic
990379744 5:55211126-55211148 TTATTATCACCCACAGAATATGG + Intergenic
992731950 5:79680459-79680481 TTCTTTTCCTTAACAGAATAAGG - Intronic
994214678 5:97124330-97124352 TTGTTTTCATTCATAGGATATGG + Intronic
994465711 5:100127308-100127330 TTATTTATCTCCGCAGTATATGG + Intergenic
998705324 5:144752734-144752756 ATATTTTCTTCCACAGGCAAAGG - Intergenic
998811082 5:145966612-145966634 TTGTTTTCCCCCACAGCATTTGG - Intronic
999214969 5:149925090-149925112 TTATCTTCCTCCAAAGGGGATGG - Intronic
1000476681 5:161716839-161716861 TTGTTTGCCTCCATAGGAAAGGG + Intergenic
1003062124 6:2872057-2872079 ATATTTTCTTCCACAGGTTATGG - Intergenic
1004273845 6:14218375-14218397 TGATTTTCCACCAAAGAATAGGG + Intergenic
1004795032 6:19072712-19072734 TTATGTTCCTGCAGAGGATGAGG - Intergenic
1007465973 6:42051318-42051340 AGATTTTCATCCACAGGAGAAGG - Intronic
1008464332 6:51813936-51813958 TTTTTTCCCTCCAAAGGAAATGG - Intronic
1009274955 6:61663667-61663689 TTGTTTTCCACCACACGGTATGG + Intergenic
1010244648 6:73651876-73651898 TTATTTACCTCTAAAAGATAAGG - Intronic
1011999996 6:93642250-93642272 TTTTTTTCCTCTTCAGAATATGG + Intergenic
1012635314 6:101531293-101531315 TTGTTTTCCTCCAAAAGAAAAGG + Intronic
1013139476 6:107317656-107317678 TTATTTTTATCCATAGAATAAGG - Intronic
1013946186 6:115725596-115725618 TTATTTTCATCCACTGGGTTTGG + Intergenic
1014247536 6:119083384-119083406 TTCTTTTCTACCACAGGATCAGG + Intronic
1014292569 6:119575939-119575961 TTATTTTCCTCCACAGAGAGAGG - Intergenic
1014540440 6:122669436-122669458 TTATTATCCTACATAGGAAAGGG - Intronic
1015014939 6:128401054-128401076 TAATTTTCCTCCAAAGGTCAAGG - Intronic
1015149298 6:130020084-130020106 CTCTTTTCCTCCCCAGAATAAGG - Intronic
1015716873 6:136202034-136202056 TTATTTTCCCTCACAGGATACGG - Intergenic
1016406932 6:143740932-143740954 TTATTTTCCTCCTCAGATAAGGG - Intronic
1016430426 6:143978713-143978735 TTATTTTCCCACCCAGAATATGG + Intronic
1017412177 6:154179505-154179527 TTATTTTGCTTCAGAAGATAAGG - Intronic
1018671647 6:166182697-166182719 CTATGTTCCTACAAAGGATATGG + Intergenic
1019983527 7:4639066-4639088 TTATATTCCTGCAGAGGATGTGG - Intergenic
1021245287 7:18253966-18253988 TTCTTTTCCTCCCCAGCAAAGGG - Intronic
1021626722 7:22600944-22600966 TCATTTTTCTCCACAGAATTTGG + Intronic
1022399226 7:30020966-30020988 CTATTTTCCTTCTCAGGAAATGG + Intronic
1023152701 7:37216689-37216711 TGTTTTTCTTCCACAGGAGATGG - Exonic
1027742715 7:82032118-82032140 TGATATTCCTCCACAGTATCAGG + Intronic
1028672090 7:93412949-93412971 TTATGTTCCTCCAAAGTATAGGG + Intergenic
1029869386 7:103674289-103674311 TTAATATCCTCAACAGGATAAGG - Intronic
1030137291 7:106267284-106267306 TTATTTTCATCCTGAGAATAGGG + Intronic
1030603606 7:111616170-111616192 TTTTTTTCCCCCATAGGAGATGG - Intergenic
1030968454 7:116023667-116023689 TTATTTCCATCTAGAGGATATGG - Intronic
1030999814 7:116401641-116401663 TTTATTTCCTTCACAGCATATGG - Intronic
1031604559 7:123752671-123752693 TTATATTCCCCCACAGTAAAGGG - Intergenic
1034113199 7:148558143-148558165 GTATTCTCCTCCACAGGATCTGG + Intergenic
1034837803 7:154368890-154368912 TTTTTTTCCTAAACAGGAAAAGG + Intronic
1037506540 8:19535820-19535842 GGAATTTCCTCCACTGGATAAGG + Intronic
1038899907 8:31830753-31830775 TTTTTTTCCCCCACAGACTAAGG - Intronic
1039390119 8:37172789-37172811 ATATTTTCCTCCACAGCCTTAGG - Intergenic
1039854015 8:41397206-41397228 TTATTTTCCCCCACAGGTTCTGG - Intergenic
1041433439 8:57810173-57810195 ATCTTTTACTCCACAGGATATGG + Intergenic
1041640929 8:60200706-60200728 TTATTGTCATCCACAAAATAAGG - Intronic
1043213255 8:77551589-77551611 GGATTTTCCTCCACAGGCTGTGG + Intergenic
1044034444 8:87282890-87282912 TTATATTCCTGCTCAGGATTTGG - Intronic
1045825511 8:106392813-106392835 TGATATTTCTTCACAGGATAGGG + Intronic
1045961816 8:107977669-107977691 TTATTTTCCTCTACAGTGAATGG - Intronic
1046141768 8:110103284-110103306 TTATTTCTCTCCACTGAATACGG - Intergenic
1048690513 8:136957001-136957023 TTATTTTCCTCAGTAGTATAGGG - Intergenic
1048939533 8:139386293-139386315 TTATTTTCTTCCATCAGATAGGG - Intergenic
1049730050 8:144172153-144172175 CAATTTTCCTCCACAAAATATGG - Intronic
1050237720 9:3599183-3599205 TTATGTTCAACCACAGTATATGG - Intergenic
1051895464 9:21982648-21982670 TTATTTTGTTCCTCAGGATGAGG - Intronic
1054710586 9:68507108-68507130 TTATTTTTCTCCTCAGAATTTGG + Intronic
1055143553 9:72904791-72904813 TTCTCTACCTCCATAGGATATGG + Intronic
1058435142 9:104955641-104955663 TTCTTATCCTCATCAGGATAAGG + Intergenic
1060266927 9:122117157-122117179 TTATTTCCTTCCCCAGAATATGG - Intergenic
1061617061 9:131787278-131787300 TTCATTTCCTCCTCAGGAAATGG - Intergenic
1188207067 X:27373404-27373426 TTGTTTTCTGCCGCAGGATATGG - Intergenic
1190112269 X:47599256-47599278 TTTTTTTCCTAAACAGGAAAAGG - Intronic
1196070213 X:111512523-111512545 TTATTTTCTTTAACATGATAAGG - Intergenic
1197370936 X:125625379-125625401 ATTTTTTTCCCCACAGGATAAGG - Intergenic
1197947014 X:131850432-131850454 TTGTTTTCCTCCAGATGTTAGGG - Intergenic
1198011960 X:132565707-132565729 TCATGTTCCTTCACAGGCTAGGG - Intergenic
1198314069 X:135449490-135449512 TTATTTTCCTCAGCAGTAAAAGG - Intergenic
1199506231 X:148564428-148564450 CTATTTTCCTCCAAAGCATTTGG + Intronic
1200273738 X:154712398-154712420 TTCTTTTGCTCCACAGGGTAAGG + Exonic
1201273647 Y:12279345-12279367 TTGTTTTCTTCCACCCGATAAGG - Intergenic