ID: 1173877112

View in Genome Browser
Species Human (GRCh38)
Location 20:46380303-46380325
Sequence ATTTGCTTATTTTCCTCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173877112_1173877118 22 Left 1173877112 20:46380303-46380325 CCTGTGGAGGAAAATAAGCAAAT 0: 1
1: 0
2: 0
3: 37
4: 321
Right 1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1173877112_1173877117 -5 Left 1173877112 20:46380303-46380325 CCTGTGGAGGAAAATAAGCAAAT 0: 1
1: 0
2: 0
3: 37
4: 321
Right 1173877117 20:46380321-46380343 CAAATATAAGGCAGGGTGGCAGG 0: 1
1: 0
2: 4
3: 53
4: 376
1173877112_1173877120 26 Left 1173877112 20:46380303-46380325 CCTGTGGAGGAAAATAAGCAAAT 0: 1
1: 0
2: 0
3: 37
4: 321
Right 1173877120 20:46380352-46380374 TGTGACTACTATCGAGAGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 61
1173877112_1173877116 -9 Left 1173877112 20:46380303-46380325 CCTGTGGAGGAAAATAAGCAAAT 0: 1
1: 0
2: 0
3: 37
4: 321
Right 1173877116 20:46380317-46380339 TAAGCAAATATAAGGCAGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173877112 Original CRISPR ATTTGCTTATTTTCCTCCAC AGG (reversed) Exonic
900567772 1:3342296-3342318 AGTTGTTAATTTTCCTCCCCTGG - Intronic
902247215 1:15128882-15128904 TTTTGTTTTCTTTCCTCCACAGG + Intergenic
902263264 1:15243160-15243182 ATTTTCTCATTTTCTGCCACGGG + Intergenic
902491413 1:16784711-16784733 ATTTTCTTATTTTATTGCACTGG + Intronic
902820440 1:18939968-18939990 ACTGGCTTCTTTTCCTCCAAGGG - Intronic
902978082 1:20103721-20103743 ATTCTCTTATTTTACTGCACTGG - Intergenic
904333350 1:29780794-29780816 ATTTTCTTATTTTTATGCACTGG - Intergenic
905352861 1:37359554-37359576 ATTTGCTCATTTTCCATGACTGG - Intergenic
905934448 1:41812642-41812664 ATTTGCTAATTTCCCTTCCCAGG - Intronic
906661942 1:47589215-47589237 ATTTGCTTATTTTCATTTATTGG - Intergenic
907207771 1:52789416-52789438 ATTTTCTTATTTTGCTTCACAGG + Intronic
907937686 1:59057405-59057427 TTTTGCTTATTTACCTCCCCTGG - Intergenic
909450374 1:75791615-75791637 ATTTTCTTATTTTACTACACTGG - Intronic
910062293 1:83108303-83108325 ATTTGCTTATTTTCCCTCAAAGG + Intergenic
910434564 1:87192017-87192039 ATTTGCTTATTTTTTTCCCCAGG + Intergenic
912493277 1:110074536-110074558 AGTTGCTTTTTTTCCTTCAAAGG + Intronic
912988776 1:114461999-114462021 ATATGCTCATTTTCTTCCATAGG - Intronic
913174152 1:116258651-116258673 ATTTGTTTTATTTCCTCTACAGG + Intergenic
913444081 1:118931425-118931447 ATTGTATTATTTTCCTCCAAGGG - Intronic
915819016 1:159001595-159001617 ATTTCCTTCTTTTCTTTCACTGG - Intronic
918143529 1:181737333-181737355 ATCTGATTACCTTCCTCCACTGG + Intronic
918782846 1:188725043-188725065 ATTTCCTTAGCTTCCTCTACAGG + Intergenic
918787846 1:188787956-188787978 AGTTATTTATTTTCTTCCACTGG + Intergenic
919039340 1:192362689-192362711 ATTTGCCTATTTTCCTACCAAGG - Intronic
919617682 1:199827767-199827789 TTTCTCTTATTTTCATCCACAGG - Intergenic
920781810 1:208999996-209000018 ATTTTCTTATTTTATTGCACTGG - Intergenic
921384407 1:214553969-214553991 TATTGCTTAGCTTCCTCCACAGG - Intergenic
922380900 1:225024397-225024419 TTTTTCTTATTTTCCACAACTGG + Intronic
923529030 1:234797831-234797853 ATTTTCTTATTTTATTGCACTGG - Intergenic
1064420073 10:15183218-15183240 ATTTAGTTTTTTTCCTCCACTGG - Intergenic
1064923210 10:20540646-20540668 GTTTGTTTATTTTTCTCCATTGG + Intergenic
1065789267 10:29244768-29244790 ATTTAGTGATTTTCCTCCATGGG + Intergenic
1066710170 10:38224581-38224603 CATTGCTCATTTTCCTCCAGTGG - Intergenic
1066954011 10:42148939-42148961 ATTTGTTAATTTTCCTTAACAGG + Intergenic
1068850841 10:61738167-61738189 ATTTGCTGGTTTTCAGCCACTGG - Intronic
1068962792 10:62882409-62882431 GTTTACTTAGTTTCCTCCACTGG + Intronic
1069619881 10:69830460-69830482 GTTTGCTTTTTTCCCTCCAGAGG - Intronic
1070757492 10:79002460-79002482 CTTAGCTTTTTCTCCTCCACTGG + Intergenic
1074113776 10:110440682-110440704 AGATGCTTTTTTTCCTCCTCAGG - Intergenic
1075274341 10:121079832-121079854 GCTTGCCTATTTTCCTGCACTGG - Intergenic
1076432410 10:130414523-130414545 TTATCCTTATTTTCCTCCCCAGG + Intergenic
1079019254 11:16895669-16895691 ATTTGCTTTTTTCCCTGCAATGG - Intronic
1079449497 11:20587429-20587451 ATTTGGATTTTTTACTCCACGGG - Intergenic
1079906648 11:26256358-26256380 GCTTGCATATTTTCCTCCTCTGG + Intergenic
1080954397 11:37076222-37076244 ATTTGCTTAATTTCTTCCAAGGG + Intergenic
1082688753 11:56273897-56273919 ATATGCATATTTTTTTCCACTGG + Intergenic
1084292939 11:68187511-68187533 AATTTCTAATTTTCCTCCATTGG + Intronic
1085854229 11:80157986-80158008 AGCTGCTTTCTTTCCTCCACAGG + Intergenic
1086507911 11:87525102-87525124 ATTTGCTTATTTACATCAAAAGG + Intergenic
1086555453 11:88105299-88105321 ATTAGCATCTTTTCCTCCATCGG + Intergenic
1086777260 11:90853853-90853875 ATTTGTTTTTTTTCCCCCACTGG - Intergenic
1087532160 11:99397313-99397335 TTTTGCTGATTTTCATCAACTGG + Intronic
1089177676 11:116560264-116560286 ATTTGCTTGTTTCCATCCCCTGG - Intergenic
1090169832 11:124591353-124591375 AATTGCTTATCTTCCTCCATGGG + Intergenic
1091362623 11:134989660-134989682 ATTTGGTTCTTTTCATCAACGGG + Intergenic
1092786708 12:12033064-12033086 CTTTCCTTATTTTCCTCCCAGGG - Intergenic
1093157017 12:15698507-15698529 ACTTCCTTATTTTCCTCAAATGG + Intronic
1094004872 12:25738708-25738730 ATATGCCTTTTTTCCTCCATTGG - Intergenic
1094066461 12:26366071-26366093 ATATTCTTATTTTCCTACATCGG + Intronic
1094505883 12:31060770-31060792 ATCTCCTTCTTTTCCTCCTCAGG - Intergenic
1094655297 12:32413812-32413834 ATTTGCTTTTTTTTGTCAACAGG + Intronic
1094722789 12:33082363-33082385 ATTAGCTTATTTTCACTCACAGG - Intergenic
1094751178 12:33410312-33410334 ATTTGCTTATTTACTTTAACTGG + Intronic
1096262113 12:50099465-50099487 ATTTCCTTCCTTCCCTCCACAGG + Exonic
1096276929 12:50217521-50217543 ATTTTTTTATTTTTCTCCAGAGG + Intronic
1096593159 12:52675744-52675766 ATTTTCTTATTTTCTCCTACAGG - Exonic
1097364561 12:58697074-58697096 ATTTCCTTTTTTTCCTCCAAAGG - Intronic
1098419338 12:70276077-70276099 ATTTGCTTTGTTTCCTCTTCTGG - Intronic
1098489290 12:71056462-71056484 ATTTGCTTGCTTTCTTCGACGGG - Intronic
1098913896 12:76237800-76237822 ATTTGCTTTGTTTCCTCCAATGG + Intergenic
1099368478 12:81799287-81799309 AGTTGCTTATTTTCAATCACAGG + Intergenic
1099878555 12:88438052-88438074 GTATGCCTATTTTCCTCCAAAGG + Intergenic
1099919150 12:88935557-88935579 ATTTGTTCATTTGCCTCCATTGG + Intergenic
1101682014 12:106978155-106978177 ATTTGCTTATTCTTCTCAACAGG + Exonic
1102342212 12:112130883-112130905 ATTACTTTATTTTCCTTCACTGG + Intronic
1102596927 12:113999997-114000019 ATTTCCTTATTTTCCTCCTGGGG + Intergenic
1103068223 12:117917802-117917824 AGTTGCCTATTTTCATCCTCGGG - Intronic
1103218181 12:119219830-119219852 AGTTGCCTATTTCCCTCCTCAGG - Intronic
1103547057 12:121709752-121709774 ATGTGGTTGTTTCCCTCCACGGG + Intergenic
1103631509 12:122265474-122265496 CTTTGCTCAGTTTCCTCCAGGGG + Intronic
1104221068 12:126785585-126785607 ATCTGCCTATTTTCATCCACAGG - Intergenic
1105568467 13:21575864-21575886 TTTAGTTTATTTTCCTCCACAGG + Intronic
1108704133 13:52969733-52969755 ATTTCATTATTTTCCACCTCAGG + Intergenic
1109494652 13:63152794-63152816 ATTTGTTTATTTTTCTTCAAAGG - Intergenic
1111998132 13:95184853-95184875 TTTTGCTAGTTTTCCCCCACTGG - Intronic
1112222264 13:97502863-97502885 ATTTGCTTATTTTTTCCCACAGG + Intergenic
1114931974 14:27483152-27483174 ATTTTCTTATTTTCCTTGATAGG + Intergenic
1115248632 14:31322244-31322266 ATTTTCTTATATCTCTCCACAGG - Intronic
1115448835 14:33523109-33523131 ATTTGTTTAATTTCTTCTACTGG - Intronic
1115532043 14:34336589-34336611 ATTTGTCTAGATTCCTCCACTGG - Intronic
1116477946 14:45363625-45363647 ATTTTCTGCTTTTCTTCCACTGG - Intergenic
1116557494 14:46330621-46330643 ATTTGATCATTTTCCTGCAAAGG + Intergenic
1117204023 14:53422431-53422453 ATTTGCTAATTATCCTACAATGG - Intergenic
1118049490 14:62011374-62011396 TTTTTTTTATTTTTCTCCACTGG - Intronic
1119354551 14:73994920-73994942 TTCTGTTTATTTTTCTCCACAGG + Intronic
1119363604 14:74072364-74072386 ATGTGCTTATTTTTCTCATCAGG - Exonic
1119669434 14:76507355-76507377 ATTTTCCCATTTTCCTGCACAGG + Intergenic
1122234689 14:100325055-100325077 ATGTGCCTATTTTCTTCCATTGG + Intronic
1123102735 14:105816546-105816568 AATTGCTTTTTTTCCTCTTCTGG + Intergenic
1123959925 15:25386722-25386744 TTTTTCTTTTTTTCCTCTACAGG - Intronic
1125068417 15:35521208-35521230 TTTTGCTTAGTTTCCTCCTAAGG + Intronic
1125188505 15:36961732-36961754 ATTTGCTTCTATTCATCAACTGG + Intronic
1126210261 15:46093587-46093609 ATTTGATTATTTTCCCCAAAGGG - Intergenic
1126387047 15:48104266-48104288 GTTTGTTTATTGTCCTCCATTGG + Intergenic
1126436179 15:48640619-48640641 ATTTGTTTATTTTTTTCCAGAGG - Intronic
1126943716 15:53794019-53794041 ATTTGCTTATTTTCTCCTATGGG - Intergenic
1126980959 15:54242180-54242202 ATTTCCTTTTTTTCCTTCTCTGG + Intronic
1128609905 15:69065180-69065202 ATTTCCTTGTTTTCCTCCTCTGG - Intergenic
1131043243 15:89292666-89292688 ATTTACTTATTTTCTCCTACAGG + Exonic
1133549336 16:6838735-6838757 ATTTGCTTAGCATCCTCCAGGGG + Intronic
1134446584 16:14335898-14335920 GTTTGCTTATATTCCTGCATAGG + Intergenic
1135282844 16:21167537-21167559 AATAGTTTATTTTCCTTCACCGG - Intronic
1138082763 16:54107413-54107435 ATTGGCTTATTTTCATGCAAAGG + Intronic
1138170205 16:54841971-54841993 ATTTTAATATTTTCCCCCACAGG + Intergenic
1139188359 16:64833702-64833724 ACTTGCTTCTTTTGCTCAACAGG - Intergenic
1139201362 16:64980836-64980858 ATTTCTTTATATGCCTCCACAGG - Intronic
1139457099 16:67089379-67089401 ATTTGCTTATTTTGTCCCCCAGG - Intronic
1139575297 16:67837921-67837943 CTCTGCTTAAATTCCTCCACTGG - Intronic
1140025910 16:71289915-71289937 ATTTGCTCATTTTCCTTCTGGGG - Intergenic
1140761852 16:78116453-78116475 ATTTGCTTCTTTACCTTCATAGG - Intronic
1144476456 17:15593266-15593288 TTTTGATTTTTTTCCTCCCCTGG - Intronic
1144921801 17:18770134-18770156 TTTTGATTTTTTTCCTCCCCTGG + Intronic
1146013156 17:29211938-29211960 ATTTGTTAAATTTGCTCCACAGG + Intergenic
1146474270 17:33150395-33150417 ATTTGATTTTTTGCCTCCAAAGG + Intronic
1150448987 17:65249970-65249992 ATTTGCTTTTTTTTCCCCATAGG + Intergenic
1151079485 17:71312191-71312213 ATTTGGTTCTGTTCCTCCATGGG + Intergenic
1153765516 18:8371249-8371271 ATTTGTTTATTTTCTTTCCCTGG + Intronic
1155424472 18:25691809-25691831 ATCTACTTATTTTACTGCACTGG + Intergenic
1155769776 18:29681909-29681931 TTTGTCTTATTTTCCTTCACAGG + Intergenic
1156412529 18:36846057-36846079 ATTTGCTGAGTTTCCTCTACTGG + Intronic
1156764194 18:40631567-40631589 ATAAGCTGATTTTCATCCACTGG - Intergenic
1157133688 18:45033398-45033420 ATTTGCCTCTTGTCCTCCACAGG + Intronic
1158067345 18:53426482-53426504 ATATGTATATTTTCCCCCACTGG + Intronic
1158092819 18:53735242-53735264 ATTTGTTTGTTTTCCTCCTTTGG + Intergenic
1158422573 18:57308968-57308990 ACTTGCTTAATTTTTTCCACTGG - Intergenic
1159283477 18:66317741-66317763 ATTAGCTTCTTTTCCTTCTCTGG + Intergenic
1159492568 18:69156928-69156950 ATCTGCCTAATTTACTCCACTGG + Intergenic
1159601353 18:70431158-70431180 TTTTTCTTTTTTTCCCCCACAGG - Intergenic
1162493291 19:11007947-11007969 ATCTTCTTCTTCTCCTCCACGGG - Exonic
1162592766 19:11603770-11603792 GTTTCCTTATTCTCCTCCACAGG + Intronic
925108459 2:1312915-1312937 ATTTGCTTCTCTTCCTCATCAGG - Intronic
925959248 2:8999955-8999977 TTTTGCTTCTTTTCCTTCCCTGG + Intronic
926735914 2:16073199-16073221 CTTTTCTCATTTTCCTGCACAGG + Intergenic
930226076 2:48794847-48794869 ATTTGCTGATTTTCCTACATTGG + Intergenic
930877257 2:56232941-56232963 ATTTGCTTACCTTCCTCTAGAGG + Intronic
930950101 2:57130777-57130799 ATATGCCTATTTTTCTCTACAGG + Intergenic
931065764 2:58585132-58585154 AGTTACTTTTTTTCCTCCAGTGG + Intergenic
931322736 2:61187558-61187580 GTGTGCTTTATTTCCTCCACAGG + Exonic
931495464 2:62802079-62802101 GTTTTCTTGTTTGCCTCCACAGG - Intronic
931812873 2:65872071-65872093 ATTTTCTTCTTTTCTTTCACAGG - Intergenic
931952265 2:67378286-67378308 ATATGCTTTTATTCCTCCATGGG - Intergenic
936594314 2:113833113-113833135 ATTTGATTTTTTTTCTCCAAAGG - Intergenic
938175704 2:129126234-129126256 ATTTCCTTGTTTTCTTGCACAGG - Intergenic
938665517 2:133531498-133531520 ATGTGCTTATTTTTTTCTACTGG + Intronic
938715497 2:134017511-134017533 ATTTGCTGTTTTTTCTCCATAGG - Intergenic
938912072 2:135895211-135895233 ATATGCTTATTGTTCACCACAGG - Intergenic
939064821 2:137470427-137470449 GTTTGTTTGTTTTCATCCACGGG - Intronic
939926592 2:148182492-148182514 ATTTTCTTATTTTCCTCGTTTGG + Intronic
941388891 2:164887389-164887411 TTTTACTTATTTTCTCCCACTGG - Intergenic
941441223 2:165539455-165539477 ATTTGATTATTTTCCCCTAATGG + Intronic
942990549 2:182195963-182195985 CATTGCTTATTTACCTCCAAAGG + Intronic
943056271 2:182984758-182984780 TTTTGATTATTTTACTTCACAGG + Intronic
943143802 2:184017014-184017036 ATTAATTTTTTTTCCTCCACAGG + Intergenic
943777310 2:191780270-191780292 ATTTGATTTTTTTCCCCTACTGG + Intergenic
944420848 2:199528379-199528401 ATTTCCTAAATTTCCTCCATTGG + Intergenic
944620205 2:201506496-201506518 AATTGTGTAATTTCCTCCACAGG + Intronic
944636614 2:201681331-201681353 ATTTACTTATTTTGCTTCTCGGG + Intronic
945128567 2:206540797-206540819 ATCTGCTTATCTGGCTCCACAGG - Intronic
945155199 2:206830730-206830752 TGGTGCTTATTTTCCTCTACAGG + Intergenic
948688426 2:239686409-239686431 CTGTTCTTATTTTCCTCCATTGG + Intergenic
1169452532 20:5724300-5724322 ATTTGCTTATTTTTCTGCCTAGG - Intergenic
1170654956 20:18277707-18277729 CTTTCATTATTTTTCTCCACAGG + Intergenic
1172488475 20:35315076-35315098 ATATGCCTATTTTCCTACATTGG - Intronic
1173092685 20:39988632-39988654 ATTTCCTTACTCTCTTCCACGGG - Intergenic
1173739270 20:45385523-45385545 CTTTGCTCATTTTCCTCCAATGG + Intronic
1173877112 20:46380303-46380325 ATTTGCTTATTTTCCTCCACAGG - Exonic
1174422608 20:50409505-50409527 ATTTTTTTTTTTTCCTCCAGGGG - Intergenic
1175009057 20:55716397-55716419 ACTTTTTTATTTTCTTCCACAGG + Intergenic
1175168926 20:57066349-57066371 ATCTGCTAATTTTCCTACAATGG + Intergenic
1177343414 21:19835725-19835747 GTTTGCTTGTTTACCTACACAGG + Intergenic
1177568387 21:22853676-22853698 ATTTACCTAGTTTCCTCCCCAGG + Intergenic
1179150943 21:38807521-38807543 GCTTGCTTATTTTACTCAACAGG - Intronic
1182791625 22:32957859-32957881 AGATGCTCATTTTCTTCCACAGG + Intronic
1183650001 22:39148387-39148409 ATTGGCTATTTTTCCTCCTCTGG - Intronic
1183734852 22:39638569-39638591 ATTTGGTTATTTTGTTCCATTGG + Intronic
950558324 3:13708138-13708160 ATTTCCTCAGTTTTCTCCACAGG - Intergenic
950944922 3:16935223-16935245 CTTTGCTTATTTTCCCCCTGAGG + Intronic
951185708 3:19710386-19710408 ATTTGATTATTTTTCTCAATAGG + Intergenic
951201779 3:19883430-19883452 ATTTACATATTTTTCTCAACTGG - Intronic
951299430 3:20975655-20975677 ATTTCCTTCTTTTCCTGCGCAGG + Intergenic
952096679 3:29962192-29962214 ATTTATTTATTTTTCTCCAAGGG - Intronic
955030069 3:55207600-55207622 CTTTGCCCAGTTTCCTCCACTGG + Intergenic
955089793 3:55738489-55738511 ATTTGCTCATTTTCCCACCCAGG + Intronic
956641322 3:71418366-71418388 ATTTGCATATTCTCCTGCACAGG + Intronic
957479133 3:80769252-80769274 ATTTGCTGTTTATCATCCACAGG - Intergenic
957789488 3:84920458-84920480 TTTTAATTCTTTTCCTCCACAGG - Intergenic
958133133 3:89455196-89455218 ATTTACTTATTTCCTTCCTCTGG - Intronic
958492369 3:94793459-94793481 ATTTACTTTTTGTCTTCCACAGG - Intergenic
958505452 3:94971813-94971835 ATTTGCTTATCTTCTTCCTCTGG + Intergenic
958582336 3:96043554-96043576 TTCTGCTTATTTTCCTCTCCAGG + Intergenic
958642272 3:96820296-96820318 ATTGGTTTATTTTACTCAACTGG - Intronic
958647899 3:96896315-96896337 ATCTGCTTACTTTCCTCACCTGG + Intronic
959105584 3:102061212-102061234 ATATACTTTTTTTCCTCCAAGGG + Intergenic
959268192 3:104170602-104170624 ATTTGCTGAATATCCTTCACAGG - Intergenic
961679292 3:128588241-128588263 ATCTGCTCATTTGCCTCCCCCGG + Intergenic
962062371 3:131943745-131943767 ACTTTCTTACTATCCTCCACTGG + Intronic
962314753 3:134352384-134352406 ATTTGGTTATTTCCCTGCACAGG - Intergenic
962950297 3:140212555-140212577 ATTTGCTTATAATCCTTCAATGG + Intronic
963311978 3:143719538-143719560 ATCTGCTTATTTTCCCTAACAGG + Intronic
963609155 3:147443216-147443238 CTTTGCTTATTTTCCTTCTTAGG - Intronic
964145525 3:153457465-153457487 TTTGGCTTGTTTTCCTCCAGAGG + Intergenic
964299647 3:155274084-155274106 CTTTATTTATTTTCTTCCACTGG - Intergenic
964730831 3:159862671-159862693 CTTTGCTTATTTTCCTACAAAGG - Intronic
965120599 3:164550282-164550304 ACTTGCTTCTTTTCCACCTCTGG + Intergenic
965492803 3:169360679-169360701 ATTTGCTTTTTTTTCCCCCCTGG - Intronic
965847059 3:172975541-172975563 ATTTGCTTATTTTTCCCATCTGG + Intronic
966138587 3:176729411-176729433 ATTTGCTTGCTTTTCTCAACCGG + Intergenic
967361938 3:188641149-188641171 CTTTACTTATTTTCATCCAAGGG - Intronic
967372798 3:188766748-188766770 ATTTGCTAATTTTTCTCTAATGG - Intronic
969966057 4:10996773-10996795 ATTTGCTTAGCTGCCTCCAGGGG + Intergenic
970562482 4:17296254-17296276 ATTTGTTTATTTTTCTCAATGGG - Intergenic
971149615 4:24017920-24017942 ATGTGTCTATTTTCCTCCAAAGG - Intergenic
971785006 4:31089899-31089921 ATTTGCTAATTTTCTTTTACAGG + Intronic
971855883 4:32043178-32043200 ATTTGCTTTTGTTTCTCAACGGG - Intergenic
972258392 4:37383342-37383364 ATTTCATTATTTTTCACCACAGG - Intronic
973270423 4:48256685-48256707 ATTTGCTTATTTACTGCAACAGG - Intronic
974476733 4:62391422-62391444 ATTTGCTTTTCTTTCACCACTGG - Intergenic
974836725 4:67260221-67260243 ATTTGCATTCCTTCCTCCACAGG + Intergenic
975846781 4:78533533-78533555 ATTTGCTTAATATCCTTCAGTGG - Intronic
975895225 4:79081568-79081590 ACATGCTTTTTTTCCCCCACTGG + Intergenic
976115557 4:81722477-81722499 ATTTGCTTTTCTTCCTTCAAAGG + Intronic
976341072 4:83945536-83945558 ATTTGCTTATTTATTTCCTCAGG + Intergenic
976470464 4:85422491-85422513 AATTGCTTAATTTACTCCAAGGG + Intergenic
976768874 4:88629239-88629261 ATTTGCTTATTTTAGTTTACAGG - Intronic
977839819 4:101689378-101689400 ATATCCTTATTTTCCTCCTTAGG + Intronic
981614547 4:146633463-146633485 CTCTGCTTTCTTTCCTCCACCGG + Intergenic
982254861 4:153441913-153441935 ATCTACCTACTTTCCTCCACTGG - Intergenic
982285254 4:153727097-153727119 ATGTGCTTGTTTTCATCCCCTGG - Intronic
982474276 4:155831402-155831424 AATTGATTCTTGTCCTCCACTGG + Intronic
982752090 4:159174643-159174665 ATTTGTTTATTTTTTTCCTCTGG + Intronic
982880993 4:160715317-160715339 ATTTTCTTTTTTTCTTACACAGG + Intergenic
984112116 4:175629515-175629537 ATTTGTTTCTTCTCCTCCAATGG - Intergenic
984524523 4:180842201-180842223 ATTTTTTTTTTTTTCTCCACAGG + Intergenic
985477928 5:90337-90359 ACTGGTTTATTTCCCTCCACTGG + Intergenic
987379595 5:17272663-17272685 TTTTGCTAATTTACCTCTACTGG - Intronic
988106986 5:26763788-26763810 ATTAGCTTATTTTCCGACTCTGG - Intergenic
988203307 5:28098497-28098519 ATTTGTTGATTCTCCCCCACAGG + Intergenic
988222699 5:28369461-28369483 AGTTACTTATTTTCTTCCCCAGG + Intergenic
989773756 5:45177225-45177247 ATTGGCTTATTTTCTTGCAATGG + Intergenic
992356014 5:75984259-75984281 ATTAGATTATTTTCCTTCACTGG - Intergenic
993191697 5:84691239-84691261 ATTTCCTTCTATTCCTCCTCAGG + Intergenic
993715530 5:91272125-91272147 ATTTTCTCATTTTCACCCACTGG + Intergenic
995973664 5:118004460-118004482 ATCTGCCTGATTTCCTCCACAGG - Intergenic
996913443 5:128681616-128681638 ATGTGATTATTTTCCACCACTGG - Intronic
997660806 5:135588280-135588302 AGTGGCTTTTTTTCCTCCACAGG - Intergenic
997943825 5:138181931-138181953 ATTTCCTTATTTTCCTCACAAGG + Intronic
998175301 5:139898153-139898175 ATAGGCTTTGTTTCCTCCACAGG - Intronic
1000703567 5:164483141-164483163 ATTTGGTTTTTATCTTCCACTGG - Intergenic
1001468973 5:171994996-171995018 ATTTGCTAATATTTCTCCTCTGG - Intronic
1001605382 5:172956134-172956156 ATTTGATAATTTTCCTCCAGTGG - Intergenic
1003744206 6:8981273-8981295 ATTTGATTTTTTCCTTCCACAGG - Intergenic
1003836308 6:10075351-10075373 ATTTGCTTATTTTCTTAAACTGG - Intronic
1004852587 6:19715494-19715516 ATTTGCTCTTCTTCTTCCACAGG + Intergenic
1005223123 6:23610868-23610890 ATTTTCTTAATTTCCCACACAGG + Intergenic
1005256000 6:24003715-24003737 GTTTGTTTTTTCTCCTCCACCGG + Intergenic
1005614872 6:27562898-27562920 ACTTCCTTAATTTCCTCCACTGG + Intergenic
1005998698 6:30948525-30948547 ATTTGCCTCTCTCCCTCCACAGG + Exonic
1007865010 6:44958606-44958628 ATTCTCTTAGTTTCTTCCACAGG + Intronic
1008119850 6:47599870-47599892 AAAAGCATATTTTCCTCCACTGG - Intronic
1008335848 6:50303737-50303759 ATTTCCTTACTTTCCTTTACTGG - Intergenic
1008549831 6:52617754-52617776 ATTTACTTTTTTTACTCAACTGG - Intergenic
1009773006 6:68167982-68168004 ATTTGCTTTGTTTCTTCCATAGG + Intergenic
1010044701 6:71427636-71427658 GTTTGATTATCTTCCTCCCCTGG - Intergenic
1011291225 6:85779397-85779419 ATTCCCTTAGTTTCCCCCACTGG + Intergenic
1012764174 6:103343433-103343455 ATCTGCTTTTTTTCATTCACTGG - Intergenic
1013937129 6:115610564-115610586 TTTTGTTTATTTCCCCCCACTGG - Intergenic
1014536045 6:122614208-122614230 ATTTGCATAATTTCCTGAACGGG + Intronic
1015201970 6:130592875-130592897 AATTGCTTTTCTTCTTCCACTGG - Intergenic
1015716874 6:136202040-136202062 AAATGCTTATTTTCCCTCACAGG - Intergenic
1016266688 6:142240687-142240709 ATTTGTTTATTTTTTCCCACAGG - Intergenic
1017155559 6:151319961-151319983 TTTGGCTTCTTTTCCTCCAAGGG + Intronic
1018475249 6:164134036-164134058 AGTTGCTCATAGTCCTCCACGGG - Intergenic
1021528495 7:21616911-21616933 ATTTGCTTTTTTTCCACCCCAGG + Intronic
1021638177 7:22711853-22711875 ATCTGCCTATTTTTCACCACTGG + Intergenic
1022009987 7:26300454-26300476 ATTTTGTTATTTTTTTCCACAGG - Intronic
1022305219 7:29140752-29140774 TTTTTCTTATTTTCCTTCCCTGG - Intronic
1026810786 7:73462904-73462926 ATTTTCTTATATTCCTACCCGGG + Exonic
1027377783 7:77571130-77571152 ATTTTCTTCTTTTTCTCCAGTGG - Exonic
1027699225 7:81449236-81449258 ATTTTCTTTGTTTCCTCCATTGG - Intergenic
1027717970 7:81697920-81697942 ATTTTATTATTCTCCTACACAGG - Intergenic
1028045308 7:86110198-86110220 AGTTGCTTATTTTCCTCTCGGGG - Intergenic
1028924938 7:96347679-96347701 CTTTGCCTATTTTCCTTCAAAGG - Intergenic
1029105370 7:98170887-98170909 GTTTGTTTATTTTCCTGCTCAGG + Intronic
1029813762 7:103074323-103074345 GTCTGCTGATTTTCCTCCTCAGG + Exonic
1030250437 7:107438085-107438107 CTATGCTTATTTTCATCCATAGG - Intronic
1030512949 7:110507239-110507261 ATTTGCCTATTTTCTGCCTCCGG + Intergenic
1030639946 7:111993224-111993246 ATTTGGATTTTTTCCTCGACAGG + Intronic
1031337047 7:120548353-120548375 ATTTCCTTCTTTTCCTTCATCGG + Intronic
1032443083 7:131957253-131957275 ATTTCCTGATTTTTCCCCACTGG - Intergenic
1033011698 7:137629526-137629548 AGTTGCTTATCTGCTTCCACTGG - Intronic
1033089668 7:138373704-138373726 ATTTGCTTTTTTTACTCAAAAGG - Intergenic
1033301610 7:140191254-140191276 ATTTGCTTATTTTTTTCTAAGGG - Intergenic
1034366913 7:150558490-150558512 ATTTGCTTATTTCTTCCCACAGG - Intergenic
1037136358 8:15466781-15466803 TTTTTCTGATTTTCCTCCATGGG + Intronic
1038711068 8:29946175-29946197 CTTTCCTCAGTTTCCTCCACTGG + Intergenic
1040737565 8:50527402-50527424 TTTTTCTTATTTTCCTCTAGAGG + Intronic
1040808095 8:51417628-51417650 ATCTGCTAATTTTCTTCCCCAGG - Intronic
1042000216 8:64114012-64114034 ATTTCCATACATTCCTCCACAGG - Intergenic
1042010342 8:64237573-64237595 TTTTGCTTATTGGCCTACACAGG - Intergenic
1042783290 8:72517243-72517265 ATTTGCTTATCTCCCTCTCCTGG - Intergenic
1044174304 8:89098871-89098893 TATTGTTTATTTTCCTCCATTGG - Intergenic
1044309877 8:90681525-90681547 ATTTGCTTTTTATTCTCCTCTGG + Intronic
1045759753 8:105590341-105590363 TTGTGGTTATTATCCTCCACAGG - Intronic
1045887688 8:107119031-107119053 ATTTGCCTCTTTTTTTCCACTGG + Intergenic
1046231850 8:111368184-111368206 ATTTGATTATTTTCCCCCTAAGG + Intergenic
1047806285 8:128364180-128364202 ATTTGTTTATTTTCATTCATTGG + Intergenic
1048172094 8:132117032-132117054 ATTTGATTATTTTCTTCCCCTGG + Intergenic
1048757866 8:137757755-137757777 ATTAGCACATTGTCCTCCACTGG + Intergenic
1048844848 8:138596528-138596550 ATTTGTTTATCTACCTCCTCTGG + Intronic
1050271872 9:3954953-3954975 ATTTATTTATTTTTATCCACCGG - Intronic
1050391824 9:5152108-5152130 ATTTGCCTATTTGCCTTCTCAGG - Intronic
1050994953 9:12205541-12205563 ATTTGCCTAGTGTCCTCCAGTGG - Intergenic
1051375456 9:16397977-16397999 ATTTGCTGATTTTGCCCCAAGGG + Intergenic
1051556610 9:18390694-18390716 AGTATCTTGTTTTCCTCCACTGG - Intergenic
1051557825 9:18404689-18404711 ATTTACTGTTTTTCCTCCACTGG - Intergenic
1052062409 9:23976767-23976789 AATTGCTTATTTTCCTTAATTGG - Intergenic
1052245562 9:26329926-26329948 TTTTGCTTCTTTGCCTGCACAGG + Intergenic
1052892107 9:33711154-33711176 ATTTGCTTGTTATCCACGACAGG + Intergenic
1055158404 9:73094225-73094247 ATATTCTTCCTTTCCTCCACTGG + Intergenic
1055220412 9:73923277-73923299 TTATAATTATTTTCCTCCACAGG - Intergenic
1056892350 9:90507004-90507026 ATTTGCATATTTTCCTGTATAGG + Intergenic
1056899882 9:90588252-90588274 TTTTGCTTATTTCCCTCCAATGG - Intergenic
1060039801 9:120290236-120290258 ATATGCCTATGTTCCTTCACTGG - Intergenic
1060138771 9:121185178-121185200 ATTTTATTATACTCCTCCACGGG + Intronic
1188042588 X:25386998-25387020 ATTTGCTATTTTCTCTCCACTGG + Intergenic
1189626370 X:42901630-42901652 CCTTTCTTATTTTCCTCCAAAGG + Intergenic
1189828864 X:44949966-44949988 ATTTGCTTGTGCTACTCCACAGG - Intronic
1190726069 X:53191622-53191644 ATTCCCTGATTTTTCTCCACAGG - Intronic
1192634766 X:72806593-72806615 ATTTTTTTTTTTTCCTCCCCTGG + Intronic
1192646947 X:72914208-72914230 ATTTTTTTTTTTTCCTCCCCTGG - Intronic
1193309005 X:79983054-79983076 ATTTACCTAATTTTCTCCACCGG - Intergenic
1193560946 X:83014880-83014902 ATTTGCTAATTTTGCTTAACAGG + Intergenic
1194309840 X:92292579-92292601 CTTTTCTTATTTTCCTTCTCAGG - Intronic
1194634056 X:96322200-96322222 GTTTGGTTATTTTCTTTCACTGG + Intergenic
1195931355 X:110080385-110080407 TTTTACCTAATTTCCTCCACTGG + Intronic
1196245858 X:113399726-113399748 ATATGCATAGTTTCCTCCAGTGG + Intergenic
1196296863 X:114007815-114007837 ATTTGATTATTTTCTTCAAATGG - Intergenic
1196766017 X:119244020-119244042 ATTTGGTTATTTTACTCAATTGG + Exonic
1197606280 X:128589086-128589108 ATTTGCTGATTTTCTTCAAAGGG + Intergenic
1197810021 X:130433031-130433053 CTTTGCTTAAAATCCTCCACAGG + Intergenic
1198768556 X:140103937-140103959 AATTGCTTATTTGCCTCATCTGG - Intergenic
1199926420 X:152470735-152470757 AGTTTCATTTTTTCCTCCACAGG - Intergenic
1200618133 Y:5406868-5406890 CTTTTCTTATTTTCCTTCTCAGG - Intronic
1201944049 Y:19492013-19492035 ATTTGTTTGTTTTCCACCAGTGG - Intergenic
1202233407 Y:22679655-22679677 ACTTGCTCATTTTTCTCCTCAGG + Intergenic
1202309749 Y:23516503-23516525 ACTTGCTCATTTTTCTCCTCAGG - Intergenic
1202367465 Y:24175726-24175748 ATTTACTTATTTTCCTTGAATGG + Intergenic
1202503318 Y:25494397-25494419 ATTTACTTATTTTCCTTGAATGG - Intergenic
1202561052 Y:26154090-26154112 ACTTGCTCATTTTTCTCCTCAGG + Intergenic