ID: 1173877118

View in Genome Browser
Species Human (GRCh38)
Location 20:46380348-46380370
Sequence CACCTGTGACTACTATCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173877112_1173877118 22 Left 1173877112 20:46380303-46380325 CCTGTGGAGGAAAATAAGCAAAT 0: 1
1: 0
2: 0
3: 37
4: 321
Right 1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1173877111_1173877118 28 Left 1173877111 20:46380297-46380319 CCATATCCTGTGGAGGAAAATAA 0: 1
1: 1
2: 3
3: 19
4: 252
Right 1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173877118 Original CRISPR CACCTGTGACTACTATCGAG AGG Intronic
920422856 1:205847249-205847271 CACCTCTGACAACTTTGGAGGGG + Intronic
920423600 1:205854488-205854510 CACCTCTGACAACTTTGGAGGGG - Intergenic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1078143436 11:8707669-8707691 CACCTGTGACTGTGAGCGAGCGG - Intronic
1078417052 11:11174455-11174477 CACCAGTGTCTAATATGGAGGGG + Intergenic
1101075138 12:101121231-101121253 CACTGGGGACTACTATAGAGGGG - Intronic
1101550765 12:105759466-105759488 CACCTGGGACTATCATCCAGGGG - Intergenic
1107812263 13:44211873-44211895 CACCTGTCACCACTCTTGAGTGG + Intergenic
1108820026 13:54337005-54337027 CACCTGTGACTACCACTAAGTGG - Intergenic
1109029562 13:57175743-57175765 CGCCTGTGCCTAGTATGGAGAGG - Intergenic
1112535092 13:100246062-100246084 CACCTGTATCAACTATCTAGGGG + Intronic
1125515085 15:40314371-40314393 CACCTGTGTCTTCTATAAAGTGG - Intergenic
1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG + Exonic
1139042033 16:63009525-63009547 CACCTGTAATCACTAGCGAGAGG - Intergenic
1144270821 17:13613946-13613968 CAGCTGTGATCACTATGGAGTGG + Intergenic
1156504168 18:37578323-37578345 CACCTGTGGCCACTACCTAGAGG - Intergenic
1160666096 19:329380-329402 CACCTTGGGCTACTATGGAGAGG - Intronic
1164905734 19:31966494-31966516 CTCCTGTGACTGCAATTGAGAGG - Intergenic
931118088 2:59186243-59186265 CACTTTTGACTACTAGCGTGGGG - Intergenic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
944336973 2:198545535-198545557 CACCTCTTACTCCTATCCAGAGG - Intronic
947020920 2:225674679-225674701 CACTTTTGACAAATATCGAGGGG - Intergenic
1170774977 20:19367262-19367284 CTCCTGTGACCACTATCCAGAGG - Intronic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1177850310 21:26338883-26338905 CATATATGACTACTATTGAGTGG - Intergenic
974366261 4:60953550-60953572 CACTGGTGACTACTAGAGAGGGG - Intergenic
975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG + Intergenic
976131330 4:81887568-81887590 CACTGGGGACTACTACCGAGGGG + Intronic
977529748 4:98185996-98186018 TAACTGTGACTACCATTGAGTGG + Intergenic
1004290772 6:14364883-14364905 AAGCTGTGACCATTATCGAGGGG + Intergenic
1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG + Intergenic
1013905676 6:115215243-115215265 CACCTGTGTCTTCTTTAGAGAGG + Intergenic
1028664644 7:93327308-93327330 CACGTGTGACTACTATCATATGG + Intronic
1036495112 8:9263237-9263259 CACTGGTGACTACTAGAGAGGGG + Intergenic
1060528127 9:124331998-124332020 GACCTGTGACTGCCACCGAGGGG - Intronic
1194240381 X:91437717-91437739 CACCTGTGAATATTATCAAAAGG - Exonic
1195281056 X:103332870-103332892 CACATCTGACTCCTATGGAGAGG - Intergenic
1196010074 X:110877399-110877421 CACCTGTGCCTATTTTCCAGAGG - Intergenic
1202147258 Y:21811914-21811936 CACCTTTTACTACTATCTTGTGG - Intergenic