ID: 1173878083

View in Genome Browser
Species Human (GRCh38)
Location 20:46389142-46389164
Sequence GCTGGATGCCATGAAGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173878083_1173878090 1 Left 1173878083 20:46389142-46389164 CCAGCTCCTTCATGGCATCCAGC 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1173878090 20:46389166-46389188 GGGTCTCCATGTTGGATGACTGG 0: 2
1: 0
2: 2
3: 9
4: 98
1173878083_1173878091 2 Left 1173878083 20:46389142-46389164 CCAGCTCCTTCATGGCATCCAGC 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1173878091 20:46389167-46389189 GGTCTCCATGTTGGATGACTGGG 0: 2
1: 0
2: 2
3: 8
4: 91
1173878083_1173878093 19 Left 1173878083 20:46389142-46389164 CCAGCTCCTTCATGGCATCCAGC 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1173878093 20:46389184-46389206 ACTGGGTCCTCTCCATCAGCTGG 0: 2
1: 0
2: 0
3: 13
4: 161
1173878083_1173878087 -7 Left 1173878083 20:46389142-46389164 CCAGCTCCTTCATGGCATCCAGC 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG 0: 2
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173878083 Original CRISPR GCTGGATGCCATGAAGGAGC TGG (reversed) Exonic
900203876 1:1422926-1422948 ACAGGATGCCGTGAAGAAGCCGG + Intergenic
900393217 1:2442904-2442926 GCAGGCAGCCATGAAGGAGGAGG - Intronic
900408977 1:2504396-2504418 GCTGGATGACATGCTGGAGGAGG - Exonic
900898605 1:5501826-5501848 GCTGGCTTCCAGGAAGGAGAGGG - Intergenic
901760661 1:11469145-11469167 GCTGGGAGGCAGGAAGGAGCCGG + Intergenic
902388167 1:16088002-16088024 GCTGGCTGGCAGGAAGGAGAAGG - Intergenic
902507321 1:16946739-16946761 GCTGGAGGCCAGGTAGGAGTGGG - Exonic
902534618 1:17112380-17112402 GCCAGATGCCAGCAAGGAGCAGG - Intronic
903222036 1:21874524-21874546 GCTGGCAGCCCTGGAGGAGCAGG + Exonic
905037003 1:34925072-34925094 CCAGGATGCCAGGAAGGAACAGG + Intronic
908145891 1:61242794-61242816 GCTGGTTGTCATGAAGGTACTGG + Intronic
908738522 1:67302780-67302802 GCTGGATGCCATGACTGGACAGG + Intergenic
911951303 1:104177031-104177053 ACTGGTTGCAGTGAAGGAGCCGG + Intergenic
912201314 1:107461367-107461389 GCTGAAAGGCAGGAAGGAGCTGG + Intronic
913695974 1:121326019-121326041 GCTGGAAACCATGGAGGAGATGG - Intronic
914141590 1:144954040-144954062 GCTGGAAACCATGGAGGAGATGG + Intronic
915323007 1:155066336-155066358 GATGGATGCTGTGAAGAAGCTGG - Intronic
915561741 1:156691941-156691963 GCTGGATGCCTGGAGGAAGCTGG + Intergenic
918206046 1:182310249-182310271 GCTGGATGCCATGAATTGGGAGG - Intergenic
918631102 1:186719442-186719464 GCTCCATGACATGAAGGATCTGG - Intergenic
920483300 1:206344387-206344409 GCTGGAAACCATGGAGGAGATGG - Intronic
920676809 1:208043791-208043813 GCTGGATGACAGGGAAGAGCTGG - Intronic
921709292 1:218357252-218357274 GCTGGATGAGATGAAGGGGAGGG + Intronic
922249795 1:223838037-223838059 CCTGAATGACAAGAAGGAGCTGG - Intronic
923337795 1:232985245-232985267 GCTGTTTCCCATGAAGGAGAGGG + Intronic
923341258 1:233008910-233008932 GGTGGATGCCCTGGAGCAGCTGG + Intronic
924721546 1:246627580-246627602 GCTGTATGCCAGGAAGGAGAGGG + Intronic
1063019123 10:2108421-2108443 GCTGGGTGCCACGAAGGCTCTGG + Intergenic
1063096212 10:2911337-2911359 TCTGGATGCCACGAAGCACCAGG + Intergenic
1065576028 10:27119321-27119343 AATGGTTACCATGAAGGAGCTGG - Exonic
1069887560 10:71633676-71633698 CCTGGGAGCCAAGAAGGAGCAGG - Intronic
1071390075 10:85165142-85165164 GCTGGATGCCTGAGAGGAGCAGG + Intergenic
1071503365 10:86218886-86218908 TCTGGATGCCTTGGAGCAGCAGG + Intronic
1072633525 10:97163387-97163409 TTTTGATGACATGAAGGAGCTGG - Exonic
1073610838 10:104941164-104941186 GCAGGATGCAATAAAGAAGCTGG - Intronic
1074569233 10:114609441-114609463 GCTGGAGGACATGGAGGAGAAGG - Intronic
1075726390 10:124612964-124612986 GCTGGAGGCCCAGAGGGAGCTGG + Intronic
1075928604 10:126273905-126273927 GCTGGAGGCCATGAAGGAAGTGG + Intronic
1076942196 10:133617355-133617377 GCTTGATGCCATCAAGGAAATGG - Intergenic
1077407144 11:2387712-2387734 GCTGGAAGCCATGTGGCAGCTGG - Intronic
1078264932 11:9747990-9748012 GCAGGAGGCCATGGAGCAGCTGG + Exonic
1079009081 11:16813612-16813634 GGTGGATGCCTTGAAGAGGCAGG + Intronic
1079242317 11:18729527-18729549 GCTGGTGGCAATGAAGCAGCCGG + Exonic
1080138883 11:28890939-28890961 ACTGGGTGCCATGGAGCAGCGGG - Intergenic
1080503035 11:32888241-32888263 ACTGGGTGCCATGGAGCAGCGGG + Intergenic
1081670849 11:44941724-44941746 GATGGAGGCCATGGAGGAGTAGG + Intronic
1083089605 11:60186121-60186143 GCTGAACACCATGAAGGAACTGG + Intergenic
1084236417 11:67790718-67790740 CCTGGATCCCATCCAGGAGCCGG - Intergenic
1084686747 11:70700629-70700651 GCTGGATGCCAGGGAGGAGGGGG - Intronic
1085182933 11:74551292-74551314 GCTGAGTGCCATGAAGGGGAAGG - Intronic
1086972021 11:93091807-93091829 ACTTGATACCATGAAGCAGCTGG + Intergenic
1087022609 11:93618373-93618395 GCTTAATGCCATGGAGGACCGGG - Intergenic
1088686476 11:112288456-112288478 CCTGGAGGCCAAGAAGGAGCTGG + Intergenic
1089202002 11:116730204-116730226 GCTGGACACCATAGAGGAGCAGG - Intergenic
1090217304 11:124981019-124981041 CCTGGAAGCCATTCAGGAGCAGG + Intronic
1090437043 11:126695712-126695734 GCTGCATTGCAAGAAGGAGCTGG + Intronic
1091177207 11:133571713-133571735 GCTTGATGGCAGGAATGAGCAGG + Intergenic
1091672048 12:2458896-2458918 GCTGTATGGCAGGAAAGAGCTGG - Intronic
1092761445 12:11814852-11814874 GCTGGATGCAAGGCAGAAGCAGG - Intronic
1092927962 12:13289265-13289287 GCTTACTGCCATAAAGGAGCTGG + Intergenic
1093939326 12:25035697-25035719 TCTGGACGCCATGATGGATCAGG + Intronic
1095587463 12:43864229-43864251 ACTGGGTGCCATGAAGCAGGGGG - Intronic
1096081684 12:48837517-48837539 ACTGCATGCCATTAAGGTGCAGG - Exonic
1096794058 12:54062951-54062973 GCTGGATTTCAGGATGGAGCTGG - Intergenic
1097240542 12:57572159-57572181 GCTGCAGGCCCTGGAGGAGCTGG + Exonic
1097963739 12:65557445-65557467 ACAGGATGCCATAAAGAAGCCGG + Intergenic
1101019579 12:100539887-100539909 GCTTGATTGCAGGAAGGAGCAGG + Intronic
1101959748 12:109239874-109239896 CCTGGAGGCCATGGACGAGCTGG + Exonic
1102050409 12:109857752-109857774 CCTGGAGGGCAGGAAGGAGCAGG - Intronic
1102206689 12:111095873-111095895 GCTGGGTGCCATGTAGGGTCCGG + Intronic
1103564534 12:121808811-121808833 GCCTGATGCCAGGGAGGAGCTGG - Intronic
1105003582 12:132707048-132707070 CCTGGATGCCGTGAAGGATGTGG + Intergenic
1105670185 13:22604919-22604941 CCTATATGCCATGAATGAGCAGG + Intergenic
1107153081 13:37134407-37134429 GCTAGTTGCTATGAAGGAACAGG - Intergenic
1111108539 13:83676383-83676405 GTTGAATGCCAGGAAGGGGCGGG - Intergenic
1112013313 13:95310182-95310204 GTTGGATGAGATGAATGAGCAGG - Intergenic
1113674485 13:112197835-112197857 GCTGCATGACATGAGGGAGTTGG - Intergenic
1116327452 14:43548827-43548849 GCTGAAGGCAAAGAAGGAGCAGG + Intergenic
1116642277 14:47479609-47479631 GTTAGATGCCAAGAAGAAGCAGG - Intronic
1121171833 14:91861047-91861069 GCTGGATACCATAATGGAGTGGG + Intronic
1121551549 14:94806558-94806580 GAGGAATGCTATGAAGGAGCGGG + Intergenic
1123119613 14:105910703-105910725 GCTCAGAGCCATGAAGGAGCAGG - Intergenic
1123432624 15:20231567-20231589 GATGGATGCCATGAAGTATACGG - Intergenic
1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG + Intergenic
1124972118 15:34497476-34497498 GCTTTATGCCATGAACAAGCAGG + Intergenic
1125280926 15:38042083-38042105 GCTGGGAGCCATGAAGCAGTGGG - Intergenic
1125720853 15:41844536-41844558 GCTGGCTGGCCTGAAGGAGCTGG + Exonic
1125909349 15:43422007-43422029 GCTGGATGCCTTGGAGGAGAAGG + Exonic
1126112207 15:45181976-45181998 GCTGGGTGGCAGGAAGGAGAGGG - Intronic
1127187041 15:56490849-56490871 GCTGGGTACCATGGAGGAGACGG - Intergenic
1127520414 15:59738118-59738140 TCTGAATTCCATGAAGGAGTCGG - Intergenic
1128556301 15:68634125-68634147 GCCGGAGGCCATGAAGGAGGGGG + Intronic
1129029871 15:72610348-72610370 GCTGGGTGACCTGAAGGAGACGG + Intergenic
1129111013 15:73337088-73337110 ACAGGATGACAAGAAGGAGCTGG - Intronic
1129113015 15:73349130-73349152 GCTGGAGACCAGGAAGGAGGTGG - Intronic
1129591315 15:76917380-76917402 GCTGCATGCCATGAAGAAAAGGG + Intergenic
1130115614 15:81002132-81002154 GGTGGATGGCATGATGGTGCGGG + Exonic
1131133657 15:89916236-89916258 AGTGGGTGACATGAAGGAGCAGG + Intergenic
1132763598 16:1523511-1523533 GCTGGCTGCCAGGAAGGTACGGG - Exonic
1133234507 16:4381663-4381685 CCTGGCTGCCCTGCAGGAGCTGG + Exonic
1133293240 16:4736504-4736526 GTTGGATGCCATGAGGGCCCAGG - Exonic
1134453716 16:14379041-14379063 GCTGGCTACCAGGAAGGAGCTGG - Intergenic
1134880241 16:17739932-17739954 GATGGAGGCCAGGAAGGAGGGGG + Intergenic
1135176698 16:20236236-20236258 GGTGGAGGACATGAAGGAGGTGG - Intergenic
1136990699 16:35149756-35149778 GCTGGATGCCAAGAAGGTGAAGG - Intergenic
1138553972 16:57761675-57761697 GCTGAATGCGGTGGAGGAGCTGG - Intronic
1140670869 16:77277762-77277784 GCTGGACTACAGGAAGGAGCGGG - Intronic
1203113611 16_KI270728v1_random:1468057-1468079 GATGGATGCCATGAAGTATACGG + Intergenic
1143891452 17:10105610-10105632 TCTGGATGACAAGAAGCAGCTGG - Intronic
1144965295 17:19073507-19073529 GGTGAAAGCCAAGAAGGAGCAGG - Intergenic
1144982672 17:19178676-19178698 GGTGAAAGCCAAGAAGGAGCAGG + Intergenic
1144985551 17:19199563-19199585 GGTGAAAGCCAAGAAGGAGCAGG - Intergenic
1145998560 17:29118126-29118148 GCAGGCGGCCATGAAGGTGCTGG - Exonic
1146059054 17:29594941-29594963 GCTGGATGCCATGCAGGCCTGGG - Intronic
1146278760 17:31531618-31531640 AATGGAAGCCCTGAAGGAGCAGG + Exonic
1146605671 17:34255631-34255653 GCTGGAATCCTGGAAGGAGCTGG - Intronic
1146607144 17:34270575-34270597 GCTGGAATCCTAGAAGGAGCTGG - Intronic
1146608924 17:34287639-34287661 GCAGGATTCCATGAAGTATCTGG + Exonic
1148193672 17:45698160-45698182 GCTGGATGCCGTCATGGAGCTGG - Intergenic
1150069601 17:62139822-62139844 GCAGGGTGCCTTCAAGGAGCTGG - Intergenic
1150251924 17:63710561-63710583 CATGGATGGCATGAATGAGCTGG - Exonic
1151151676 17:72093477-72093499 TCTGCACGCCAGGAAGGAGCAGG - Intergenic
1151542734 17:74773001-74773023 GCTGGATGCCGAGAAGTGGCAGG - Exonic
1151545725 17:74791724-74791746 GCCAGATCCCAGGAAGGAGCAGG - Intronic
1152221758 17:79072626-79072648 CCCGGAGGCCATGAAGGAGGAGG + Intergenic
1153098562 18:1437633-1437655 GCTGGATGGCATGATGGCACTGG - Intergenic
1153514892 18:5894172-5894194 GCTGGATGCCTTGGGGGAGGAGG + Intronic
1153824746 18:8865112-8865134 ACAGGAAGCCAGGAAGGAGCTGG + Intergenic
1154045920 18:10904685-10904707 CCTGGATCCCAGGATGGAGCAGG + Intronic
1156859218 18:41816933-41816955 GCTGGCTGCTCTGAAGGATCTGG + Intergenic
1156946919 18:42844521-42844543 GCTGGACTTCATGAAGGACCTGG - Intronic
1157574188 18:48732747-48732769 GCTGGAGGGCATACAGGAGCAGG - Intronic
1158034560 18:53009936-53009958 GGTAGATGCGATGAAGCAGCAGG + Intronic
1158127932 18:54122483-54122505 GCTGAATGCCAAGTGGGAGCTGG - Intergenic
1160477274 18:79203172-79203194 GCAGGAGGCCCTGGAGGAGCAGG + Intronic
1160477292 18:79203280-79203302 GCAGGAGGCCCTGGAGGAGCAGG + Intronic
1161496901 19:4591444-4591466 CCTGGAGGCCAGGAAGGAGGAGG + Intergenic
1161950891 19:7467252-7467274 GCGGGCTGCCATCCAGGAGCGGG + Exonic
1161998916 19:7731047-7731069 GCTGGGTGCCCTGAAGGAGGAGG - Exonic
1162007252 19:7788587-7788609 GCTGGGTGCCCTGGAGGAGGAGG + Intergenic
1163347058 19:16749947-16749969 GCTGGATGCTATGGATGACCTGG + Exonic
1163364009 19:16866138-16866160 GCTGGGTGCCAGGGAGGAGGTGG + Intronic
1164861124 19:31563116-31563138 GTTGGATGAGAGGAAGGAGCTGG - Intergenic
1165116719 19:33533259-33533281 GCTGGAAACCAGGAAGGAGGAGG - Intergenic
1165413745 19:35678303-35678325 GATGCCTGCCATGAAGGAGGAGG - Exonic
1165778512 19:38418608-38418630 GTTGGATGCCATGGAAGGGCAGG - Intronic
1165939568 19:39408347-39408369 GCTGGAGGGCGAGAAGGAGCTGG - Exonic
1166127487 19:40724226-40724248 GCAAGATGCCATAAAGTAGCTGG + Intronic
1167427802 19:49438420-49438442 GCTGGATCCCAGGAAGGGGCTGG + Intronic
925238323 2:2298466-2298488 ACCAGATGCCATGAAGAAGCAGG + Intronic
926491731 2:13532859-13532881 GCTGAACACCATGAAGGAGCAGG - Intergenic
928142927 2:28746240-28746262 TTTGGTTGCCAGGAAGGAGCTGG - Intergenic
928613056 2:33009776-33009798 AGTGAATGCCAGGAAGGAGCAGG + Intronic
929773546 2:44913388-44913410 GCGGGATGCCAGGAGAGAGCTGG - Intergenic
931174348 2:59838062-59838084 GCTTGATGCCAGGATGAAGCAGG - Intergenic
932404752 2:71505600-71505622 GCTGTGTGCCATGGAGGATCTGG + Intronic
932750822 2:74370675-74370697 GGTGGAGGCACTGAAGGAGCGGG - Exonic
932763561 2:74456188-74456210 GCTGGATGCCCTGGAGAAGGGGG + Exonic
934096719 2:88613739-88613761 GCTGGATGACACCAAGGAACCGG + Exonic
934768426 2:96893576-96893598 GCTGGATGCCAGGGAGGGGATGG - Intronic
938070058 2:128303635-128303657 CCTGGATGTCATGAAGCAGAAGG - Intronic
938408428 2:131045406-131045428 GCTGAATGCCAGCAAGCAGCAGG + Exonic
938735230 2:134179887-134179909 GCAGGATGCAATAAAGAAGCTGG + Intronic
938761261 2:134428329-134428351 GCATGATACCATGAAGGAGAAGG - Intronic
940340997 2:152581429-152581451 GCTGGATGCTATGAAAAACCTGG + Intronic
948031522 2:234821595-234821617 GCTGGATGACAGAAAGGATCTGG - Intergenic
948589264 2:239038917-239038939 GCTGGTTGGCAGGAAGGAGAGGG + Intergenic
1168998933 20:2152681-2152703 GCAGGAGGCCATGATGGATCTGG - Intronic
1169358066 20:4924493-4924515 GCAGGAGGCCAGGCAGGAGCTGG - Intronic
1169784974 20:9349941-9349963 ACTGGATGGCATGAAGAAGTGGG + Intronic
1171204913 20:23271380-23271402 GTTTTATGCCATGAAGGAGCTGG + Intergenic
1172921720 20:38489089-38489111 CCTGGAAGCCAGGAAGGAGTAGG - Intronic
1173701401 20:45075062-45075084 CCTGGACCCCATGATGGAGCAGG + Exonic
1173812979 20:45967830-45967852 CCTGGAGGCCATGATGGAGGTGG - Exonic
1173878083 20:46389142-46389164 GCTGGATGCCATGAAGGAGCTGG - Exonic
1173927701 20:46793000-46793022 GCAGGGTGCCATCAAGCAGCTGG + Intergenic
1173937306 20:46878184-46878206 GCTGACGGCCATGAAGAAGCAGG + Intergenic
1174060963 20:47832854-47832876 GCTGGAGGCCAAAGAGGAGCTGG - Intergenic
1174070934 20:47898516-47898538 GCTGGAGGCCAAAGAGGAGCTGG + Intergenic
1174170431 20:48614745-48614767 GCTGGATGCCTCCAAGGCGCAGG - Intergenic
1174766096 20:53255399-53255421 GCTGGGTCCCCTGAAGGAGGAGG + Exonic
1174860424 20:54086271-54086293 GCTGGAGGACATGCAGGAGAAGG - Intergenic
1175391790 20:58632160-58632182 GCTCCATGCCAAGGAGGAGCAGG + Intergenic
1175756015 20:61530680-61530702 GTTTGATGCCATGAAGTAGATGG + Intronic
1175798066 20:61784919-61784941 GCTGGAGGCCAGGAAGGAGGAGG - Intronic
1175933386 20:62503862-62503884 CCTGGATGCCAGGATGGGGCTGG + Intergenic
1179944934 21:44666785-44666807 GCAGGATGCCTGGCAGGAGCTGG + Exonic
1179963354 21:44784703-44784725 GCTGGCTGCCATGAGCCAGCTGG + Intronic
1180230119 21:46422079-46422101 GCCGGAAGCCATGAAGGAGAAGG + Exonic
1181029572 22:20143264-20143286 GATGGATGCCATGATGGTCCTGG - Exonic
1181319599 22:21994382-21994404 GCTGGATTTCATCCAGGAGCTGG - Intergenic
1181461438 22:23088429-23088451 GCTGGGTGCCAAGGTGGAGCTGG + Intronic
1181513682 22:23400054-23400076 GATGGATGCCATGATGGTCCTGG + Intergenic
1182442810 22:30374012-30374034 GCTGGAGGAGCTGAAGGAGCGGG + Exonic
1182446311 22:30391674-30391696 GCTGGACCCAAGGAAGGAGCAGG - Intronic
1183083744 22:35474070-35474092 GCTGGATGCCAGCAGGGAGAGGG - Intergenic
1183364256 22:37398944-37398966 GCTGTGTTCCAGGAAGGAGCTGG - Intronic
1184296593 22:43529032-43529054 GCAGGCTGCCAGGAAGGGGCTGG + Intronic
1185054359 22:48570442-48570464 CCTGGATGCCAGGAAGAAGGAGG - Intronic
950493916 3:13322437-13322459 GCTGGAAGACATGCAGGGGCAGG - Intronic
954226154 3:49182694-49182716 ACTGGATGCCATGGAGCAGGGGG + Intronic
954660242 3:52223208-52223230 CCTGGTCGCCCTGAAGGAGCTGG - Exonic
955341944 3:58131669-58131691 GCTGAACCCCATGAAGGAGAAGG - Intronic
958492290 3:94792638-94792660 GCAGGATGACATCATGGAGCAGG - Intergenic
963469757 3:145725487-145725509 GCATGATGCCATGAAGAACCTGG + Intergenic
964137412 3:153360236-153360258 ACTGGATCCCTTGAAGGAACTGG - Intergenic
968095106 3:195923885-195923907 GCTGGACAACGTGAAGGAGCAGG - Intergenic
968471251 4:783424-783446 CCTGGATGCCAGGTGGGAGCTGG - Intergenic
968953672 4:3707478-3707500 CTTGGATGCCATGAAGATGCAGG + Intergenic
969276291 4:6137943-6137965 GCTGCAAGCCAGGAAGGAGAAGG - Intronic
969325842 4:6443394-6443416 GCGGGATGCCATGCAGACGCTGG + Intronic
969393606 4:6907056-6907078 CCTGGAAGCCCTGAAAGAGCAGG + Intergenic
969483679 4:7459956-7459978 CCTGGATGACATGAAGGACGTGG - Intronic
970927120 4:21465884-21465906 GCTGGAGCACATGAAGGACCAGG - Intronic
975322754 4:73026840-73026862 GTTGGATGCCACGAAGTAGGTGG - Intergenic
976389882 4:84497129-84497151 GCTGGACGACAGGGAGGAGCCGG + Intronic
976475862 4:85482414-85482436 GGTGGATTCCAAGGAGGAGCTGG + Intronic
976724916 4:88206438-88206460 GTTGGATGCCATGAAGTAGGTGG + Intronic
976796368 4:88938207-88938229 GCTTGAAGGCATGAAGGAACAGG - Exonic
982345675 4:154355206-154355228 ACAGGATGCCATAAAGAAGCAGG + Intronic
984421504 4:179528240-179528262 GTTGGATGCAAGAAAGGAGCAGG + Intergenic
985927216 5:3027677-3027699 GTTGGATGCCTTGAAGGAGGCGG + Intergenic
985961609 5:3307002-3307024 GCTGGAAGCCGTGGAGGAGTGGG - Intergenic
987381611 5:17290669-17290691 GATGGTTGCTAGGAAGGAGCTGG - Intergenic
988065764 5:26227910-26227932 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
990214529 5:53515422-53515444 GCTGATTGCCAGGAAGGAGATGG - Intergenic
990671088 5:58130784-58130806 GCTGGTGGGGATGAAGGAGCAGG - Intergenic
994692499 5:103035238-103035260 GCTGGCTGCCATGGGGGAGGCGG - Intergenic
998250509 5:140549033-140549055 GCTGGAGGAGCTGAAGGAGCAGG + Exonic
998384223 5:141747204-141747226 GCTGGATACCATCTAGGAGGTGG + Intergenic
1000260293 5:159581720-159581742 TCAGGATGCCATGAAGAAACAGG + Intergenic
1000386016 5:160675441-160675463 ACTGGATGCCATGGGGGAGCAGG + Intronic
1002051280 5:176573064-176573086 CCTGAATGGCAAGAAGGAGCTGG + Intronic
1003117265 6:3291282-3291304 GCTGGATGGCAGGAAGGAGGTGG - Intronic
1003350732 6:5315351-5315373 GCTGCATGCAAGGAAGGAGATGG - Intronic
1003505782 6:6739212-6739234 GGAGGTTGCCATGAAGGTGCAGG - Intergenic
1003850970 6:10222128-10222150 GTTAGATGCCATGAAGTAGGTGG - Intergenic
1003873798 6:10420312-10420334 GCTGGAAGCCATAGAGGAGTGGG - Intergenic
1004462276 6:15848751-15848773 CCTGGATGACAAGAAGGATCCGG - Intergenic
1005394495 6:25367420-25367442 GGTGGCTGCCATTGAGGAGCAGG + Intronic
1006117424 6:31782579-31782601 GCTGGTGGCGCTGAAGGAGCGGG - Exonic
1007111853 6:39317427-39317449 GCTGAACACCCTGAAGGAGCTGG - Intronic
1007717579 6:43866166-43866188 GCTGCCTGCCATGCAGGAGCAGG + Intergenic
1008164626 6:48120974-48120996 GCTGCCTTCCATGAAGGAGAAGG + Intergenic
1010181917 6:73096463-73096485 CCTGCAGGCCATGGAGGAGCTGG + Intronic
1010748761 6:79594583-79594605 GATGGAGGCTATGCAGGAGCTGG + Intergenic
1010915946 6:81619032-81619054 GCTGCATGGGATAAAGGAGCTGG + Intronic
1017545824 6:155450088-155450110 GCTGGTCGCCATGGAGGAGTGGG + Intronic
1018456751 6:163960364-163960386 CCTGGCTGGCATGGAGGAGCAGG + Intergenic
1018481469 6:164195220-164195242 GCTGGAAGCCATACAGCAGCAGG - Intergenic
1018530435 6:164757519-164757541 GCTGGCCACCATGGAGGAGCTGG + Intergenic
1019070336 6:169340424-169340446 GCTGGAGGCCTCGAAGCAGCAGG - Intergenic
1019315240 7:381104-381126 GCTGGATCCCCTGAGGCAGCAGG + Intergenic
1020036262 7:4964926-4964948 GCAGGAGGACAAGAAGGAGCAGG + Intergenic
1020096174 7:5370810-5370832 GGTGGAGGCCAAGGAGGAGCCGG - Exonic
1020255037 7:6498156-6498178 GCGCGAGGCCATGGAGGAGCTGG - Exonic
1020711192 7:11607698-11607720 GCTGAATTCCATGAAGGAATGGG - Intronic
1023156786 7:37259272-37259294 GCTGGAAGCCCTGAAGGACTTGG - Exonic
1024274420 7:47666428-47666450 GGTGGATGTCATGTAGGAGCTGG - Intergenic
1026625699 7:71990122-71990144 ACAGGATGCCATGAAGAAGCTGG + Intronic
1026800189 7:73395520-73395542 GCAGGATGCAATAAAGAAGCTGG - Intergenic
1027999742 7:85478760-85478782 ACAGGTTGCAATGAAGGAGCCGG + Intergenic
1029711233 7:102301102-102301124 GCTGGCTGCCAAGGTGGAGCTGG + Exonic
1032097742 7:128947823-128947845 GCTGGAGGCCACCCAGGAGCAGG + Exonic
1032340902 7:131072023-131072045 ACAGGATGCCATAAAGAAGCCGG + Intergenic
1032362830 7:131272099-131272121 GCTGGCAGCCAGGAAGGAGAAGG - Intronic
1034479905 7:151311556-151311578 GCCGGGTGCCTTGCAGGAGCAGG + Intergenic
1034825149 7:154255518-154255540 CCTGGAAGCCAGGAGGGAGCAGG + Intronic
1035017379 7:155778587-155778609 GCTGGATGGCCTGGAGGAGTGGG + Exonic
1036453932 8:8892431-8892453 GCTGGTGGCCCTGGAGGAGCTGG - Exonic
1037020843 8:13968382-13968404 TCTGGATGGAATGAAGAAGCAGG - Intergenic
1037685883 8:21139067-21139089 GGTGTTAGCCATGAAGGAGCTGG + Intergenic
1037951683 8:23022766-23022788 GCTGGATGCCTTGGAGACGCTGG - Exonic
1038495678 8:28000413-28000435 GGTGGATTCCATGACGGCGCAGG - Intergenic
1040888113 8:52287586-52287608 ACCGGTTGCCATGAAGGAGAAGG + Intronic
1044518989 8:93176218-93176240 GCTGGAGGCCACCAAGGAGCTGG + Intergenic
1045182783 8:99804212-99804234 GCAGGATGCCATGAGGCAGCAGG + Intronic
1048960457 8:139572667-139572689 GCTATATCCCATGAAGCAGCTGG + Intergenic
1048985349 8:139731997-139732019 GCTGGAGCCCACGAAGGAGACGG + Exonic
1049708922 8:144055040-144055062 CCTGGGTGCCATGCAGGAGACGG - Exonic
1049771581 8:144384709-144384731 GCTGCATGCCATGAAATAGAGGG - Intronic
1051687050 9:19668746-19668768 GGTGGAGGCCATGAAAGAGAAGG - Intronic
1055031681 9:71776506-71776528 GCTGGTTGCCTGGAAGGAACAGG - Intronic
1058752374 9:108051944-108051966 GCTAGGTGCCATGAAGAAGATGG + Intergenic
1058868139 9:109180279-109180301 GCTGGGGGCCAAGATGGAGCAGG - Intronic
1059336527 9:113572558-113572580 GCTGCAGGCCCTGAAGGAGGAGG + Intronic
1059342306 9:113604497-113604519 GCTGGAGGCCAAGAAAGAGGGGG + Intergenic
1059852989 9:118364361-118364383 GCTGGTTGCCATGGAGGGGTGGG - Intergenic
1060545694 9:124457856-124457878 GCTTGATGCCATGCAGGGGTGGG + Intronic
1061031606 9:128087656-128087678 GCTGGAGTCCATGAAGGAGGGGG - Intronic
1061223296 9:129265025-129265047 GCTGGATGAGATGGAGGAGCAGG - Intergenic
1062215832 9:135389351-135389373 GCAGAATGACATGCAGGAGCTGG + Intergenic
1062418619 9:136467201-136467223 GCTGGTTTCCAGGAAGAAGCTGG - Intronic
1062483670 9:136763798-136763820 GCTGGGTGCCATGAGTGAGCCGG - Intronic
1062486371 9:136778489-136778511 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486384 9:136778538-136778560 GCTGGAAACCCTGGAGGAGCCGG - Intergenic
1062486439 9:136778783-136778805 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486450 9:136778832-136778854 GCTGGAGACCCTGGAGGAGCCGG - Intergenic
1062486483 9:136778979-136779001 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486506 9:136779078-136779100 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486524 9:136779176-136779198 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486547 9:136779275-136779297 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062521130 9:136958467-136958489 GCTGGGTGCCAGGAAGGCGGTGG - Intergenic
1062605694 9:137347959-137347981 GCTGGCAGCCATGGATGAGCTGG + Intronic
1191636833 X:63387681-63387703 ACAGGTTGCCATGAAGAAGCTGG + Intergenic
1192223534 X:69213335-69213357 TCTGTATGACATGAAGGACCTGG + Intergenic
1192915669 X:75648897-75648919 GCTGAACACCAGGAAGGAGCTGG - Intergenic
1196818586 X:119685152-119685174 GCAGGATTCCATTAAGTAGCCGG + Intronic
1200115424 X:153767790-153767812 GCTGGGTGCCAGCATGGAGCAGG + Exonic