ID: 1173878087

View in Genome Browser
Species Human (GRCh38)
Location 20:46389158-46389180
Sequence ATCCAGCCGGGTCTCCATGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173878083_1173878087 -7 Left 1173878083 20:46389142-46389164 CCAGCTCCTTCATGGCATCCAGC 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG 0: 2
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173878087 Original CRISPR ATCCAGCCGGGTCTCCATGT TGG Exonic
902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG + Intergenic
913195869 1:116455424-116455446 AGGCAGCCAGGTCCCCATGTGGG - Intergenic
916641050 1:166729462-166729484 CTCCAGGCAGCTCTCCATGTTGG - Intergenic
920170594 1:204070082-204070104 CTCCATCCTGGTCTCCAGGTGGG - Intergenic
923663489 1:235979029-235979051 ATACAGCCGGGTCTGCTTGTGGG + Exonic
1068878040 10:62018538-62018560 ATATTGCCCGGTCTCCATGTTGG + Intronic
1068949118 10:62759899-62759921 TTCCAGCCAGGCCTCCCTGTTGG - Intergenic
1074085656 10:110207722-110207744 AGCCGGCCGGGTCTCCCTGGGGG + Exonic
1083609070 11:63996606-63996628 ATCCAGCAGTGCCTCCAAGTGGG - Exonic
1095928787 12:47605738-47605760 CCCCAGCAGGGACTCCATGTGGG + Intergenic
1104471986 12:129036711-129036733 GGCCAGTCTGGTCTCCATGTTGG - Intergenic
1114517276 14:23308150-23308172 AGCCAGCTGCGTCTCCAGGTAGG - Exonic
1121535112 14:94685836-94685858 ATCCAGCTGGGCCCCCCTGTAGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1125598579 15:40903085-40903107 CTCCAGCCGGGCCTGCTTGTAGG - Exonic
1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG + Exonic
1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG + Intronic
1132001797 15:98188001-98188023 ATCCAGCAGGGTGTCCCTTTGGG - Intergenic
1136392383 16:29973856-29973878 CTCCCGCCCGGTCTCCATCTTGG + Exonic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1141771212 16:86090679-86090701 ATCTACCGGGGGCTCCATGTGGG + Intergenic
1143852250 17:9821800-9821822 ATTCAGCGGGGGTTCCATGTGGG - Exonic
1144715996 17:17436318-17436340 ATGCAGCCGGGGCTGCTTGTGGG + Intergenic
1149204522 17:54228212-54228234 CTCCAGTAGGGACTCCATGTGGG - Intergenic
1151107003 17:71626589-71626611 ATGAAGGTGGGTCTCCATGTTGG + Intergenic
1151370510 17:73644082-73644104 CTCCAGGCTGGTCACCATGTGGG - Exonic
1152643350 17:81458108-81458130 AACCAGCCGGGTCTCTAGGATGG + Intronic
1154255951 18:12780925-12780947 ATACAGGCGGTCCTCCATGTTGG - Intergenic
1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161316287 19:3619089-3619111 CTCCAGCAGGTCCTCCATGTCGG + Exonic
1162019092 19:7860592-7860614 CTCCAGCTCGGTCTCCAGGTGGG - Exonic
1164596776 19:29535461-29535483 ATCCAGCCGGCTCTCTGTGGGGG - Intronic
925169451 2:1742106-1742128 ATCCAGCCAGGACTCCATTCTGG + Intronic
929090688 2:38214364-38214386 ATCCAGCTGGGGCTTCATCTGGG - Intergenic
929944605 2:46361009-46361031 ATCCAGGGGGATGTCCATGTGGG - Exonic
937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG + Intronic
945977102 2:216279581-216279603 TTCCATCCGGGTCTCCCTGTTGG - Intronic
948705417 2:239789341-239789363 ATACTGACGGGTCTCCCTGTGGG - Intronic
1170691879 20:18623718-18623740 GTCCAGCCGGGTCTCCTTTCAGG + Intronic
1172146785 20:32762832-32762854 ACCCAGCCGGGTCTCCAACCCGG - Intronic
1172419914 20:34807489-34807511 ATTCAGCAGGATTTCCATGTAGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175807747 20:61839268-61839290 ATCCCGCCGGGTGTGCATGGGGG + Intronic
1179320160 21:40283849-40283871 ATCCAGAGGGGTCCCCTTGTAGG + Intronic
1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG + Intronic
950910953 3:16591218-16591240 ATCCCGCCGTCTATCCATGTTGG - Intronic
953223970 3:40999485-40999507 ATCCAGCCAGCTCTCCCTGTGGG - Intergenic
956035724 3:65089226-65089248 TTCCAGCCAGGTCTTCCTGTTGG - Intergenic
958075162 3:88666882-88666904 ATCCAGGCAGTTCTCCATTTGGG + Intergenic
964926434 3:161963791-161963813 CCCCAGTGGGGTCTCCATGTGGG - Intergenic
972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG + Intronic
979758765 4:124374117-124374139 ATCCAGCTGGGGATCCAGGTTGG + Intergenic
998113168 5:139517651-139517673 ATCCAGCCTGGAGTCGATGTTGG + Intergenic
1003227976 6:4223585-4223607 CTCCAGGAGGGACTCCATGTGGG - Intergenic
1015658492 6:135546693-135546715 ATCCAGCAGGGAATCCAGGTGGG - Intergenic
1026727312 7:72879709-72879731 ATCCAGGCGGGTGTCCTTCTCGG - Exonic
1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG + Exonic
1027121838 7:75527720-75527742 ATCCAGGCGGGTGTCCTTCTGGG + Intergenic
1028121328 7:87059413-87059435 ATCCAGGCGGGGCTCCAGGGCGG + Exonic
1028850055 7:95527942-95527964 GGCCAGGGGGGTCTCCATGTGGG - Exonic
1028891544 7:95993384-95993406 ACCCAGCTGGGTCTCATTGTTGG - Intronic
1034445306 7:151111065-151111087 GTCCAGCAGGCTCTCCAAGTTGG - Intronic
1045763555 8:105639739-105639761 ATGAAGCCAGGCCTCCATGTTGG + Intronic
1051353209 9:16217775-16217797 TTCCAGCCGAGGCTCCATGCTGG - Intronic
1060046367 9:120344526-120344548 ATCCTCCCAGGACTCCATGTAGG + Intergenic
1203775519 EBV:71025-71047 ATCCAGCCATGTGTCCTTGTTGG + Intergenic
1192179551 X:68907940-68907962 AGCCAGCCGGGTCTCTCTGCAGG - Intergenic
1197414995 X:126164739-126164761 TTCCAGCCTGGACTCCATGCCGG - Exonic
1199766722 X:150946802-150946824 AACCAGCCTGGGCTCCAGGTGGG - Intergenic