ID: 1173878814

View in Genome Browser
Species Human (GRCh38)
Location 20:46395080-46395102
Sequence CAGAAAATGGGGAAGATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 397}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173878810_1173878814 -4 Left 1173878810 20:46395061-46395083 CCTCTGTGTGGGACGACATCAGA 0: 1
1: 1
2: 0
3: 7
4: 56
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397
1173878809_1173878814 -1 Left 1173878809 20:46395058-46395080 CCTCCTCTGTGTGGGACGACATC 0: 1
1: 1
2: 1
3: 3
4: 96
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397
1173878802_1173878814 29 Left 1173878802 20:46395028-46395050 CCCTTTCCCCTCAAAGGACACAA 0: 1
1: 0
2: 2
3: 212
4: 2350
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397
1173878804_1173878814 23 Left 1173878804 20:46395034-46395056 CCCCTCAAAGGACACAATGCAAA 0: 1
1: 1
2: 1
3: 19
4: 227
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397
1173878806_1173878814 21 Left 1173878806 20:46395036-46395058 CCTCAAAGGACACAATGCAAAGC 0: 1
1: 1
2: 1
3: 17
4: 187
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397
1173878801_1173878814 30 Left 1173878801 20:46395027-46395049 CCCCTTTCCCCTCAAAGGACACA 0: 1
1: 0
2: 2
3: 36
4: 368
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397
1173878803_1173878814 28 Left 1173878803 20:46395029-46395051 CCTTTCCCCTCAAAGGACACAAT 0: 1
1: 0
2: 2
3: 24
4: 410
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397
1173878805_1173878814 22 Left 1173878805 20:46395035-46395057 CCCTCAAAGGACACAATGCAAAG 0: 1
1: 1
2: 6
3: 171
4: 409
Right 1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG 0: 1
1: 1
2: 1
3: 23
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173878814 Original CRISPR CAGAAAATGGGGAAGATAAC TGG Intronic
900534324 1:3169539-3169561 CATAAAATGGAGATAATAACAGG + Intronic
901800556 1:11705666-11705688 AGAAAAATGGGGAAAATAACAGG + Intronic
901865722 1:12105426-12105448 GAGAAGGTGGGGAAGATAATTGG - Intronic
901899799 1:12350565-12350587 TAGAAAATGGGGAAGATCTTTGG + Intronic
902548544 1:17205650-17205672 CTCAAGATGGGGAAGAGAACTGG + Intronic
902634029 1:17723499-17723521 CAGAAGATGTGGAAGAAATCAGG - Intergenic
903559916 1:24219623-24219645 TAGAAATTAAGGAAGATAACCGG - Intergenic
904273262 1:29364094-29364116 CAGATGATTGGGAAGAAAACTGG + Intergenic
904834238 1:33324567-33324589 CAGAAAGAGGGGAAGAGAGCGGG + Exonic
906098868 1:43243201-43243223 CAGAAAAGGGGGAAGAGAGAGGG - Intronic
910202649 1:84715223-84715245 CAGAAACTGGTGAACATAGCTGG - Intergenic
910365567 1:86461432-86461454 AAGAAAATGAAGAAGATAAAAGG + Intergenic
910496892 1:87840017-87840039 CAAAAATTAGGGAAGATAGCTGG + Intergenic
910593727 1:88955640-88955662 CAGAAAATAGGCAAAATAAAGGG - Intronic
911357186 1:96836835-96836857 CAGGCTATGGGGAAGATGACAGG - Intergenic
911474253 1:98356954-98356976 TAGATAATGGGGAAAACAACTGG - Intergenic
911490378 1:98558058-98558080 CAGAAAATAGGAAAGAATACTGG + Intergenic
913955353 1:143285385-143285407 AACAAAATGGGGAAGATGAGTGG + Intergenic
913982078 1:143530059-143530081 AACAAAATGGGGAAGATGAGTGG - Intergenic
916744966 1:167678156-167678178 CAGAGAATAGGGAAGAGAAGAGG - Intronic
917294926 1:173508712-173508734 CAGGAACTGGGGAAGTGAACTGG - Intronic
918434373 1:184496104-184496126 TAGAAAAGGGGGCAGGTAACAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919859791 1:201731953-201731975 CAGAAAACAGGGAAGATCAGAGG - Intronic
920813367 1:209307707-209307729 CAGGGAGTGGGGAAGAGAACTGG + Intergenic
922453085 1:225752282-225752304 CAGAACAGGGGGAAGAAAATGGG - Intergenic
922572672 1:226643159-226643181 TAGACACTGGGGAAGGTAACAGG + Intronic
923693476 1:236221923-236221945 CAGATTATGGGGAAAATTACAGG - Exonic
923843247 1:237697290-237697312 CAGAAACTGGGTAGAATAACAGG - Intronic
924024599 1:239819081-239819103 CAGAAAGTTGAGAGGATAACTGG - Intronic
924485246 1:244476581-244476603 CGGAAAATGGAGATTATAACTGG - Intronic
924811833 1:247409756-247409778 CAGGAAAAGGAGAAGATAAATGG + Intergenic
1064225446 10:13479939-13479961 CAGATAATGGGGAACAGAAGGGG + Intronic
1065322582 10:24522989-24523011 TTGAAAATGGGAAAGATCACTGG + Intronic
1065601782 10:27376116-27376138 CACATAATGGCAAAGATAACAGG - Intergenic
1066951847 10:42126278-42126300 AACAAAATGGGGAAGATGAGTGG + Intergenic
1067148178 10:43708761-43708783 CAGAGACTGGGAAAGAAAACTGG + Intergenic
1069273598 10:66561983-66562005 CAGAGAAGAGAGAAGATAACAGG + Intronic
1071487920 10:86114985-86115007 GAGGAAATGGGGAAGATACATGG - Intronic
1071918092 10:90318881-90318903 CAGGAAATGGGAAAGAGAAGTGG + Intergenic
1073072265 10:100802191-100802213 CAGAGAATGGGGAAGAATACTGG + Intronic
1073593858 10:104781067-104781089 CAGAAAATGAGGAAAATCACTGG + Intronic
1073948856 10:108784206-108784228 GAGCAAAAGGGGAAGATAATTGG - Intergenic
1074283165 10:112072455-112072477 AGGAAGATGGTGAAGATAACTGG - Intergenic
1074896804 10:117784397-117784419 GAGAAAATGGGCAAAATAAAGGG - Intergenic
1075645970 10:124096403-124096425 GAGATAATGGGGAATATAACTGG + Intergenic
1078464237 11:11538690-11538712 CAGTAAATGGGGACCTTAACAGG + Intronic
1080141233 11:28922798-28922820 CAGATAAGGGGGAAGCAAACTGG - Intergenic
1080849252 11:36054123-36054145 CAGAAAATGGGGGGGAAACCTGG - Intronic
1080928410 11:36782649-36782671 CAGAAGAGGGGGAAGATGATAGG + Intergenic
1082193644 11:49276099-49276121 CAGAATATGGCCAAGAAAACTGG + Intergenic
1086528182 11:87753723-87753745 AAGAAAATGAGGAACATAAATGG - Intergenic
1086657685 11:89380261-89380283 CAGAAAATGTGGAGAAAAACAGG + Intronic
1086816945 11:91383630-91383652 TAGAAAAAGGGGAATTTAACAGG + Intergenic
1087552593 11:99670617-99670639 GAGAAAATGGTGAACATCACTGG - Intronic
1088263035 11:107962855-107962877 CAGAGAATGGGGAAAAAACCTGG - Exonic
1088840557 11:113624162-113624184 CTCAAAATGGGGAAGTTAATGGG - Intergenic
1088907685 11:114167062-114167084 AAGAGAATGGGGCAGAGAACAGG + Intronic
1089039891 11:115437322-115437344 GAGAAAACGGGGAAGACAGCTGG + Intronic
1090390832 11:126386245-126386267 CAGGAAATGGTGGAGATGACGGG - Intronic
1091815468 12:3434624-3434646 CAGAAAATGGAGCTGATGACAGG + Intronic
1092703970 12:11264238-11264260 AAGAAAACAGGGAAGAGAACAGG + Intergenic
1093044395 12:14426036-14426058 CAGAAAATGAGGAAGAGAATAGG - Intronic
1093601307 12:21027531-21027553 CAGAAAAGTGTCAAGATAACTGG + Intronic
1094091194 12:26652141-26652163 GAGAAACTGGGGAAGAGAAAAGG - Intronic
1095123913 12:38452170-38452192 GAGAAAATGGGGACAATAAAAGG + Intergenic
1095360891 12:41337431-41337453 CCAAAAATGGGGAAGATAAATGG + Intronic
1095607178 12:44083096-44083118 TATAAAATTGGGAAGAAAACTGG - Intronic
1096185517 12:49577969-49577991 CAGAGAATGGGGAAGACATATGG - Intronic
1097469990 12:59977546-59977568 CTGAAGATGTGGAAGCTAACTGG + Intergenic
1098540222 12:71647451-71647473 CAAAAAATGGAGAAAATATCTGG + Intronic
1099323870 12:81186533-81186555 CAAAAAATGGGCAAAATACCTGG + Intronic
1099564493 12:84225419-84225441 CAGAATATGGGGAGTATAATGGG + Intergenic
1099847672 12:88049185-88049207 TAGTAAATGGGGAAATTAACAGG + Exonic
1100399440 12:94215728-94215750 CATAAAATGTGTGAGATAACTGG + Intronic
1101091196 12:101287620-101287642 CAGAAAATGGGCAACCAAACAGG - Intronic
1102426893 12:112850761-112850783 CTGAAAATGGGGGTGCTAACTGG + Intronic
1102847715 12:116205128-116205150 CAGAAAATGGTGAACAAAAACGG + Intronic
1103398866 12:120628834-120628856 CAGAAAGTGGGGAAGCTATAAGG + Intergenic
1104075842 12:125388990-125389012 CAGAAAATATGGAAGAAAAGAGG - Intronic
1105233444 13:18522761-18522783 AACAAAATGGGGAAGATGAGTGG - Intergenic
1105416846 13:20220812-20220834 CAGGAAGTGGGGAAGATAAGGGG - Intergenic
1106488647 13:30195241-30195263 CTCAAAATGGAGATGATAACAGG - Intergenic
1107204136 13:37761502-37761524 AAAAAAGTGGGGAAGTTAACTGG - Intronic
1107221080 13:37981251-37981273 CTGTAAATGGGGAATATGACAGG + Intergenic
1107441452 13:40430959-40430981 CAGAAACTGGGTAAGAAAAAGGG + Intergenic
1108061263 13:46535683-46535705 CAGACAATGGGAAAGAGACCCGG + Intergenic
1108168621 13:47718548-47718570 AAGAAAAGGGGGAAGAAAGCAGG + Intergenic
1109848920 13:68035113-68035135 GAGAAAATGGGAAAAATAAAGGG + Intergenic
1110365460 13:74679954-74679976 CTGAAAATGGAGAAAATATCAGG - Intergenic
1110951521 13:81498701-81498723 CAGAATCTGGGAAGGATAACGGG + Intergenic
1111194315 13:84853264-84853286 CATAAAATGGTGTAGATAAAAGG - Intergenic
1116537820 14:46057724-46057746 GAGAAAAGGGGAAAGATAATGGG + Intergenic
1116766864 14:49083229-49083251 CAGAAAATGGGGAAAATGTCTGG - Intergenic
1117706752 14:58477874-58477896 GAAAAAATGGGGAAGAGAATGGG - Intronic
1117853576 14:60003063-60003085 CAGAAAATGGGAGACATTACTGG + Intronic
1119489453 14:75018195-75018217 GAGAACATGGAGAACATAACAGG - Intronic
1120706599 14:87752341-87752363 CACAAAATGAGGAAGAAACCTGG - Intergenic
1121842901 14:97149636-97149658 GAGAAAATGGAGAAGATCCCTGG + Intergenic
1122434294 14:101683210-101683232 AAGAAAATGGGGAAGGCACCAGG - Intergenic
1123166362 14:106329099-106329121 CATAAGATGGAGAAGACAACTGG + Intergenic
1123395323 15:19928980-19929002 AACAAAATGGGGAAGATGAGTGG - Intergenic
1123723620 15:23081472-23081494 CAGAAAATGGGGAAGAGAACTGG - Intergenic
1125387488 15:39153840-39153862 CAGAAAGTGGAGAAGAGAGCAGG + Intergenic
1126519874 15:49581011-49581033 CTGAAAATGGGGGAGAGAAAAGG + Intronic
1127220079 15:56870508-56870530 CAGTAAGTGGGGAAGATGTCAGG + Intronic
1127459052 15:59181206-59181228 CAGAATGTGGGGATGATAAAGGG - Intronic
1127593878 15:60457699-60457721 GAGAAAATGTGAAAGATAGCAGG - Intronic
1127602965 15:60556730-60556752 CAGAAAATGATGAAGAGAAAGGG - Intronic
1128179836 15:65592449-65592471 CAGAAAATGTAAAAGCTAACGGG + Intronic
1129949757 15:79575372-79575394 CAGATGAAGGGGAAGAGAACTGG - Intergenic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1131956359 15:97740355-97740377 TAGAGAATAGGGAAGATAAGGGG - Intergenic
1135282975 16:21169303-21169325 CAGAAAAAGGGGAAAAAAAAAGG - Intronic
1135935136 16:26773512-26773534 CAGAAAATGGCTGAGAGAACAGG + Intergenic
1136697647 16:32099884-32099906 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136701420 16:32147411-32147433 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136726777 16:32363829-32363851 CAGAGAATGAGGAAGATTAGGGG - Intergenic
1136766245 16:32780053-32780075 AACAAAATGGGGAAGATGAGTGG + Intergenic
1136769926 16:32827732-32827754 AACAAAATGGGGAAGATGAGTGG + Intergenic
1136798146 16:33043166-33043188 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136801853 16:33090325-33090347 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136845007 16:33569341-33569363 CAGAGAATGAGGAAGATTAAGGG - Intergenic
1136900657 16:34034243-34034265 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136936049 16:34465643-34465665 AACAAAATGGGGAAGATGAGTGG + Intergenic
1136940092 16:34515487-34515509 AACAAAATGGGGAAGATGAGTGG + Intergenic
1136945670 16:34648302-34648324 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136959727 16:34833079-34833101 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136963772 16:34882927-34882949 AACAAAATGGGGAAGATGAGTGG - Intergenic
1136967903 16:34937453-34937475 AACAAAATGGGGAAGATGAGTGG - Intergenic
1137088398 16:36158167-36158189 AACAAAATGGGGAAGATGAGTGG - Intergenic
1137092912 16:36217404-36217426 AACAAAATGGGGAAGATGAGTGG - Intergenic
1137220280 16:46442161-46442183 AACAAAATGGGGAAGATGAGTGG + Intergenic
1138000649 16:53275605-53275627 TAGAGAATGGAGAAGAAAACTGG - Intronic
1138218690 16:55229379-55229401 CAGAAAATGGGAAAGAAATATGG + Intergenic
1138877967 16:60976160-60976182 CAGAAAATGGGAGAGAATACAGG - Intergenic
1139392624 16:66614519-66614541 CTGAAAATGGGTAAGAAAGCTGG + Intergenic
1139561976 16:67748878-67748900 CAGACACTGGGGAAGCTACCTGG - Intronic
1139668109 16:68472430-68472452 CAGAAGATGGGAAAGACAGCTGG + Intergenic
1140702468 16:77593935-77593957 TATAAAATGGGGAAGGTATCTGG + Intergenic
1140754096 16:78051984-78052006 CAGAATAAGGGGAAGATCCCTGG + Intronic
1142305860 16:89285063-89285085 CAGAGAGTGGGGAGGATGACAGG - Exonic
1142351252 16:89581554-89581576 TAAAAAATGGGGAGGACAACAGG - Intronic
1202999657 16_KI270728v1_random:153929-153951 CAGAGAATGAGGAAGATTAGGGG + Intergenic
1203068631 16_KI270728v1_random:1042299-1042321 AACAAAATGGGGAAGATGAGTGG + Intergenic
1203072348 16_KI270728v1_random:1089836-1089858 AACAAAATGGGGAAGATGAGTGG + Intergenic
1203106715 16_KI270728v1_random:1417994-1418016 CAGAGAATGAGGAAGATTAAGGG - Intergenic
1203131255 16_KI270728v1_random:1690329-1690351 CAGAGAATGAGGAAGATTAGGGG + Intergenic
1203155175 16_KI270728v1_random:1869639-1869661 CAGAGAATGAGGAAGATTAAGGG - Intergenic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1145691950 17:26751397-26751419 AACAAAATGGGGAAGATGAGTGG - Intergenic
1146815873 17:35942114-35942136 CTGAAAATCTGTAAGATAACTGG + Intronic
1147817457 17:43220581-43220603 GAGCAGCTGGGGAAGATAACGGG - Intergenic
1148250868 17:46078782-46078804 GAGAAGGTGGGGAAGATAAGAGG + Intronic
1149168086 17:53778147-53778169 CAGAAAATATAGAAGATATCAGG - Intergenic
1149356683 17:55846329-55846351 CATAAAGTGGTGAAGAAAACAGG + Intergenic
1149575068 17:57706023-57706045 CAGAAACTGGGGAGAATGACGGG + Intergenic
1149886531 17:60345623-60345645 CAGAAGATGGGTAAGAAATCAGG + Intronic
1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG + Intergenic
1203183469 17_KI270729v1_random:88935-88957 AACAAAATGGGGAAGATGAGTGG - Intergenic
1155314601 18:24558766-24558788 CACAAAATGGGGAATATCAAGGG + Intergenic
1155724124 18:29057862-29057884 CTGAAAGTGGGGAAAATACCTGG - Intergenic
1155797353 18:30057286-30057308 TAGACAATCGGGAAAATAACTGG + Intergenic
1155930024 18:31697307-31697329 CAGCAAATGGAGAAGATGGCAGG + Intergenic
1156207548 18:34902933-34902955 CTGAAAATGGGACAGACAACAGG + Intergenic
1157410590 18:47459727-47459749 CAGAGAAGGGGGAAGTAAACTGG + Intergenic
1157909162 18:51598851-51598873 CAGAAGATGAGGAAGAAAACTGG + Intergenic
1158254439 18:55530199-55530221 CAAAAAATGGGGACTAAAACAGG + Intronic
1159249958 18:65862981-65863003 CACCAAATGGAGAAGATAATAGG - Intronic
1159457254 18:68675834-68675856 AAGACAATGGAGAAGGTAACTGG + Exonic
1159802093 18:72913819-72913841 CAGAAGCTGGGGAAGGTAATGGG - Intergenic
1160482847 18:79258618-79258640 TAGAAAATGAGGATGATAGCCGG + Intronic
1163993759 19:21023670-21023692 AAGAAAATGTGGTAGATAATTGG + Intronic
1163999628 19:21085190-21085212 AAGAAAATGTGGTAGATAATTGG + Intronic
1164027147 19:21362910-21362932 AAGAAAATGTGGTAGATAATTGG + Intronic
1164036881 19:21463508-21463530 CACAACCTGGGGAAGATGACGGG + Intronic
1164115028 19:22211772-22211794 AAGAAAATGTGGTAGATAATTGG - Intergenic
1164182987 19:22835696-22835718 AAGAAAATGTGGTAGATAATTGG + Intergenic
1164198837 19:22999931-22999953 AAGAAAATGTGGTAGATAATTGG - Intronic
1164296784 19:23917549-23917571 CAAAAAATGTGGTAGATAATTGG + Intronic
1164786118 19:30932482-30932504 CAGAGACTGGGGAAGAGAAGTGG + Intergenic
1164886567 19:31783526-31783548 AAGAAATTGGGAAAGACAACAGG - Intergenic
1165925448 19:39323341-39323363 CATAAAATGGGGATGGTAATAGG - Intergenic
1167714938 19:51137203-51137225 CAGAAAGTGGGGGAGACATCAGG - Intergenic
1202681936 1_KI270712v1_random:14253-14275 AACAAAATGGGGAAGATGAGTGG - Intergenic
925944320 2:8846658-8846680 TAGAAAGGGGGGAAGATCACTGG + Intergenic
926614988 2:14987964-14987986 CAGAAAATGGGAGAGAAAGCTGG - Intergenic
928744368 2:34394379-34394401 CAGAAAATGGAGAAAATAAGTGG + Intergenic
929742889 2:44622506-44622528 CAGACATTGGGGAATATAAGAGG - Intronic
929850715 2:45587526-45587548 CAGAAACTGGGGTAAAAAACAGG + Intronic
929982204 2:46692058-46692080 CTGAAAATGGTGAAGAGAAGTGG - Intergenic
930466420 2:51755828-51755850 GATAAAATGGTGAAGAGAACAGG - Intergenic
931152957 2:59595563-59595585 CAGAATATGGCAAAGGTAACGGG + Intergenic
933355202 2:81200790-81200812 CAGAGAGTGGGGAGGATGACAGG - Intergenic
933875035 2:86611601-86611623 GAGAAAATGGGGGGGAAAACCGG + Intronic
934249833 2:90340841-90340863 AACAAAATGGGGAAGATGAGTGG + Intergenic
934259740 2:91462605-91462627 AACAAAATGGGGAAGATGAGTGG - Intergenic
934303041 2:91794534-91794556 AACAAAATGGGGAAGATGAGTGG - Intergenic
934330219 2:92058222-92058244 AACAAAATGGGGAAGATGAGTGG + Intergenic
934468440 2:94288131-94288153 AACAAAATGGGGAAGATGAGTGG + Intergenic
935640852 2:105288558-105288580 CATAACATGGAGAATATAACAGG + Intronic
935710590 2:105894756-105894778 TATAAAATGGGGATGATAGCAGG - Intergenic
937400604 2:121580198-121580220 CTGAAATTAGGGAAGATCACTGG - Intronic
937439518 2:121904276-121904298 CAGAAAATGGGGATGTTAACAGG + Intergenic
937627329 2:124057790-124057812 TAGAAAATGGGGATGATTAATGG + Intronic
938519563 2:132053324-132053346 AACAAAATGAGGAAGATAAGTGG + Intergenic
938732726 2:134158825-134158847 CAGATAAAGGGGAAGAGAAGGGG - Intronic
938818805 2:134932368-134932390 CTGAAAATGGTTAACATAACCGG - Intronic
939582094 2:143962377-143962399 CAGGAAATGGCAAAGATAACTGG + Intronic
939717910 2:145608821-145608843 CAGAATTTGAGTAAGATAACAGG - Intergenic
939724935 2:145706754-145706776 CACAAAATGGGGAAGGTTAATGG - Intergenic
940630393 2:156230522-156230544 CTGAAAATGGGTAACATCACAGG + Intergenic
941180381 2:162252624-162252646 CAGAAAAATGGGAAGCTAAGGGG - Intergenic
941194723 2:162435080-162435102 CAGAAAATTGAGGAGATAATGGG - Intronic
941296307 2:163742830-163742852 CTGAAAATGAGGAAGACATCAGG + Intergenic
941331834 2:164186904-164186926 CATAAAATGGTGAAAATATCAGG - Intergenic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
942252953 2:174063352-174063374 CACAAAAATGGGAAGATAAAAGG + Intergenic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
943025120 2:182618039-182618061 CAGTAAATGAGAAAGAAAACAGG - Intergenic
943241770 2:185393622-185393644 CAGAAAATTGAGAATTTAACAGG - Intergenic
944400425 2:199319822-199319844 CATAAAAGGGAGAAGATAGCAGG + Intronic
944819765 2:203418675-203418697 CAGAAAATGGCAAAAATGACAGG - Intronic
945181325 2:207094450-207094472 CAGGAAATGGAAAAGAAAACTGG + Intronic
945924285 2:215787907-215787929 AAGAGAATGGGAAAGATAATTGG + Intergenic
945975193 2:216265002-216265024 AAGAAACAGGGGAAGATGACTGG + Intronic
946045998 2:216821454-216821476 CAAAAAATGGACAAGACAACTGG + Intergenic
946092951 2:217247046-217247068 ACGAAAATGGAGAAAATAACGGG + Intergenic
946104807 2:217359818-217359840 CAGAACATAGGGAAAATAAGAGG + Intronic
947121662 2:226822046-226822068 TAGAAAATTGGGAAGTTCACAGG - Intergenic
947357999 2:229317107-229317129 CAGGAAATGTGGACGTTAACTGG + Intergenic
947671561 2:231939888-231939910 CAGGAAATGGTCAAGAAAACAGG - Intergenic
947866053 2:233398510-233398532 GAGAAAATGGAGAAGATCAAAGG - Intronic
1169179726 20:3552955-3552977 CAGAATATGGCGAAGATGATAGG - Intronic
1173299293 20:41786871-41786893 CAGAAATTGGGGAAGGTAGAAGG - Intergenic
1173364133 20:42369741-42369763 GAGACAATGGGGAAGAGAAAAGG + Intronic
1173572678 20:44087687-44087709 CAGGATATGGGGAAGATAGGAGG - Intergenic
1173672251 20:44806848-44806870 CTGAAAATGGGGATGTTAACAGG + Intronic
1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG + Intronic
1174284144 20:49460374-49460396 AAAAAAAGGGGCAAGATAACAGG + Intronic
1175552137 20:59824451-59824473 CAGACTCTGGGGAAGATAAAAGG - Intronic
1176585445 21:8580220-8580242 AACAAAATGGGGAAGATGAGTGG - Intergenic
1176777428 21:13151040-13151062 AAGAAAATGGGGAAGATGAGTGG - Intergenic
1177679963 21:24354246-24354268 TAGAGAATTGGGAAGATAATAGG + Intergenic
1180268253 22:10557119-10557141 AACAAAATGGGGAAGATGAGTGG - Intergenic
1182358555 22:29733751-29733773 TAGAAAATGGGGCAGATTCCTGG + Intronic
1184875839 22:47274983-47275005 AAGAAAGGGGGGAAGAAAACAGG - Intergenic
1203237303 22_KI270732v1_random:17568-17590 AACAAAATGGGGAAGATGAGTGG - Intergenic
1203323346 22_KI270737v1_random:90526-90548 AACAAAATGGGGAAGATGAGTGG + Intergenic
949204688 3:1423796-1423818 CAGAACAGAGGGAAGATAATTGG + Intergenic
951478737 3:23136364-23136386 CAGAAAATGGGGTATAACACAGG - Intergenic
951673637 3:25212741-25212763 CAAAAAAAGTGGAAAATAACTGG - Intronic
953317763 3:41944516-41944538 CAGAGAAATGGGATGATAACTGG - Intronic
955147201 3:56331686-56331708 CTAAAAATGGGAAATATAACTGG + Intronic
955440892 3:58953988-58954010 GAGAAAATGGGGTAGTTGACGGG + Intronic
956587083 3:70876431-70876453 CATAAAATGAGGATAATAACAGG - Intergenic
957716661 3:83936894-83936916 CAGAAAATGATGAAGAAAATGGG + Intergenic
958951780 3:100424777-100424799 CAGAAAATGGTTAATATAGCAGG - Intronic
960707810 3:120497381-120497403 CAGAAAAGGGGGAAGGTGAGTGG - Intergenic
960935291 3:122896294-122896316 CAAAACAGGGGAAAGATAACTGG - Intergenic
961372143 3:126438016-126438038 CAGGAAATAGGGTAGAGAACAGG - Exonic
961422554 3:126817847-126817869 TAGAAAATGGGGAAGAAGAAGGG - Intronic
961925323 3:130473431-130473453 CAGAAAAGGGGGAAAAAAGCAGG - Intronic
961939052 3:130618308-130618330 CAGTAAATGGGGTTAATAACAGG + Intronic
962049924 3:131802357-131802379 CAGAAAAGGGTCAAGAAAACTGG + Intronic
962795149 3:138843510-138843532 CTGAAAATGGGGAAGACCCCAGG + Intergenic
963989072 3:151632370-151632392 GAGAAAATGAGGAAGAGAAAGGG + Intergenic
964241694 3:154601671-154601693 AAGATAATGGGGAAGAGACCTGG - Intergenic
964400666 3:156294643-156294665 CATAGAATAGGGAAGATAATTGG + Intronic
964565347 3:158044796-158044818 CAGAAAATGGAAAAGGTAAGTGG + Intergenic
964642055 3:158918948-158918970 CTTAAAATGGGGAAGGTTACTGG + Intergenic
964734165 3:159899355-159899377 CTAAAAATGGGGAAGAGAAGCGG - Intergenic
965950422 3:174301655-174301677 CAGAACAAGAGAAAGATAACTGG + Intergenic
965973942 3:174597525-174597547 CAGAAAATGGTTAACATAAAAGG - Intronic
966813451 3:183869061-183869083 GAGGAAAAGGGGAAGATACCGGG - Intronic
967020393 3:185517370-185517392 CAGTAAAGGGGGAAAACAACTGG - Intronic
967774850 3:193375740-193375762 CAGGAGATGGGAATGATAACAGG + Intronic
969353466 4:6611526-6611548 AAGAAAATGGAGAAGATACAGGG - Intronic
970366034 4:15359286-15359308 CAGAAAAAGGGAAAGACATCTGG + Intronic
970861162 4:20704101-20704123 GAGAAGATGGAGAAGATGACAGG + Intronic
971973413 4:33651311-33651333 GAGAACATGTAGAAGATAACTGG + Intergenic
972098478 4:35380713-35380735 AAAAAACTGGGGAAGATAAGTGG - Intergenic
972852514 4:43068582-43068604 AAAAAAATGAGAAAGATAACAGG - Intergenic
973228906 4:47819611-47819633 CCAAAAATGGGAAGGATAACGGG + Intronic
975860694 4:78673511-78673533 CAGAAAATGGGCAAGAGCAAAGG - Intergenic
977152586 4:93531518-93531540 AACAAAATGGGGAAGAAAAAAGG + Intronic
978552689 4:109944802-109944824 ATGAAAATGGGGAAGAAAATAGG - Intronic
979700345 4:123659489-123659511 CAGAATTGTGGGAAGATAACAGG + Intergenic
979734353 4:124064094-124064116 AAGAAAATTTGGTAGATAACAGG + Intergenic
981651268 4:147061653-147061675 GTGAAAATGAGGAAGGTAACAGG - Intergenic
982356993 4:154481725-154481747 CATAAAATAGGGATGATAATGGG - Intronic
985071792 4:186172868-186172890 TAGAAAATGGAGCAGAGAACAGG + Intergenic
985927991 5:3032886-3032908 AAGAAAATGGAGAAAATAACTGG + Intergenic
986281845 5:6330038-6330060 AAGACAATGGGGAAAATAACTGG + Intergenic
988031513 5:25769582-25769604 CAAAAAATGGGGGATTTAACTGG + Intergenic
989316442 5:40085236-40085258 TAGAAAGTGGGGAGGATAAAAGG + Intergenic
989333383 5:40286708-40286730 CATTAAATGGGCAAGAGAACTGG + Intergenic
990920291 5:60957265-60957287 AATAAAATAGGAAAGATAACTGG - Intronic
991640655 5:68748512-68748534 CCCAACATGGGGAAAATAACAGG - Intergenic
991713633 5:69431798-69431820 AAGAAAATGGGGAGGAAGACAGG - Intronic
992929843 5:81631987-81632009 TAGAAAATTGGGAAGATAGAGGG + Intronic
993297409 5:86159729-86159751 AAGAAAATAGGGATGGTAACAGG - Intergenic
994437170 5:99751661-99751683 TAATAAATGGTGAAGATAACTGG - Intergenic
994464727 5:100112032-100112054 CAGAAAATGGCCAAAATAAAGGG + Intergenic
994676720 5:102832341-102832363 AAGAAAATGGGGATATTAACTGG - Intronic
994975020 5:106791769-106791791 GAGAAAATGGGGAAGAAATGAGG - Intergenic
995021648 5:107373435-107373457 CACAAAATGGAGAGGATACCAGG + Intergenic
995648166 5:114337117-114337139 AAGAAAAAGGGGATGATCACTGG + Intergenic
997477358 5:134152050-134152072 CAGAGAATGAGTAAGAGAACTGG - Exonic
998770600 5:145540282-145540304 CATAATAAGGGGAAGATAAGAGG + Intronic
998932908 5:147200976-147200998 GAGAAAAAGGGAAAGATAATAGG - Intergenic
999282068 5:150372575-150372597 CAGCAGATGGGGAAGGGAACTGG - Intronic
999648824 5:153745989-153746011 TAGAAAATGGGGATAAGAACAGG - Intronic
1001543875 5:172558187-172558209 CTGAAAATGGGCACGATAATAGG - Intergenic
1003800084 6:9654296-9654318 AAGAAAAAGGGGAAGAGAAAAGG + Intronic
1004150141 6:13110695-13110717 CAGAAAACTGGGGAGATCACAGG + Intronic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1006525200 6:34598514-34598536 CAGAGTATGGGGAAGAGAATGGG + Intronic
1006668711 6:35716376-35716398 AACAAAATAGGGAAGACAACAGG + Intronic
1006995671 6:38257684-38257706 CAGAAAAGGGGGATAAGAACAGG - Intronic
1007369874 6:41419724-41419746 TGAAAAATGGGGAAAATAACAGG - Intergenic
1007987101 6:46217874-46217896 CAGAAAAAGGGGAACAGAGCAGG - Intergenic
1007989880 6:46244070-46244092 CATAAAATGGGGATAATAATAGG + Intronic
1008867700 6:56234262-56234284 CAGAAAATGTTGAATATAAAGGG + Intronic
1010388355 6:75308533-75308555 CACAAAATGGGAAAGACAAATGG + Exonic
1010388525 6:75310062-75310084 CAGAAAATAAGGAAGCAAACTGG - Intronic
1010987303 6:82439591-82439613 AAGAAAATGAGGAGGATAACTGG + Intergenic
1011586386 6:88930792-88930814 GAGAAGATGGGGCAGATTACAGG + Intronic
1011891236 6:92163037-92163059 AACAAAATGGGAAAGATACCTGG - Intergenic
1012036834 6:94152612-94152634 CAGAAAAAGGAGAAAATAAGGGG - Intergenic
1014599666 6:123395200-123395222 AAGAAAAAGGAGAAGATAAGAGG - Intronic
1014645982 6:123973369-123973391 AAGAAATGGGGAAAGATAACAGG + Intronic
1014725926 6:124971788-124971810 CAGAAACTTAGGAAGAAAACAGG - Intronic
1014817249 6:125949753-125949775 CAGAAAAAGGAGAAGCCAACAGG - Intergenic
1016282684 6:142436307-142436329 CAGCAAATTAGGAAGAAAACTGG + Intronic
1017153130 6:151298961-151298983 CAGAGAATGGGGAAGATATGAGG + Intronic
1017488071 6:154921145-154921167 AAGAGAATGGGGAAAGTAACTGG + Intronic
1018516255 6:164582910-164582932 CAGAAACTGAGTGAGATAACTGG - Intergenic
1019559781 7:1650304-1650326 CAGAAAATGGGGCAGCTACTGGG - Intergenic
1020153110 7:5698863-5698885 GAGAAAATGTGCAACATAACAGG - Intronic
1020442019 7:8227423-8227445 CTGAATGTGGGGAAGATAAATGG + Intronic
1020498993 7:8891347-8891369 TAGAAAATGGGAAAAATCACTGG - Intergenic
1020765622 7:12316550-12316572 CAGAAACTGGGGAAGGTAATGGG + Intergenic
1020999603 7:15312373-15312395 CAGAACAAGGGGAAAATAAAAGG + Intronic
1021357423 7:19668471-19668493 CAGAAAATGGTCACGAGAACTGG + Intergenic
1022088653 7:27093406-27093428 CAGGAAATGGGGAATATCATAGG + Exonic
1022356893 7:29624259-29624281 CAGAAAATTGAAAAGCTAACAGG + Intergenic
1022738088 7:33094666-33094688 TAGACATTGGGGAAGGTAACTGG + Intergenic
1022784707 7:33627011-33627033 AAGACAATGGGGAAGATGCCTGG + Intergenic
1023745019 7:43315124-43315146 CATAAGAGGGGGAAGATACCTGG + Intronic
1024721260 7:52139424-52139446 CAGAAAATAGGGGAGAAAATGGG + Intergenic
1025321214 7:58096018-58096040 AAGAAAATGGGGAAGATGAGTGG - Intergenic
1025488526 7:61081693-61081715 AACAAAATGGGGAAGATGAGTGG + Intergenic
1025551575 7:62256195-62256217 AACAAAATGGGGAAGATGAGTGG + Intergenic
1025747102 7:64252606-64252628 AAGAAAATGTGGTAGATAACTGG + Intronic
1025775825 7:64560066-64560088 CAGAAAATGTGGTAGGTAATTGG - Intronic
1025825023 7:65003917-65003939 AAGAAAATGTGGTAGATAATTGG - Intronic
1026572324 7:71542045-71542067 TACAAAATGGGGAATAAAACAGG + Intronic
1027792895 7:82655822-82655844 TAGAACATGGGAAAGATAAAAGG + Intergenic
1028257377 7:88616149-88616171 CAGAAAATTGGTAAAAAAACAGG - Intergenic
1030731525 7:112995538-112995560 TAGAAAATGGAGTAGATACCAGG - Intergenic
1031355641 7:120783450-120783472 CAGACAATGGGAAAGTTAAAGGG - Intergenic
1034714073 7:153223058-153223080 CAGAAATGTGTGAAGATAACTGG + Intergenic
1036674798 8:10821602-10821624 GGGAAAGTGGGGAAGAAAACTGG + Intronic
1036681119 8:10875087-10875109 GAGAAAATGTGGAAGATACAGGG + Intergenic
1037645159 8:20786566-20786588 CAGACTAGGGGGAAGATGACTGG + Intergenic
1040295981 8:46149313-46149335 CAGAAAAGTGGGGAGATCACAGG - Intergenic
1042034898 8:64522072-64522094 CAGAAAAGGGAAAAGATAAGAGG - Intergenic
1042370034 8:67981025-67981047 CAGCAAATGTGGTAAATAACAGG + Intronic
1042928569 8:73991469-73991491 CAGTAAATATGGAAGAAAACAGG - Exonic
1043476483 8:80610692-80610714 CAGATTATGGAGAAGAGAACTGG + Intergenic
1044475137 8:92617184-92617206 CAGAGAAGGTGGAAGAGAACAGG - Intergenic
1044929563 8:97238783-97238805 CAGAAAGGGGGAAAGATATCAGG + Intergenic
1045474977 8:102545019-102545041 TATAAAATGGGGATCATAACTGG + Intergenic
1045561771 8:103271173-103271195 AAGATAATGGGGAAAAGAACTGG + Intergenic
1045738374 8:105321768-105321790 GAGATAATGGGAAAGATAAGCGG + Intronic
1045903138 8:107309118-107309140 CAGAAAATGGGTAAGAGAAAGGG - Intronic
1046302955 8:112321995-112322017 GAGAAAATGGAGAAGATAGGGGG + Intronic
1047624170 8:126639064-126639086 CTGCAAATGGGGAAGATTATAGG + Intergenic
1050364528 9:4862037-4862059 AAGAAAAATGGGAAGAAAACAGG - Intronic
1050789529 9:9448658-9448680 CACATAATAGGGAAGAAAACAGG + Intronic
1050940070 9:11447559-11447581 CATAAAAAGAGGAAGAAAACTGG - Intergenic
1051612088 9:18971001-18971023 CAGGTAATGGGGAGGATAAATGG + Intronic
1052351437 9:27462860-27462882 CACAAAATGGGCAAGAAGACTGG + Intronic
1052540140 9:29800746-29800768 GAAAAAATGGGGAGGAAAACAGG - Intergenic
1052610261 9:30762954-30762976 CAGAAAATGTGCAAGATAAATGG - Intergenic
1052712474 9:32073901-32073923 CAGGAAATGGGAAAGACAAGGGG - Intergenic
1053564172 9:39230638-39230660 CACAAAGTGGGGAAGAGAGCTGG + Intronic
1053698843 9:40666156-40666178 AACAAAATGGGGAAGATGAGTGG + Intergenic
1053829959 9:42068509-42068531 CACAAAGTGGGGAAGAGAGCTGG + Intronic
1054132976 9:61388396-61388418 CACAAAGTGGGGAAGAGAGCTGG - Intergenic
1054310132 9:63465557-63465579 AACAAAATGGGGAAGATGAGTGG + Intergenic
1054408920 9:64789709-64789731 AACAAAATGGGGAAGATGAGTGG + Intergenic
1054442078 9:65273523-65273545 AACAAAATGGGGAAGATGAGTGG + Intergenic
1054488204 9:65747974-65747996 AACAAAATGGGGAAGATGAGTGG - Intergenic
1054600597 9:67118944-67118966 CACAAAGTGGGGAAGAGAGCTGG - Intergenic
1054855377 9:69893528-69893550 ATGAAAATGGGGAAGACAATAGG - Intronic
1058893757 9:109382691-109382713 CAGCAAATGGAGGAGATCACTGG - Intronic
1061338858 9:129962522-129962544 CAGAAAATGGAGCTGACAACTGG + Intronic
1061373584 9:130211535-130211557 CAGAAGATGTGGAAGAAATCAGG + Intronic
1062525217 9:136975536-136975558 TAGAAAATGGGGAAGAGGAGGGG + Intergenic
1202781209 9_KI270717v1_random:39363-39385 AACAAAATGGGGAAGATGAGTGG + Intergenic
1203615346 Un_KI270749v1:57743-57765 AACAAAATGGGGAAGATGAGTGG - Intergenic
1185855601 X:3532049-3532071 CAGAAAAAGGGGTAAATAAATGG - Intergenic
1185942094 X:4333222-4333244 CAGGAAATGGGCAAGATCAAGGG + Intergenic
1186209831 X:7238522-7238544 CAGAGAAGGGGGAAAATAAGGGG + Intronic
1187216865 X:17285711-17285733 CAGCCAATGGGGAAGATTAAAGG - Intergenic
1187576847 X:20565877-20565899 CTGAAGATGGGGAAGTGAACAGG + Intergenic
1188061003 X:25601972-25601994 CAGACACTGGGGAATACAACAGG - Intergenic
1188906191 X:35794830-35794852 AATAAAATTGGGAAGAAAACAGG - Intergenic
1193203896 X:78725375-78725397 AAGAAAATGTGCAAGAAAACTGG - Intergenic
1195211763 X:102656837-102656859 CTGAAGATGAGGTAGATAACAGG + Exonic
1195626459 X:107009396-107009418 CAGAAAATGAAGAAAATAAGGGG + Intergenic
1195752530 X:108172818-108172840 CAGAAAATGCAGAAGATGACAGG + Intronic
1196188439 X:112770038-112770060 CAGAGGATGGGGAAGGTAAGAGG + Intergenic
1196586263 X:117432456-117432478 CAGTAACTGGGGAAGACATCAGG - Intergenic
1196934275 X:120714088-120714110 CAGAAAATGGGGAAGGCAGAAGG - Intergenic
1198367860 X:135960148-135960170 CAGAAAATGTGAAAGAAAATAGG - Intergenic
1198578632 X:138037876-138037898 GAGAAAGTAGGGAAGAGAACAGG + Intergenic
1198614648 X:138443143-138443165 CAAAAAATGGGGTACATAACAGG + Intergenic
1199040323 X:143107583-143107605 CAGAAGATGTGAAATATAACTGG + Intergenic
1201575862 Y:15460862-15460884 CAGAAAATGAGGAAGAAAGGAGG - Intergenic