ID: 1173881660

View in Genome Browser
Species Human (GRCh38)
Location 20:46418223-46418245
Sequence ATCTGAACACAGTTGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173881660 Original CRISPR ATCTGAACACAGTTGGAACA CGG (reversed) Intronic
903823575 1:26124145-26124167 CTCTGAACACATTTGAAACAGGG - Exonic
904305128 1:29583950-29583972 CTCTGAACGCAGTGGAAACAGGG + Intergenic
904911856 1:33940310-33940332 ATATGACCTCATTTGGAACAGGG - Intronic
909821978 1:80076530-80076552 ATCTGAATATAATTGAAACAAGG + Intergenic
910279075 1:85478748-85478770 ATCTGAACACTATTGCAATAAGG - Intronic
912655476 1:111482768-111482790 GTCTGAGCAGAGTTGGAACAGGG - Intergenic
912927422 1:113925649-113925671 AACTGACAACATTTGGAACATGG + Intergenic
912943234 1:114063354-114063376 ATTGGAATACAGCTGGAACAGGG + Intergenic
916291489 1:163171422-163171444 AACTGAAAACAGTTGCAGCATGG - Intronic
916712854 1:167427321-167427343 ATGTGAAAACACTTGGAAGATGG - Exonic
918188555 1:182149232-182149254 ATCAGAACAAAGTTGGACCTCGG - Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
922116048 1:222616010-222616032 GTCTGAAGACAGCTGGGACAAGG + Intergenic
923085029 1:230696740-230696762 ATGTGAACACATTTGGAAAAGGG - Intergenic
1064617424 10:17175352-17175374 ATCTGAAAACATTTTGAAAATGG - Intronic
1064683597 10:17836174-17836196 ATCTGAAAATAGCTGGAAAAAGG - Intronic
1066596729 10:37059216-37059238 ATGTGAGCACAGTTAGAAAAGGG + Intergenic
1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG + Intronic
1072989682 10:100180171-100180193 ATCTGAACAAAGGTGTGACAAGG - Intronic
1073628036 10:105119546-105119568 CTGTGAAAACAGTTGGAACGGGG + Intronic
1074094413 10:110297247-110297269 ATATAAACTCAGTTGGGACAAGG + Intronic
1074123793 10:110512483-110512505 CTCTGAACACAGTTGGGGAAAGG - Intergenic
1074477288 10:113784665-113784687 ATCTGACTGCAGGTGGAACAGGG + Intergenic
1074705767 10:116128871-116128893 CTTTGTACAAAGTTGGAACAGGG + Intronic
1076990718 11:272100-272122 ACCTGGACACAGCTGCAACATGG - Intergenic
1079588839 11:22157836-22157858 ACCTGAACACAGTAGTGACATGG + Intergenic
1079763749 11:24363471-24363493 ATCTTAACCCAGTTAGAAAATGG + Intergenic
1083066427 11:59928726-59928748 ATCTGAACATAGTGTGACCATGG - Intergenic
1083638340 11:64132299-64132321 ATCTGAAAACAGGTGGAGAAAGG - Intronic
1087003877 11:93449781-93449803 ATCTGAACAGAGCTATAACAAGG - Intergenic
1089069291 11:115687060-115687082 ATCTAATCACTGTGGGAACAAGG - Intergenic
1091837900 12:3598741-3598763 TTCTGGACCCAGTTGGAACCAGG + Intergenic
1092942641 12:13424677-13424699 ATCAGAGCAGAGTTGGGACAGGG + Intergenic
1093674947 12:21927716-21927738 GTCTGTAGACATTTGGAACATGG + Intronic
1096578326 12:52568754-52568776 ATCTGATCACAGTGGGACCGTGG - Intronic
1098722179 12:73914118-73914140 ATCTACACACAGTTAGAATAAGG + Intergenic
1099338485 12:81396076-81396098 ATCTCAACAGAGTTGAAAAATGG + Intronic
1101501034 12:105303841-105303863 ATCTGAACATAGTGTGACCATGG + Intronic
1102128355 12:110504009-110504031 ATCTGAATACACTTAGAGCATGG + Intronic
1103234275 12:119359355-119359377 ATCTGTACATTCTTGGAACATGG + Intronic
1105668192 13:22584080-22584102 ATTTGAAAACAATGGGAACAAGG - Intergenic
1107366040 13:39677512-39677534 ATCAGAAGTCAGTTGGAACTTGG - Exonic
1108416825 13:50206088-50206110 AGCTGAACAAATTTGAAACACGG - Intronic
1111883331 13:93986407-93986429 ATCTGAACAAAGATGAAGCAGGG + Intronic
1111883368 13:93987233-93987255 ACCAGAACATTGTTGGAACATGG + Intronic
1111914891 13:94350710-94350732 TTCTGCACACAGCTGGAAGATGG - Intronic
1114656288 14:24317554-24317576 GTCAGAACAGAGTTGGACCAAGG - Exonic
1117984157 14:61370923-61370945 AGCTGGAGACAGTTGGGACAGGG + Intronic
1119247523 14:73125310-73125332 TTCTGAAAACAGTTGCAACTAGG + Intergenic
1121048864 14:90806988-90807010 ATCTGAACCCAGGTCTAACAGGG + Intronic
1126163900 15:45637600-45637622 ATATAAACACATTTGGAACGGGG + Intronic
1126657640 15:50996471-50996493 ATCTGTTCAGAGTTGGAAGAAGG + Intronic
1127334555 15:57970876-57970898 TTCCCAACACAGTTGGAACCAGG - Intronic
1131769671 15:95722580-95722602 ATCTGAAACCAGTTAGATCATGG + Intergenic
1136688842 16:32013290-32013312 ATCTGAACAGACTTACAACATGG + Intergenic
1136789437 16:32956801-32956823 ATCTGAACAGACTTACAACATGG + Intergenic
1136880375 16:33897129-33897151 ATCTGAACAGACTTACAACATGG - Intergenic
1138319467 16:56099605-56099627 ATCACAACACAGTAGGACCAGGG + Intergenic
1138368714 16:56506308-56506330 ATTTTAACATAGTTGTAACAAGG - Intronic
1141848176 16:86625490-86625512 TTCTGATCTCAGTTGGAAAAGGG - Intergenic
1142132657 16:88437990-88438012 CTCCGAACACAGGTGGAGCAGGG - Exonic
1203091637 16_KI270728v1_random:1218275-1218297 ATCTGAACAGACTTACAACATGG + Intergenic
1147151694 17:38519451-38519473 ATCTGAACAGACTTACAACATGG + Intergenic
1148846188 17:50531567-50531589 ATCTGAGGGCAGGTGGAACATGG - Intergenic
1151043076 17:70886748-70886770 ATCTCAACACTATTGAAACATGG - Intergenic
1151224273 17:72637037-72637059 ATCTGGACACAGTTTTAACTGGG - Intergenic
1155493226 18:26419831-26419853 TTCTGAACACTTTTTGAACAAGG + Intergenic
1155840662 18:30638460-30638482 ATCTGAACACGGGTGCAATATGG - Intergenic
1156312483 18:35937483-35937505 ATTTGCACACAGTTTAAACAAGG + Intergenic
1158724027 18:59952014-59952036 ATCTGAATACAGGAGAAACATGG - Intergenic
1160628253 18:80228172-80228194 CTCTGAGCACAGCTGGAAAAGGG + Intronic
1162582065 19:11537558-11537580 ATATGTACAGAGTTGGAACATGG + Intergenic
1163739148 19:18999999-19000021 AACTTAAGACAGTTGGACCAGGG - Intronic
1164284673 19:23803187-23803209 ATCTGATCAGGGTTGGGACAGGG - Intronic
1164441092 19:28281581-28281603 AGCAGAACACAGTGGGAAGAAGG - Intergenic
1164525829 19:29012859-29012881 ATGTGAACACATTTGGAAATAGG - Intergenic
1165485238 19:36091454-36091476 ATCTGGAGACAGGTGGGACATGG + Exonic
1166963132 19:46511740-46511762 ATTTGAACACAGTTTGAATTAGG - Intronic
1167209245 19:48122778-48122800 GTCTGAACTCAGTTGCAGCAGGG + Intronic
1167776257 19:51559527-51559549 ATCTGAACCTAGTTGGAAGCTGG + Intergenic
926462207 2:13144991-13145013 ATCTGAGAACAGGTGAAACAAGG - Intergenic
927688103 2:25186916-25186938 AGCTGTAGATAGTTGGAACATGG - Intergenic
929210999 2:39357033-39357055 ATTATAACACAGTTGGAACAAGG - Intronic
930178413 2:48324833-48324855 ATGTAAATGCAGTTGGAACACGG + Intronic
930414514 2:51074477-51074499 ATCTGTACACAGATGAAAAAAGG - Intergenic
934886381 2:98029154-98029176 AACTCAACACTGTTTGAACACGG + Intergenic
937227855 2:120379867-120379889 ATATGAACACACATGCAACAGGG - Intergenic
939536165 2:143431956-143431978 ATCTGAAGTCAGTTGGAAGCTGG + Intronic
939841907 2:147199336-147199358 ATCTGAATACAATTAGAACCTGG + Intergenic
944418794 2:199506362-199506384 TTTTAAACACAGTTGTAACATGG - Intergenic
945098636 2:206242969-206242991 ATTTGTACACACTGGGAACAGGG + Intergenic
946668444 2:222075953-222075975 ATTTAAATACAGTTGGAAAAGGG - Intergenic
946984343 2:225255526-225255548 ATTTGAACAGAGCTGGAACTAGG + Intergenic
948371206 2:237490090-237490112 ATCTAAACAGAAATGGAACAAGG + Intronic
948763043 2:240204402-240204424 AATTGAACAGAGCTGGAACAGGG + Intergenic
1169149850 20:3280865-3280887 ATCTCAGCACACTTGGAAGATGG - Intronic
1172883408 20:38216249-38216271 AACTGTACACAGCTGGAACTGGG + Intronic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1174499236 20:50972123-50972145 ATGTAAATCCAGTTGGAACAGGG + Intergenic
1174753262 20:53133168-53133190 AACTGAAGCCAGTTGGAAGAAGG - Intronic
1175764016 20:61580811-61580833 ACGTGAACACAGTTGGGACTGGG - Intronic
1177321135 21:19522348-19522370 CTCTGAAATCACTTGGAACATGG + Intergenic
1180696638 22:17755344-17755366 ATGTGAACACACATGGACCATGG + Intronic
1181510821 22:23388065-23388087 ATCTGGACACTGTGGCAACATGG + Intergenic
1181949879 22:26546248-26546270 ATCTAAACCCAGATGGAAAAGGG + Intronic
1184308544 22:43625874-43625896 ATCTGCACAGAGTTGGTGCACGG + Intronic
950030260 3:9847328-9847350 ATGTGACCACAGTGGGAAGATGG + Intronic
951594111 3:24298626-24298648 ATCTGTACAGAGTTGTTACAAGG - Intronic
953855446 3:46496260-46496282 ATGTGACCACATTTGGAAAAAGG - Intergenic
956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG + Intronic
957683247 3:83467163-83467185 ATCAGAACACAGTAGGACAATGG - Intergenic
959192681 3:103135154-103135176 ATGTGAATACATTGGGAACAAGG + Intergenic
961250110 3:125495165-125495187 ATCTGATCACAGTTGAAAGCTGG - Intronic
961530714 3:127538340-127538362 CTCTGAAAACAGTTTGACCAGGG + Intergenic
965208909 3:165759197-165759219 TTCTGAACCCAGTTGGGTCAGGG - Intergenic
967541175 3:190669252-190669274 ATCTGAGCAGAGTTGTAACATGG + Intergenic
967915235 3:194573552-194573574 ATCTGAACAGAGTGGGGACTGGG + Intergenic
967993410 3:195148747-195148769 GTCTGAAATCAGTTGGTACAAGG - Intronic
968771885 4:2512721-2512743 ATCTGGATACAGTTGGAACTGGG + Intronic
969875515 4:10133158-10133180 ATCGGGTCACATTTGGAACAAGG - Intergenic
971562421 4:28097198-28097220 ATTTGAAAACTGTTGGATCAAGG + Intergenic
972442424 4:39107626-39107648 ATCTGAACACAGTGGAAAGATGG + Exonic
972710758 4:41592135-41592157 CTCTGACTACAGTTGGATCAAGG - Intronic
973703162 4:53556050-53556072 ATGTGACCATATTTGGAACAAGG + Intronic
975442446 4:74427144-74427166 ATCTGAACACATTTCTAAGAAGG - Intergenic
975825399 4:78314556-78314578 TTCTAAACACAGTAGAAACACGG - Intronic
975922367 4:79407495-79407517 AACTGAAGACATTTGGAAGAAGG + Exonic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
982449108 4:155531201-155531223 ATCTGAGCACAGCTGCAACTTGG + Intergenic
983472793 4:168177047-168177069 CTCTTAACATAGTTGGAGCAAGG + Intronic
989438295 5:41440033-41440055 ATTCGCACACAGGTGGAACATGG + Intronic
990306552 5:54499223-54499245 ATCTGAACACAGTGTGGCCATGG + Intergenic
990699105 5:58456626-58456648 ATCTTAACAAGGTAGGAACAGGG + Intronic
993997530 5:94740711-94740733 CTCTGCACACAGTTGGCACTCGG - Intronic
995421739 5:111975302-111975324 ACCTGGAAACATTTGGAACAAGG + Exonic
995592652 5:113715560-113715582 AGCTGAACATAGTTGGGCCATGG - Intergenic
999786604 5:154896238-154896260 CTCTTACCACACTTGGAACACGG - Exonic
1000019092 5:157303539-157303561 ATGTGAACACCCTTGGAAGATGG - Intronic
1000952211 5:167498382-167498404 ATCTGAGCATAGTAGGCACAGGG - Intronic
1002064280 5:176644306-176644328 GGCTGAACCCAGTTGGAACCAGG + Intronic
1003537024 6:6984429-6984451 ATCTGTCCGCAGTTGGATCATGG - Intergenic
1004091414 6:12506170-12506192 ATTTGTACACATTTTGAACAAGG + Intergenic
1004460470 6:15830494-15830516 TTCTGAACAAATTTGGAACATGG + Intergenic
1005198814 6:23319622-23319644 CTGTGAACAAATTTGGAACATGG - Intergenic
1007164801 6:39821701-39821723 ATCTGAACATAGCTGGAGCCTGG + Intronic
1009281918 6:61763110-61763132 ATGTGATCTCAGTTAGAACAAGG + Intronic
1010514737 6:76759577-76759599 AACTGAAGACTGATGGAACAAGG - Intergenic
1011856235 6:91694935-91694957 CTCTGATCCCAGCTGGAACAAGG - Intergenic
1013357249 6:109356904-109356926 AACAGAACACAGATGGAACTTGG + Intergenic
1014787922 6:125639186-125639208 AGTTGAAGACAGTTGGAACCAGG - Intergenic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG + Intergenic
1016373270 6:143395740-143395762 ATCTGAAAACTATTGGAAGAGGG - Intergenic
1016775679 6:147902203-147902225 AAATGAACACAGTTTTAACAAGG - Intergenic
1019013266 6:168860492-168860514 ATTTAAACACAGTTTGAACCGGG - Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023248919 7:38236813-38236835 ATCTGAACAGCATTGGAGCAAGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026414870 7:70169021-70169043 ATCTAAACACATTTGAAAAATGG - Intronic
1027636295 7:80679392-80679414 ATCTGGGAACAGTTGGAAAAAGG - Intergenic
1028628282 7:92903119-92903141 ATCTGAACAAAGTTCAAAAACGG + Intergenic
1029565101 7:101331584-101331606 ATATGAAGACACTTGGCACATGG + Intergenic
1031558081 7:123203014-123203036 ATTTGAATACAGTTGGCTCAAGG - Intergenic
1033156764 7:138963431-138963453 AACTGAACACAATTGGAAGAGGG + Intronic
1033451195 7:141463673-141463695 ATCTGAGCAGAGCTGGAAGAAGG + Intronic
1035031027 7:155860810-155860832 ATCTGAACACAGCTGTACCTAGG + Intergenic
1037829459 8:22179224-22179246 ATCTGAAAGCACCTGGAACAAGG - Intronic
1039531197 8:38264603-38264625 ATCTGAAGAGAGTGGAAACAAGG + Exonic
1039928678 8:41962412-41962434 GCCAGAACACAGTTGGAAGACGG - Intronic
1042144566 8:65714559-65714581 ATCTGCATACATTTGAAACACGG - Intronic
1042558959 8:70058210-70058232 ACCTGCACAGATTTGGAACAAGG + Intronic
1042859899 8:73301881-73301903 ATCAGAACACATGTGGGACAGGG - Intronic
1044590935 8:93914178-93914200 ATCTGAAAACAATTTGAAAAGGG + Intronic
1046960162 8:120103104-120103126 CTCTGAACACTCTTGGGACAAGG - Intronic
1047085038 8:121506675-121506697 ATTTTAAAACAATTGGAACAGGG + Intergenic
1048210401 8:132449939-132449961 CTCTGGACACAGTGGGAAGAGGG - Intronic
1048715344 8:137262654-137262676 ATCTGAAAGCAGTTGGAAAATGG + Intergenic
1051909695 9:22139134-22139156 ATTTGAACACAGTGGGAAGATGG + Intergenic
1052788783 9:32854786-32854808 TCCAGAACACAGTTGGCACAAGG - Intergenic
1055262720 9:74457377-74457399 ATCTAAACACAAATTGAACAGGG + Intergenic
1057559086 9:96113336-96113358 ATCTGCACACAGTGGGAAACAGG + Intronic
1058402894 9:104637449-104637471 AGCTGAATACAGTAGCAACAAGG - Intergenic
1058738236 9:107916719-107916741 AGCTGAAAAAAGTTGGAAAATGG + Intergenic
1185543100 X:919972-919994 ATCTGAACAAAGTTGAAACTTGG - Intergenic
1187071694 X:15894615-15894637 AACTGAAGACAGTGGGAACAGGG + Intergenic
1197354993 X:125428031-125428053 TTCTGAACAATCTTGGAACATGG + Intergenic
1198426513 X:136526128-136526150 CTGTGCACAGAGTTGGAACATGG + Intergenic
1198864865 X:141111316-141111338 GTCTGAACACAGACAGAACATGG - Intergenic
1198897822 X:141476075-141476097 GTCTGAACACAGACAGAACATGG + Intergenic
1199826494 X:151505454-151505476 GTCTGAATACATTTGTAACAGGG - Intergenic