ID: 1173882103

View in Genome Browser
Species Human (GRCh38)
Location 20:46423233-46423255
Sequence ACCTCAGAGAAACCAGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 4, 3: 18, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173882097_1173882103 19 Left 1173882097 20:46423191-46423213 CCTTTGGCAAGTTTGTATGCCAA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG 0: 1
1: 1
2: 4
3: 18
4: 245
1173882102_1173882103 -6 Left 1173882102 20:46423216-46423238 CCTCACTGGGGAGTGCAACCTCA 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG 0: 1
1: 1
2: 4
3: 18
4: 245
1173882101_1173882103 0 Left 1173882101 20:46423210-46423232 CCAACACCTCACTGGGGAGTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG 0: 1
1: 1
2: 4
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173882103 Original CRISPR ACCTCAGAGAAACCAGATTG AGG Intronic
901346606 1:8549831-8549853 ACTTCAGAAAAGCCAAATTGAGG + Intronic
903702097 1:25256826-25256848 ACTCCAGAGAAATCAGATTTAGG - Intronic
905033175 1:34901038-34901060 ACCCCAGAGAAACAAGTCTGGGG + Intronic
906809502 1:48811703-48811725 ACCTCACAGAAACCAGAGTTGGG - Intronic
906902090 1:49845968-49845990 ACATCAGCGAAACCACACTGAGG + Intronic
911064718 1:93777783-93777805 ACCTCAGGGTAACCAAATAGTGG - Intronic
911588066 1:99714137-99714159 ACATTAGAGAAACTAGTTTGAGG + Intronic
913372517 1:118116685-118116707 ACCTCATAGAGATCACATTGGGG + Intronic
916187381 1:162146277-162146299 ACCTCAGAGGAGGCAGATTTAGG - Intronic
916232331 1:162552849-162552871 ACATCTGAGAAACCATCTTGTGG + Intergenic
917045616 1:170856718-170856740 ACATCAGACAAAACAAATTGAGG + Intergenic
918527662 1:185482604-185482626 ACATCAGACAAACCAAATAGAGG - Intergenic
918778577 1:188668294-188668316 GGCTAAGAGAAACCAGTTTGTGG + Intergenic
918809438 1:189096490-189096512 ACCTCAGAAAATTCAAATTGTGG + Intergenic
919563330 1:199152135-199152157 TCCTCAGAGAAACCAGCTCCAGG + Intergenic
919954159 1:202395839-202395861 ACCACAGAGAAATCAGAGTTAGG - Intronic
922151680 1:223010910-223010932 ATCTCAGAAAGACCACATTGAGG - Intergenic
923090771 1:230739532-230739554 AGCACAGAGAAACCAGGTGGAGG + Intergenic
923229311 1:231969538-231969560 ACCTCAGAGACAGCATTTTGGGG + Intronic
923620464 1:235575123-235575145 ACATCAAAGAAAAGAGATTGTGG - Intronic
1063146782 10:3302139-3302161 AACTCACAGACAGCAGATTGTGG + Intergenic
1063582799 10:7324510-7324532 AACTCAGGGAACTCAGATTGGGG - Intronic
1063807762 10:9666771-9666793 CCCTCAGAGAAGCCAGGTTCTGG + Intergenic
1066525887 10:36279237-36279259 ACCTCAGAGGAACAAAATGGTGG + Intergenic
1067300499 10:45003836-45003858 ACATCAGAGAACCCACACTGGGG + Exonic
1067508856 10:46878403-46878425 ACATCTTAGAAACCAGATGGGGG + Intergenic
1067653393 10:48173447-48173469 ACATCTTAGAAACCAGATGGGGG - Intronic
1068006413 10:51396620-51396642 AACTCAGAAAAGCCAGACTGTGG - Intronic
1068482871 10:57616720-57616742 ACCTGAAAGAAACAAGATTTAGG - Intergenic
1068506841 10:57911486-57911508 GCCTCAGAGAAGCCAAGTTGAGG + Intergenic
1069523774 10:69149338-69149360 ACATCAGACACACCAAATTGAGG + Intronic
1070462956 10:76688084-76688106 GCCTTAGAGAAACCATTTTGCGG - Intergenic
1070796962 10:79222526-79222548 ACATCAGGGAAACCAGGCTGAGG - Intronic
1072366889 10:94720604-94720626 CTCTAAGAGAAACAAGATTGAGG - Intronic
1072929870 10:99652745-99652767 TCCTCAGAGAGACCAGGGTGAGG - Intergenic
1074889210 10:117721229-117721251 TCCTGAGAGGAACCAGAATGGGG + Intergenic
1075125151 10:119693504-119693526 ACCTCAGTGAAAGCAGTTTCCGG - Intergenic
1075865165 10:125712415-125712437 ACCCCAGAGATACTAGATTCTGG + Intergenic
1078477179 11:11640985-11641007 AGCTGGTAGAAACCAGATTGGGG + Intergenic
1079108018 11:17586381-17586403 ACCTCCGAGCATCCAGATTGAGG + Intronic
1079350039 11:19684684-19684706 ACCCCACAGACACCAGAGTGAGG + Intronic
1079582138 11:22078988-22079010 ACCTCAGACAAACAAGATCATGG - Intergenic
1080381240 11:31774294-31774316 ACCTCAGAGAAAAAAGATTAAGG - Intronic
1081994358 11:47354028-47354050 ACCTTAGGGAACCCAGATTCTGG - Intergenic
1082298153 11:50470207-50470229 ATATCAGAGAAACCACTTTGTGG - Intergenic
1082608003 11:55265647-55265669 AAATCAGAGAAACCTGAATGTGG + Exonic
1083330612 11:61896731-61896753 ACCTCTGAGGACCCAGAGTGGGG - Intergenic
1084091739 11:66883235-66883257 GTCTCAGAGAAAGCAGAGTGAGG + Intronic
1084565499 11:69926246-69926268 CCCTCCTAGAAACCAGCTTGTGG - Intergenic
1084592587 11:70099130-70099152 ACCTCAAAGACCCCAGCTTGAGG + Intronic
1086284044 11:85225017-85225039 ACCTAAGATAAACCTGCTTGAGG - Intronic
1086695942 11:89845511-89845533 AAATCAGAGAAACCTGAATGTGG + Intergenic
1086710213 11:89998972-89998994 AAATCAGAGAAACCTGAATGTGG - Intergenic
1088225935 11:107620289-107620311 ACCTTAGAGAAACCAGGTTGTGG + Intronic
1088415431 11:109583585-109583607 ACCACAGAGAAATGAGACTGAGG - Intergenic
1089011284 11:115133840-115133862 AGCTCACAGACAGCAGATTGTGG + Intergenic
1090218806 11:124996942-124996964 ACAACAGAGAAAACTGATTGTGG - Intronic
1091109618 11:132953692-132953714 TCCCCAGAGAACCCAGAGTGTGG + Intronic
1091583099 12:1800514-1800536 CCCTCAGAGAGACCAGAGAGTGG + Intronic
1092768680 12:11877157-11877179 ACTCCAGAGAAAGCAGTTTGAGG + Intronic
1093617934 12:21250789-21250811 ACCACAGAAAAACAAAATTGTGG + Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1095079415 12:37980360-37980382 ATCTCAGAGAAACCACTTTGTGG + Intergenic
1095900986 12:47327804-47327826 ACCTCAGAGGTACAACATTGTGG + Intergenic
1098033024 12:66273670-66273692 ACCAAAGAGAGACCAGATTAGGG - Intergenic
1098169995 12:67737393-67737415 ACCTCAGAGTAACTAGAATCCGG - Intergenic
1098958961 12:76718475-76718497 ACCTCACAGAAACCCTATGGGGG + Intergenic
1100571998 12:95851786-95851808 ATATCAGACAAACCACATTGAGG - Intergenic
1100783336 12:98052763-98052785 TCCTCACAGAAATCAGAGTGAGG + Intergenic
1102769951 12:115467094-115467116 TCCTCAGAGAACCCAGCATGGGG - Intergenic
1103034882 12:117648402-117648424 TACTCAGTGAATCCAGATTGAGG - Intronic
1103045726 12:117733077-117733099 GGCTCAGAGCAACTAGATTGAGG + Intronic
1103268461 12:119651284-119651306 CCATGAGAGAAACCAGTTTGAGG - Intergenic
1104070857 12:125344310-125344332 AAATCTGAGAAACCAAATTGGGG + Intronic
1104999922 12:132683808-132683830 AGCTCAGAGAAAGCAGTTTTGGG - Intronic
1105050950 12:133050270-133050292 ACCTCAGAGTATCAAGACTGAGG - Intronic
1107421627 13:40253131-40253153 ACTTTAGAGAAACCAGATTGGGG - Intergenic
1110234984 13:73207606-73207628 GCAGCAGAGAGACCAGATTGGGG - Intergenic
1112767676 13:102763112-102763134 ATCTTAGACAAACCAGATTTGGG - Intergenic
1113628290 13:111862874-111862896 ACCACAGAGCAGCCCGATTGCGG + Intergenic
1116318064 14:43423313-43423335 TCCTCAGAAAAACCATATTGAGG + Intergenic
1117194436 14:53325451-53325473 ACCTCAGAGTAAAGGGATTGGGG + Intergenic
1117511995 14:56461653-56461675 AGCTAAGAGAAACTAGGTTGGGG + Intergenic
1117649499 14:57888162-57888184 ACCTCAGAGAAAGGAGATTTGGG + Intronic
1120105574 14:80490414-80490436 ACTTCAGAGCAACCTGATTTGGG - Intronic
1120609637 14:86624110-86624132 ACCCCAGAGACCCCAGACTGGGG - Intergenic
1120913298 14:89687599-89687621 AGCTCAGAGGAATCAGGTTGGGG + Intergenic
1121004781 14:90483166-90483188 ACCTCTGAAATGCCAGATTGTGG + Intergenic
1121121465 14:91378350-91378372 GCCTCAGCTAAACCAGCTTGGGG + Intronic
1122968352 14:105142325-105142347 GCCACAGAGAAACCCGAGTGAGG + Exonic
1123008483 14:105335781-105335803 ACATCAGAGAAAGCTGAGTGAGG + Intronic
1124475818 15:30033547-30033569 CCCTCAGAGAAACATAATTGAGG - Intergenic
1126001939 15:44218922-44218944 ACCACAGAGAAAGAAGAATGTGG - Intergenic
1126376593 15:48002812-48002834 TCCTGAGAGAAACCAGAAAGGGG - Intergenic
1127827582 15:62718541-62718563 GCCTCAGAGAATCCAGATTCAGG - Intronic
1130392752 15:83473395-83473417 ACCACAGAGAAAACAAAATGTGG - Intronic
1132926565 16:2432760-2432782 ACCTCAGAGAAACTCGTTTCTGG + Intronic
1133939602 16:10297345-10297367 ACCTCTCAGACACCGGATTGTGG + Intergenic
1134784841 16:16932672-16932694 AAAACAGAAAAACCAGATTGAGG - Intergenic
1135870543 16:26145844-26145866 ACGGCAGAGAATACAGATTGGGG + Intergenic
1137919229 16:52470057-52470079 CCTTCAGAGAAACCAGATAAAGG - Intronic
1138375886 16:56563811-56563833 ACCTGAGAGCTCCCAGATTGGGG + Intergenic
1138578934 16:57927034-57927056 GCCCCAGAGAAGCCAGAATGAGG + Intronic
1138729129 16:59175600-59175622 AGCACAGAAAAACCAGATAGGGG - Intergenic
1140050397 16:71475739-71475761 ACATCAGAGAATCCACACTGGGG - Exonic
1140268061 16:73437051-73437073 ACATCAGAGCTTCCAGATTGCGG - Intergenic
1143705680 17:8696435-8696457 TCCTCAGAGAAACCACACTCTGG - Intergenic
1144853455 17:18255608-18255630 ACCACAGAGAAATCAGAATCTGG + Intronic
1144858641 17:18285528-18285550 ACCTCAGAGTAACCAGCAAGTGG - Intronic
1149589798 17:57820249-57820271 ACATCAGACACACCAGGTTGGGG - Intergenic
1149954418 17:61032458-61032480 ACCTCAAAGATACCAGCTAGAGG + Intronic
1150389756 17:64783526-64783548 TTCTCAGGGAAATCAGATTGCGG - Intergenic
1151150145 17:72077922-72077944 ACCTCTGAGAAAGCACTTTGAGG - Intergenic
1154375281 18:13803862-13803884 ACCTCAGAGAAATCTGGTTTGGG - Intergenic
1156620011 18:38840197-38840219 ACATCAGACAACCCCGATTGAGG + Intergenic
1157496626 18:48161576-48161598 ACCTCTGAGAAAGCAGAATCCGG + Intronic
1157585002 18:48795328-48795350 ACCTTGGAGAAATCAGGTTGGGG - Intronic
1157600228 18:48889098-48889120 AGGTCAGAGAACCCAGGTTGTGG - Intergenic
1158205856 18:54991411-54991433 ACCCCAGAGATACCCAATTGAGG - Intergenic
1164026807 19:21360130-21360152 AATTCAGAGAAACAAAATTGAGG - Intronic
1164482488 19:28623754-28623776 ACCTCACAAAAACAAGAATGGGG - Intergenic
1164999666 19:32750794-32750816 ACATCAGGCAAACCAAATTGAGG - Intronic
1165610982 19:37152344-37152366 ACATCAGAGAATCCATACTGGGG - Exonic
1165614349 19:37185982-37186004 ACATCAGAGAATCCATACTGGGG - Exonic
1166587784 19:43966399-43966421 ACATCAGAGAATCCATACTGGGG + Exonic
1166665892 19:44680295-44680317 ACCACAGAGAAGCCAGAATTGGG + Exonic
1167375001 19:49106172-49106194 ACCCCAGAGAGACCAGAGTAAGG - Intronic
928329136 2:30344236-30344258 ACCTAAAAGAAGGCAGATTGCGG + Intergenic
928410563 2:31051015-31051037 ACCTCGGAGAAACCACCTTCAGG + Intronic
929239817 2:39642732-39642754 AGCTCAGAGAACCCAGACTTTGG - Intergenic
929267060 2:39929814-39929836 ACATCAGAGAATCCATACTGGGG + Intergenic
931092392 2:58900031-58900053 CTCTCTGAGAAAGCAGATTGTGG + Intergenic
931825248 2:65993868-65993890 ACCTCAAAGAAAGCATCTTGTGG + Intergenic
932021165 2:68088284-68088306 ACCACAGAGAAACCAAAATATGG - Intronic
935484473 2:103636304-103636326 ACAGCAGAGATACCACATTGAGG - Intergenic
935668961 2:105539045-105539067 AGCTCAGAGTAACCATATTGAGG + Intergenic
935992593 2:108734465-108734487 AGCACACAGAAACCAGTTTGGGG + Intronic
936557168 2:113506507-113506529 ATCTCAGAGATTCCAGATAGTGG - Intergenic
938315225 2:130320806-130320828 ACATCAGAGAAACCCAACTGAGG - Intergenic
940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG + Intronic
941264380 2:163341717-163341739 AGCTCTGAGAAACCTGAATGTGG - Intergenic
942350579 2:175048945-175048967 ACCTCAGACAAACAAAACTGAGG - Intergenic
946027406 2:216680088-216680110 GCCTCAGAGGAACCAGAATGGGG + Intronic
946507145 2:220313930-220313952 TCTTCACTGAAACCAGATTGAGG + Intergenic
947969293 2:234308631-234308653 TGCACAGAGAAACCAAATTGTGG + Intergenic
1168974290 20:1952614-1952636 TCCTCAGAGACACTAGGTTGGGG - Intergenic
1170501395 20:16978131-16978153 ACCCCCAAGAAAACAGATTGAGG + Intergenic
1170901319 20:20466049-20466071 AACTCAGAGAGACCAAATGGTGG + Intronic
1171161426 20:22927738-22927760 ACCTTAGACAAACCAAACTGTGG - Intergenic
1171161806 20:22932382-22932404 ACCTCATAAAAACAAGATAGAGG - Intergenic
1171402919 20:24890972-24890994 ACTTCACAGCAACCAGACTGGGG + Intergenic
1171943436 20:31353382-31353404 CCCTAAGAGAAACAAGACTGAGG + Intergenic
1172741836 20:37174782-37174804 CCATCAAAAAAACCAGATTGAGG + Intronic
1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG + Intronic
1176874483 21:14114705-14114727 CCCTCAGAGAAACTAGATTTGGG + Intronic
1176970317 21:15257753-15257775 ATCAGAGAGAAAGCAGATTGTGG - Intergenic
1178128042 21:29537235-29537257 AACTCAGAGAAAAGAGACTGTGG - Intronic
1178910448 21:36669264-36669286 ACCCCAGAGAAGCCAGAGTGAGG - Intergenic
1179453141 21:41479079-41479101 AGCTCAGAGAAATCAGACTCAGG + Intronic
1180559800 22:16606838-16606860 AACCCAGAGAAACCTGACTGTGG - Intergenic
1181173153 22:21021580-21021602 GCCTCTGAGAAGCCAGAATGAGG - Intronic
1182408096 22:30155602-30155624 CACTGAGAGAAACCACATTGTGG - Intronic
1184627671 22:45749864-45749886 ACCTTAAAGAAACCATATTCAGG - Intronic
950670397 3:14522233-14522255 ACCGCTGAGAAACCAGGGTGAGG - Intronic
950791610 3:15476823-15476845 ATCTCAGGGAAACCAGAGTGGGG + Intronic
951558529 3:23944938-23944960 ACCTAAGAGCCACCAGGTTGGGG + Intronic
952271046 3:31831754-31831776 GCCACAGAGAAACGAGTTTGTGG + Intronic
952568805 3:34688357-34688379 ACCTCAGAGAAACTAGCCTCTGG + Intergenic
952842731 3:37662004-37662026 AAGGGAGAGAAACCAGATTGTGG + Intronic
953616929 3:44499387-44499409 ACATCAGAGAACCCATACTGGGG - Exonic
953625936 3:44571150-44571172 ACATCAGAGAACCCATACTGGGG + Exonic
954674106 3:52306289-52306311 GCCTCATGGAGACCAGATTGTGG + Intergenic
956154478 3:66281128-66281150 AACTCAGATAATCCAGATTATGG - Intronic
962180505 3:133201228-133201250 ACCTCAAAGAAATCAGAGTGGGG - Intronic
962884141 3:139608010-139608032 GCCTCAGATAAAACAGAGTGAGG - Intronic
963759875 3:149277112-149277134 ATATCAGAGATACCAGATTGGGG - Intergenic
963865226 3:150353550-150353572 ACCTAAGAGAAACCAGCACGTGG - Intergenic
964172386 3:153786088-153786110 ACCATAGAGAGACCAGAGTGAGG + Intergenic
964513516 3:157479522-157479544 ACCTCAGATAAAGCAGTTGGTGG + Intronic
964681892 3:159350214-159350236 AACTCAGAGAAACAAGAAAGTGG + Intronic
966058115 3:175721502-175721524 ACATCAGAGAAAGGAGACTGAGG + Intronic
967642413 3:191881676-191881698 ACCTCAGAGAACTTAGATTCCGG + Intergenic
968325393 3:197809597-197809619 AACAGAGAGAAAACAGATTGGGG - Intronic
971822707 4:31579481-31579503 AGCTCAGAGAAAATATATTGAGG + Intergenic
973016102 4:45139636-45139658 AGCTTAGAGAAACAAAATTGGGG + Intergenic
974222702 4:58997077-58997099 ACCTTAGAGAAAGCAAATTTGGG - Intergenic
975856142 4:78626596-78626618 GCCTCACAGAAACAAGAATGAGG - Intergenic
976213303 4:82692877-82692899 CCCTCAGGGAAGCCAGCTTGTGG - Intronic
976505850 4:85846326-85846348 ACCTCACAGAAAGCAGATTGGGG - Intronic
979729720 4:124009649-124009671 ACCTCAGAGAAACAAGAAATGGG - Intergenic
979873253 4:125852759-125852781 TCCTCAAAGAAACCAGAATTGGG + Intergenic
980804114 4:137789822-137789844 ACTTCAGAGAAACAGGCTTGGGG + Intergenic
983168045 4:164501565-164501587 ACAGCAGAGAAACAAGATTAAGG + Intergenic
983746138 4:171202743-171202765 ATCTCAGAGACCCCAGATTTTGG + Intergenic
984297564 4:177872787-177872809 ATTTCACAGAAAACAGATTGAGG + Intronic
984768600 4:183418923-183418945 ACACCAGAGAGACCAGCTTGTGG - Intergenic
986839116 5:11675453-11675475 CCCTCAGAGAAACCAGAGTGGGG + Intronic
987793843 5:22603722-22603744 ACTTCAATAAAACCAGATTGGGG + Intronic
989527638 5:42471632-42471654 TCCTCAGGAAAACCAGACTGAGG - Intronic
990974613 5:61548435-61548457 ACCTCAGAGAACACACACTGGGG - Intergenic
992483720 5:77175986-77176008 TCATCAGTGAAACCAGAATGGGG + Intergenic
993151140 5:84163290-84163312 TCTTCAGAGCAACCAAATTGAGG - Intronic
994110082 5:95992458-95992480 ACATCAGATAAACCAAACTGGGG + Intergenic
999582928 5:153059725-153059747 ACCTCAGTGAATCCATATGGTGG - Intergenic
999960593 5:156752119-156752141 ACCTCAGAAACATCATATTGAGG + Intronic
1000115813 5:158152157-158152179 ACCTGAGGGAACCCAGATTGAGG + Intergenic
1001393475 5:171399568-171399590 TCTACAGAGAAACCAGCTTGGGG + Intronic
1003527297 6:6909017-6909039 ACCTCAGAGAAACAAGATTGTGG - Intergenic
1004552970 6:16667483-16667505 ACCTCACAGAATCCAGCGTGTGG - Intronic
1005675813 6:28153633-28153655 ACATCAGAGAATCCACACTGGGG + Exonic
1006558203 6:34887409-34887431 ATCTAAGAGGAACCATATTGCGG + Intronic
1009320595 6:62283903-62283925 ATTTCAGAGAAATCAGAATGAGG - Intronic
1009604645 6:65850893-65850915 AGCTCAGAGTAACTAGATTTAGG - Intergenic
1010406671 6:75514070-75514092 CCCTCACAGACAGCAGATTGTGG - Intergenic
1011272297 6:85592422-85592444 ACATCAGAGAAAACAGCTTGCGG + Intronic
1011626587 6:89288210-89288232 ATCACAGAGAAACCAGAGAGGGG + Intronic
1012540795 6:100359438-100359460 ACCTGAGAGAAACAACAATGGGG + Intergenic
1013551434 6:111211470-111211492 GCCTAACAGAAGCCAGATTGTGG - Intronic
1020441807 7:8224851-8224873 AAATCAGACAAACCAAATTGAGG - Intronic
1021378592 7:19938897-19938919 ACTTCAGAGGAAGGAGATTGAGG - Intergenic
1023743758 7:43303265-43303287 ACGTAAGAGAAACCAGCTGGAGG - Intronic
1024513335 7:50220451-50220473 ACCTCAGTCAAAACAGATTCAGG - Intergenic
1024533935 7:50414524-50414546 ACCCAAGAGAAACCATTTTGAGG - Intergenic
1024696921 7:51867212-51867234 ACCTTAGATATACCAGATGGGGG - Intergenic
1024783428 7:52878230-52878252 ACCTCAGACAATACAGAGTGGGG + Intergenic
1025590764 7:62857750-62857772 CTATCAGAGAAACCAGTTTGTGG + Intergenic
1027472760 7:78593426-78593448 AACGCAGAGTAACAAGATTGGGG + Intronic
1028879780 7:95867199-95867221 AAATCAGAGAAAGCAGATTTAGG - Intronic
1029265987 7:99340923-99340945 ACCTAATAGAAATAAGATTGTGG - Intronic
1029358638 7:100071811-100071833 ACATCAGAGAATCCACACTGGGG - Exonic
1029806722 7:103005302-103005324 ACATCAGAAAAACAGGATTGAGG + Intronic
1030187999 7:106781945-106781967 AGCTCACAGACAGCAGATTGAGG - Intergenic
1033436826 7:141340574-141340596 TCCTCAGAGGAATCCGATTGTGG + Intronic
1035032622 7:155871363-155871385 AGCTCAGAGAGCCCAGATGGGGG - Intergenic
1036795540 8:11753890-11753912 GCCTAAGAGAAACCAGATGTGGG + Intronic
1037178990 8:15981778-15981800 ACATCAGACAAACCAAATTGAGG - Intergenic
1037572352 8:20169173-20169195 ACATCAGACAAACCAAATTTAGG + Intronic
1037874574 8:22535116-22535138 ACCTTAAAGAAAACAGTTTGAGG + Intronic
1039113916 8:34071147-34071169 ACCTCAGACAAGACAGACTGTGG + Intergenic
1041539593 8:58967795-58967817 AGCCCAGGGAAACCAGAGTGAGG - Intronic
1043337191 8:79191082-79191104 AAGTCAGAGAAACAAGATTAAGG + Intergenic
1043767357 8:84152988-84153010 ATTTCAGAGAATCCAGATTCTGG - Intergenic
1044058566 8:87603509-87603531 AACTCAGAGAAAACAAACTGTGG + Intronic
1046766953 8:118079946-118079968 AACTCAGGGAAGCCAGATTTTGG + Intronic
1047549653 8:125856311-125856333 ATATCAGACAAACCAGACTGAGG - Intergenic
1047896854 8:129375870-129375892 ACTTAAAGGAAACCAGATTGGGG - Intergenic
1048259792 8:132935984-132936006 AGCTCAGAGAAGCCAGACTGAGG - Intronic
1048396365 8:134017936-134017958 ATCTCAGAGAAACCAAAGCGGGG + Intergenic
1049084578 8:140468685-140468707 ACCACAGACAAACCAAAATGGGG + Intergenic
1049895829 9:110794-110816 ATCTCAGAGATTCCAGATAGTGG + Intergenic
1050991282 9:12155629-12155651 ACTTCAGATAAGACAGATTGAGG - Intergenic
1052009377 9:23387750-23387772 ACTTCAGAGAGAGCAGATTTGGG + Intergenic
1052665429 9:31489015-31489037 ATCTAAGAGAAAACAGAATGTGG + Intergenic
1053739010 9:41120976-41120998 ATCTCAGAGATTCCAGATAGTGG + Intergenic
1054689339 9:68310346-68310368 ATCTCAGAGATTCCAGATAGTGG - Intergenic
1055423557 9:76169495-76169517 ACCACAGAGAAACAGAATTGGGG - Intronic
1056396113 9:86182681-86182703 ACATCAGATGACCCAGATTGGGG + Intergenic
1203398162 Un_KI270519v1:47259-47281 ACCTGAGAAAAACAAGAATGGGG + Intergenic
1185814148 X:3138668-3138690 AGCTCAGAGAACCCAAATTCAGG + Intergenic
1186270191 X:7878528-7878550 GCCTCAGAGAAAGCAGCTTCAGG - Intergenic
1187353665 X:18545803-18545825 GCCTCAGATAAATCACATTGTGG - Intronic
1189195512 X:39148905-39148927 ACCTCAGAAAAACCTGAAAGTGG - Intergenic
1190250713 X:48722973-48722995 ACCTCAGAGAACACAAACTGAGG + Intergenic
1193632399 X:83906165-83906187 AGCGCAGAAAAAGCAGATTGTGG - Intergenic
1194089618 X:89568535-89568557 AGCTCAGAGAAACCTGTTTCTGG - Intergenic
1195656084 X:107332677-107332699 AACTCAGAGAAACTAGCTAGAGG - Intergenic
1200442273 Y:3224588-3224610 AGCTCAGAGAAACCTGTTTCTGG - Intergenic
1201267558 Y:12222816-12222838 AGCTCAGAGAATCCAAATTCAGG - Intergenic
1202580470 Y:26375491-26375513 ACCACAGAGAAATCAGAGTTAGG + Intergenic