ID: 1173884195 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:46442378-46442400 |
Sequence | CAATCTAGATGCCCTTCACT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173884195_1173884198 | -9 | Left | 1173884195 | 20:46442378-46442400 | CCCAGTGAAGGGCATCTAGATTG | No data | ||
Right | 1173884198 | 20:46442392-46442414 | TCTAGATTGTTTTCAGTTTTGGG | No data | ||||
1173884195_1173884199 | 14 | Left | 1173884195 | 20:46442378-46442400 | CCCAGTGAAGGGCATCTAGATTG | No data | ||
Right | 1173884199 | 20:46442415-46442437 | TTATTACAAATAAAGCTGTTAGG | No data | ||||
1173884195_1173884197 | -10 | Left | 1173884195 | 20:46442378-46442400 | CCCAGTGAAGGGCATCTAGATTG | No data | ||
Right | 1173884197 | 20:46442391-46442413 | ATCTAGATTGTTTTCAGTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173884195 | Original CRISPR | CAATCTAGATGCCCTTCACT GGG (reversed) | Intergenic | ||