ID: 1173884195

View in Genome Browser
Species Human (GRCh38)
Location 20:46442378-46442400
Sequence CAATCTAGATGCCCTTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173884195_1173884198 -9 Left 1173884195 20:46442378-46442400 CCCAGTGAAGGGCATCTAGATTG No data
Right 1173884198 20:46442392-46442414 TCTAGATTGTTTTCAGTTTTGGG No data
1173884195_1173884199 14 Left 1173884195 20:46442378-46442400 CCCAGTGAAGGGCATCTAGATTG No data
Right 1173884199 20:46442415-46442437 TTATTACAAATAAAGCTGTTAGG No data
1173884195_1173884197 -10 Left 1173884195 20:46442378-46442400 CCCAGTGAAGGGCATCTAGATTG No data
Right 1173884197 20:46442391-46442413 ATCTAGATTGTTTTCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173884195 Original CRISPR CAATCTAGATGCCCTTCACT GGG (reversed) Intergenic