ID: 1173884196

View in Genome Browser
Species Human (GRCh38)
Location 20:46442379-46442401
Sequence ACAATCTAGATGCCCTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173884196_1173884199 13 Left 1173884196 20:46442379-46442401 CCAGTGAAGGGCATCTAGATTGT No data
Right 1173884199 20:46442415-46442437 TTATTACAAATAAAGCTGTTAGG No data
1173884196_1173884198 -10 Left 1173884196 20:46442379-46442401 CCAGTGAAGGGCATCTAGATTGT No data
Right 1173884198 20:46442392-46442414 TCTAGATTGTTTTCAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173884196 Original CRISPR ACAATCTAGATGCCCTTCAC TGG (reversed) Intergenic