ID: 1173884197

View in Genome Browser
Species Human (GRCh38)
Location 20:46442391-46442413
Sequence ATCTAGATTGTTTTCAGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173884191_1173884197 12 Left 1173884191 20:46442356-46442378 CCACGCACCACAGTTTGTTTAAC No data
Right 1173884197 20:46442391-46442413 ATCTAGATTGTTTTCAGTTTTGG No data
1173884195_1173884197 -10 Left 1173884195 20:46442378-46442400 CCCAGTGAAGGGCATCTAGATTG No data
Right 1173884197 20:46442391-46442413 ATCTAGATTGTTTTCAGTTTTGG No data
1173884192_1173884197 5 Left 1173884192 20:46442363-46442385 CCACAGTTTGTTTAACCCAGTGA No data
Right 1173884197 20:46442391-46442413 ATCTAGATTGTTTTCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173884197 Original CRISPR ATCTAGATTGTTTTCAGTTT TGG Intergenic