ID: 1173884199

View in Genome Browser
Species Human (GRCh38)
Location 20:46442415-46442437
Sequence TTATTACAAATAAAGCTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173884195_1173884199 14 Left 1173884195 20:46442378-46442400 CCCAGTGAAGGGCATCTAGATTG No data
Right 1173884199 20:46442415-46442437 TTATTACAAATAAAGCTGTTAGG No data
1173884192_1173884199 29 Left 1173884192 20:46442363-46442385 CCACAGTTTGTTTAACCCAGTGA No data
Right 1173884199 20:46442415-46442437 TTATTACAAATAAAGCTGTTAGG No data
1173884196_1173884199 13 Left 1173884196 20:46442379-46442401 CCAGTGAAGGGCATCTAGATTGT No data
Right 1173884199 20:46442415-46442437 TTATTACAAATAAAGCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173884199 Original CRISPR TTATTACAAATAAAGCTGTT AGG Intergenic