ID: 1173884308

View in Genome Browser
Species Human (GRCh38)
Location 20:46443953-46443975
Sequence AAGGAGTTAGATGTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173884308_1173884320 12 Left 1173884308 20:46443953-46443975 CCCTGCCCCACATCTAACTCCTT No data
Right 1173884320 20:46443988-46444010 CTTCTCATATCTCAGGGAGAAGG No data
1173884308_1173884315 5 Left 1173884308 20:46443953-46443975 CCCTGCCCCACATCTAACTCCTT No data
Right 1173884315 20:46443981-46444003 CCCCCAGCTTCTCATATCTCAGG No data
1173884308_1173884317 6 Left 1173884308 20:46443953-46443975 CCCTGCCCCACATCTAACTCCTT No data
Right 1173884317 20:46443982-46444004 CCCCAGCTTCTCATATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173884308 Original CRISPR AAGGAGTTAGATGTGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr