ID: 1173885762

View in Genome Browser
Species Human (GRCh38)
Location 20:46457636-46457658
Sequence ATGGCGAGCTGGACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173885762_1173885769 13 Left 1173885762 20:46457636-46457658 CCATCCTCAGTCCAGCTCGCCAT 0: 1
1: 0
2: 2
3: 25
4: 356
Right 1173885769 20:46457672-46457694 CACCTCTGTCCTGTGACAGCTGG 0: 1
1: 0
2: 1
3: 21
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173885762 Original CRISPR ATGGCGAGCTGGACTGAGGA TGG (reversed) Intergenic
900206485 1:1433949-1433971 ATGGCGAGCTGAAGGGAGGAGGG + Intergenic
901225786 1:7612257-7612279 ATGGGGAGCTGGACAAGGGATGG + Intronic
902437405 1:16407402-16407424 AGGGAGAGCTGCACTTAGGAAGG + Intronic
902709673 1:18230207-18230229 ATGGTGAGCAGGACTGGGGCAGG + Intronic
902810407 1:18884997-18885019 TGGGCGAGCTGGACAGAGGTGGG + Intronic
904012160 1:27395916-27395938 CTGGGGAGCTGGACAGAGGGTGG + Intergenic
904046838 1:27614330-27614352 CGGGCGACCTGGAGTGAGGAAGG + Intronic
904477762 1:30775822-30775844 GAGGGGAGCTGAACTGAGGAGGG + Intergenic
904563552 1:31413931-31413953 AGCGCGAGCCAGACTGAGGACGG - Intronic
904614466 1:31742541-31742563 ATGGCCAGCTGGACTGTGAGAGG - Intronic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
906345059 1:45009852-45009874 ATGGGGAGCTGAACTGAGTGTGG + Intronic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
910149623 1:84126342-84126364 ATGGGGAGCTGGAAAGCGGATGG + Intronic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912798074 1:112704919-112704941 CGGGTGAGCTGGACTGAGGGAGG - Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914937312 1:151992856-151992878 AGGCAGAGCTGGACTGAGGCTGG + Intronic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
923678547 1:236100710-236100732 GTGGAGAGCTGGACTGAGACTGG + Intergenic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1067295298 10:44972171-44972193 ATGGTGTGATGGGCTGAGGACGG - Intronic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1068139933 10:52992842-52992864 AGGGAGAGCTGGAGTGATGATGG + Intergenic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1068610337 10:59053053-59053075 ATGGGAATCTGGACTGAAGATGG - Intergenic
1069195540 10:65546290-65546312 ATTAAGAGCTGGACTGGGGAGGG - Intergenic
1069566095 10:69464439-69464461 ATGGCCCCCTGGCCTGAGGACGG - Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1072782776 10:98261618-98261640 ATGGCCAGCTGTCCTGAGGCTGG + Intronic
1072892105 10:99332831-99332853 AAGGCGAGATGGACTGAACAGGG - Intronic
1073735076 10:106336273-106336295 ATGGTGAGCTGGAAAGGGGATGG - Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074360310 10:112820315-112820337 ACTGGGAGTTGGACTGAGGATGG - Intergenic
1075292164 10:121240123-121240145 ATGGCCAGCTGGCCTGTAGAAGG + Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1081312812 11:41593994-41594016 ATGGGGAGCTGGGAAGAGGATGG + Intergenic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1084042428 11:66550005-66550027 CTGGCAAGCTGGTCTGAGGAAGG + Intronic
1084598067 11:70128962-70128984 GTGACCACCTGGACTGAGGATGG - Intronic
1085205018 11:74726494-74726516 ATGGGGTCCTGGACAGAGGAAGG + Intronic
1085319194 11:75563842-75563864 ACAGCTAGCTGGACTGAGCAGGG - Intronic
1087698784 11:101412399-101412421 ATGGCGAGCTGGAAAGGGGATGG - Intergenic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1089406487 11:118201880-118201902 TTGGGGAGATGGGCTGAGGAGGG + Intronic
1089909083 11:122077640-122077662 GTGGCCAGCTGGACTTAGGCTGG - Intergenic
1090332331 11:125941828-125941850 AGGGACAGCTGGGCTGAGGAGGG - Intergenic
1090471965 11:126988933-126988955 ATAGAAAGCTGAACTGAGGAGGG - Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1091294114 11:134460545-134460567 ATGGGGAGCTGTGCTCAGGAGGG + Intergenic
1091379404 12:46262-46284 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1093073975 12:14737983-14738005 ATGTGGAGCAGAACTGAGGAGGG - Intergenic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1096575131 12:52548132-52548154 AAGGTGAGCTGGGCTGAGGTGGG - Exonic
1096761001 12:53841949-53841971 ATGGGGAGCAAGAGTGAGGAGGG - Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1101755611 12:107618613-107618635 ATGGAAAGATGGTCTGAGGATGG - Intronic
1103057797 12:117835319-117835341 ATGGCGAGTTGGAGGGAGGGTGG + Intronic
1105402117 13:20105150-20105172 GTGAGCAGCTGGACTGAGGACGG - Intergenic
1105972984 13:25447827-25447849 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1108846139 13:54679887-54679909 ATGTGGAGCTGGACAGGGGATGG - Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1113035656 13:106045920-106045942 AAGGCAAGCTGAAATGAGGAAGG - Intergenic
1113591313 13:111503261-111503283 ATGGAGTGCTGGAATGAGAAGGG - Intergenic
1114836146 14:26205016-26205038 TTGGCGAGCTGAGCTGAGGGTGG + Intergenic
1115365250 14:32550417-32550439 ATTTCCAGCTGGCCTGAGGAAGG - Intronic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1117077257 14:52116999-52117021 ATGGCAAGTTGGTCTTAGGATGG - Intergenic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1119984222 14:79117636-79117658 ATGGTGAGTGGGAGTGAGGAAGG + Intronic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120806129 14:88752897-88752919 ATGGCGAACTGGAGAGGGGATGG - Intronic
1121172709 14:91868157-91868179 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121702029 14:95961924-95961946 ATAGTGAGCTGTGCTGAGGAAGG - Intergenic
1122124407 14:99571265-99571287 TTGGCGAGATGGCCTGGGGAGGG - Intronic
1122779591 14:104138171-104138193 ACGGCGAGGTGGGCCGAGGAAGG - Intergenic
1125446899 15:39767795-39767817 ATGGGGAGCTGGAACGGGGATGG - Intronic
1125968252 15:43891480-43891502 AGGGAGGGCTGGTCTGAGGAGGG + Intronic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1128925454 15:71651209-71651231 ATGGCCAACTGGACTGAAGATGG - Intronic
1130803432 15:87291956-87291978 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1130969359 15:88720092-88720114 AGGATGAGCTGGACTGACGATGG - Intergenic
1132703282 16:1230992-1231014 ATGGGGAGCTGGGCTGGGGTTGG - Intergenic
1132703295 16:1231025-1231047 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703332 16:1231124-1231146 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703345 16:1231157-1231179 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703379 16:1231257-1231279 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703392 16:1231290-1231312 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703419 16:1231357-1231379 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703432 16:1231390-1231412 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703445 16:1231423-1231445 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703472 16:1231490-1231512 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132708058 16:1254944-1254966 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708071 16:1254977-1254999 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708082 16:1255009-1255031 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708092 16:1255041-1255063 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708105 16:1255074-1255096 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708163 16:1255239-1255261 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1133324541 16:4935282-4935304 ATGGAGAGCTGCACGAAGGAGGG + Intronic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1135435394 16:22423473-22423495 ATTAGGAGCGGGACTGAGGAAGG - Intronic
1135587208 16:23680032-23680054 ATGGGGAGGTGGATTGAGGCCGG - Intronic
1135953878 16:26939677-26939699 ATGGCGATCTGGACTGTCGTTGG - Intergenic
1136671546 16:31863017-31863039 ATAGCGATCTGGCCTGAGAAGGG - Intergenic
1137035934 16:35569905-35569927 CTGGTGAGCTGTACTGAGGCAGG + Intergenic
1137910064 16:52368893-52368915 ATGGCTAGCTGGAGGAAGGATGG - Intergenic
1138977919 16:62230545-62230567 ATGGGGAGCTGGACAGGGGGTGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1143262967 17:5614060-5614082 TGGGGGAGATGGACTGAGGAGGG - Intronic
1143627780 17:8121171-8121193 ATGGAGAGCAGGACTGAGGGTGG + Exonic
1143698502 17:8638928-8638950 ATGGTGACTTGGACTAAGGAGGG + Intergenic
1145888791 17:28400401-28400423 ATGGCGAGCTAGGTGGAGGAAGG - Exonic
1147232055 17:39026933-39026955 TTGGAGAGCAGAACTGAGGACGG + Intergenic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148643346 17:49204592-49204614 ATGGTGAGATGGAGTCAGGATGG + Intronic
1150398048 17:64836573-64836595 TTGGGGAGCTGGACAGGGGATGG + Intergenic
1151826722 17:76527902-76527924 GTGGGGAGCTGGTCTGAGAAGGG + Exonic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1158968542 18:62644671-62644693 AAGGGGAGCTGGAAAGAGGATGG - Intergenic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1160908928 19:1465962-1465984 ATGGCGAGCAGGACTGGGCGCGG - Exonic
1164837799 19:31369139-31369161 CTGGCGTTCTGGACTGAGGGTGG + Intergenic
1167435158 19:49474840-49474862 AGGGGGAGATGGACAGAGGATGG + Intronic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167642380 19:50688861-50688883 ATGGCGAGCTGGACTGCGAATGG - Exonic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
925266162 2:2568005-2568027 CAGGCGACCTGGGCTGAGGACGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
928371492 2:30743113-30743135 GTGGCAAGAGGGACTGAGGAAGG - Intronic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
932430981 2:71673369-71673391 CAGGCGAGCTGGTCTGAGGGAGG + Intronic
932983181 2:76695157-76695179 ATGGCCAGCAGAACTGAGAATGG - Intergenic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
936564362 2:113571665-113571687 CAGGAGAGCTGGACAGAGGAAGG + Intergenic
937659467 2:124413959-124413981 ATTGAGAGATGGAGTGAGGAGGG + Intronic
937659668 2:124416198-124416220 ATTGAGAGTTGGAGTGAGGAGGG + Intronic
938384153 2:130852699-130852721 AAGCCGAGCAGGACTGAGGTGGG + Intronic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
941858093 2:170250776-170250798 ATGAGGAGCTGGACAGGGGATGG + Intronic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
946727073 2:222671591-222671613 AGGGCGCGCTGGGCTGAGGCTGG - Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947815469 2:233033747-233033769 ATGGTGAGCTGGACTGGGGTGGG + Intronic
948282895 2:236761976-236761998 ATGTTTAGCTGGTCTGAGGAGGG + Intergenic
948386593 2:237584632-237584654 CAGGTGAGCTGGACTGGGGATGG - Intronic
948594966 2:239073949-239073971 ATGGGCAGCAGGACTGAGGGGGG + Intronic
1169209730 20:3759322-3759344 ATGGTGGGCTAGACAGAGGAAGG - Intronic
1170385855 20:15815993-15816015 ACGGAGAGATGGACTGGGGAAGG - Intronic
1170528651 20:17267096-17267118 ATGGGGAGCTGGATTGGGCACGG - Intronic
1171191385 20:23161921-23161943 AATGCGAGGTGAACTGAGGAAGG - Intergenic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1172230822 20:33334381-33334403 ATGGTTAGATGGACTGTGGATGG + Intergenic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1172598669 20:36168448-36168470 ATGGGAAGCTGCAGTGAGGAGGG - Intronic
1172638036 20:36423065-36423087 ATGGGGGGCTTGAATGAGGACGG - Intronic
1172757874 20:37299944-37299966 CTGGAGAGCTGGGCTGAGGCTGG + Intronic
1173270547 20:41530343-41530365 CTGGCAAGATGGACTGAGGGAGG + Intronic
1173803824 20:45911451-45911473 ATGGCGAGCGGGCCTGGGGGTGG + Exonic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1175166811 20:57049680-57049702 ATGGGGATCTGCATTGAGGATGG + Intergenic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1179058162 21:37954975-37954997 CTGGCGAGCGGGACTGATGCTGG + Intronic
1179389608 21:40975709-40975731 CTGGAAAGCTGGACTGGGGAAGG + Intergenic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1181119855 22:20658390-20658412 AGGGCGAGCGGGAAGGAGGAAGG + Intergenic
1182877928 22:33708399-33708421 ATGGCGAGGGGCACTCAGGAGGG - Intronic
1183026288 22:35067953-35067975 ATCGAGAGCTGGCTTGAGGAAGG + Intronic
1183244869 22:36685796-36685818 ATGGAAAGATGGACGGAGGAAGG - Intronic
1184786888 22:46676354-46676376 TCGGCCAGCTGGCCTGAGGAAGG - Intronic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949464758 3:4333027-4333049 ATGGGGAGCTGGATAGGGGATGG - Intronic
949802107 3:7915266-7915288 ATGGGGAGCTGGACAGGGGATGG - Intergenic
950979438 3:17286789-17286811 ATGGAAAGGTGGTCTGAGGATGG + Intronic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
951359794 3:21711802-21711824 ATAGTGAGCTGGACTGAGGTAGG + Intronic
951731616 3:25816014-25816036 ATGGGGAGCTGGACAGGGGATGG - Intergenic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
953243048 3:41166548-41166570 AAGGGGAGTTGGACTGATGAAGG - Intergenic
955947898 3:64212966-64212988 AAGGTGTGCTGGACTGAGCAAGG + Intronic
955949631 3:64229381-64229403 ATGAAGAGCTGTAATGAGGAAGG + Intronic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958868220 3:99526065-99526087 ATGGCAAGCTGAACTGACTAAGG - Intergenic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
961596516 3:128022235-128022257 CTGCAGAGCTGGACTGAGGCTGG - Intergenic
961599193 3:128045947-128045969 ATGACGAGCTAGACAGATGAAGG - Intergenic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
966956808 3:184889378-184889400 AGGAAGAGCTGAACTGAGGAAGG - Intronic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970084204 4:12327243-12327265 ATTGGGACCTGGACTCAGGAAGG - Intergenic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
972344174 4:38178897-38178919 ATGGCGACCTGGCCTGATGTTGG + Intergenic
973193125 4:47409377-47409399 ATGGGGAGCTGGAAAGAGGCTGG + Intronic
974978122 4:68917479-68917501 ATGGGGAGCTGGAATGGTGATGG + Intergenic
975580909 4:75906346-75906368 ATGGGGAGCTGGAACGGGGACGG - Intergenic
975707785 4:77128121-77128143 AAGGGGAGCTGGAATGGGGATGG + Intergenic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
979863073 4:125718596-125718618 ATGGAGAGATGCACAGAGGAAGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
981103447 4:140855304-140855326 ATGGGGAGCTGGACAGGAGATGG + Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
983141473 4:164154924-164154946 ATGGGGAGCTGGACAGGGAATGG + Intronic
983810195 4:172051473-172051495 AGGGGGAGCTGGAATGGGGATGG + Intronic
984451994 4:179914194-179914216 GTGCCCACCTGGACTGAGGATGG - Intergenic
984473007 4:180200960-180200982 AGGGGGAGCAGGACTGAGCATGG - Intergenic
984718817 4:182951668-182951690 ATGCGGAGCTGGAAAGAGGATGG + Intergenic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
986783225 5:11085980-11086002 ATGGCTTGCTGGGCTGGGGAGGG + Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987271584 5:16314736-16314758 ATGGGGACCTGGACAGGGGATGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
989558597 5:42825591-42825613 ATGGGGAGCTGGAAAGCGGATGG - Intronic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
990499023 5:56376539-56376561 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
997355924 5:133262973-133262995 ATGGCGCTCTGGACCGAGCATGG + Intronic
998165217 5:139838812-139838834 ATGGGGGCCTGGGCTGAGGATGG - Intronic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000929621 5:167235630-167235652 AGGGAGAGCTGGTCTGAGAAAGG - Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001802000 5:174552599-174552621 ATGGCGAGCTGGTGTGTGGAGGG - Intergenic
1002586788 5:180253593-180253615 AGGGCCAGCAGGAGTGAGGAAGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1004384554 6:15161450-15161472 ATGGAGAGCGGGAGTGAAGAGGG + Intergenic
1006335063 6:33416103-33416125 ATGGGGAGCTGGGCAGAGGCAGG - Exonic
1007216485 6:40244063-40244085 ATGGCTGGCTGGTGTGAGGAGGG - Intergenic
1007257837 6:40541142-40541164 ATGGCTGGCTGGCCTGGGGAAGG - Intronic
1010178286 6:73055179-73055201 ATGGCCCGCTGGGCTCAGGATGG - Intronic
1010328999 6:74599692-74599714 TTGGAGAGCTGGGCTGAGGCTGG - Intergenic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013426837 6:110019646-110019668 CTGGAGAGCTGAACTCAGGAGGG + Intergenic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1015705247 6:136080857-136080879 ATGGAGAGCTGCATGGAGGAAGG + Intronic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018745673 6:166760213-166760235 ATGGCGATTTGGAGAGAGGAAGG + Intronic
1018987537 6:168649144-168649166 AAGCCGAGTGGGACTGAGGACGG - Intronic
1019754767 7:2760928-2760950 AGGGGGAGCTGGAGTGGGGAAGG - Intronic
1020389881 7:7646671-7646693 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1021041910 7:15872800-15872822 ATGGGGAGCTGGACAGAGGATGG - Intergenic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1027977237 7:85174360-85174382 AAGGGGAGCTGGAGTTAGGAGGG + Intronic
1028267342 7:88742552-88742574 TTGGCAAGCAGGACTAAGGAGGG - Intergenic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029642854 7:101832123-101832145 AAGGCGGGCTAGAGTGAGGAGGG + Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1030856634 7:114565688-114565710 ATGGTGGTGTGGACTGAGGAAGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1034312410 7:150100321-150100343 GAGGCCAGCTGCACTGAGGATGG - Intergenic
1034794444 7:154000343-154000365 GGGGCCAGCTGCACTGAGGATGG + Intronic
1035370346 7:158375868-158375890 ATGGGGAGCTGGAGAGGGGATGG - Intronic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039103977 8:33970609-33970631 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1039426979 8:37494114-37494136 ATGGGCACCTGGACTGAAGAAGG - Intergenic
1039542231 8:38381978-38382000 ATGGCGGCCGGCACTGAGGAGGG + Exonic
1039987721 8:42462025-42462047 ATGGCAAGGTGGACTGTGGCCGG + Intronic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043544726 8:81302419-81302441 ATGGAGAGGTGGGTTGAGGAGGG - Intergenic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1045833326 8:106490712-106490734 ATGGTGAGAAGGACTGAAGATGG + Intronic
1046598446 8:116288798-116288820 ATGCAGAACTGGGCTGAGGACGG + Intergenic
1047252207 8:123189268-123189290 ATGGATAGCTGGACAGGGGAGGG - Intronic
1048074990 8:131060505-131060527 ATGGAGAGCTAGACAGAGGATGG - Intergenic
1048540930 8:135341771-135341793 AGAGAGAGCAGGACTGAGGAGGG + Intergenic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049266107 8:141668681-141668703 AGGGCGAGCAGAAGTGAGGAAGG + Intergenic
1049309835 8:141927995-141928017 GGGCTGAGCTGGACTGAGGACGG - Intergenic
1049816951 8:144608374-144608396 ATGGAAGGATGGACTGAGGATGG - Intergenic
1049888061 9:41543-41565 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1057515415 9:95716355-95716377 ATGGCTGGCTGGAGTGAAGATGG - Intergenic
1057825582 9:98370053-98370075 CTGGCCAGCTGCTCTGAGGATGG + Intronic
1060372581 9:123088457-123088479 ATGGCTAGCTGTTCAGAGGAAGG + Intronic
1060780093 9:126405294-126405316 CTCGCGAGCTGGACTCAGAAGGG - Intronic
1061249405 9:129417655-129417677 CTGGCGAGCTTGGCTGAGGAAGG - Intergenic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062217980 9:135399414-135399436 ATGGCCAGGGGGACTGAGGTTGG + Intergenic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1186056473 X:5654707-5654729 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187433563 X:19246854-19246876 ATGGAGAGGTGGTCTGATGATGG - Intergenic
1187654368 X:21453540-21453562 ATGGAGAGATGAACTGAAGAGGG - Intronic
1188624761 X:32269624-32269646 ATGGTGAGCCGGAATGAGTAAGG - Intronic
1189450303 X:41122804-41122826 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1195328201 X:103775152-103775174 CTGGCGAGCAGGGCTGGGGAGGG + Intronic
1197739238 X:129876586-129876608 ATGAGGAGCTGGACAGGGGATGG - Intergenic
1198041672 X:132859192-132859214 ATGGGTAGCTTGATTGAGGAAGG - Intronic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200824964 Y:7627830-7627852 ATGGCGGGCTTTACTAAGGATGG - Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1202235091 Y:22703257-22703279 ATGGCGGGCTTTACTAAGGATGG + Intergenic
1202308068 Y:23492911-23492933 ATGGCGGGCTTTACTAAGGATGG - Intergenic
1202562733 Y:26177675-26177697 ATGGCGGGCTTTACTAAGGATGG + Intergenic