ID: 1173885765

View in Genome Browser
Species Human (GRCh38)
Location 20:46457655-46457677
Sequence GAGGTGAGCTGGGCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 993
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 905}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173885765_1173885776 24 Left 1173885765 20:46457655-46457677 CCATCCTCAGCCCAGCTCACCTC 0: 1
1: 0
2: 6
3: 81
4: 905
Right 1173885776 20:46457702-46457724 CTTCGTTGACCGACGGTTCTTGG 0: 1
1: 0
2: 0
3: 0
4: 10
1173885765_1173885769 -6 Left 1173885765 20:46457655-46457677 CCATCCTCAGCCCAGCTCACCTC 0: 1
1: 0
2: 6
3: 81
4: 905
Right 1173885769 20:46457672-46457694 CACCTCTGTCCTGTGACAGCTGG 0: 1
1: 0
2: 1
3: 21
4: 257
1173885765_1173885773 17 Left 1173885765 20:46457655-46457677 CCATCCTCAGCCCAGCTCACCTC 0: 1
1: 0
2: 6
3: 81
4: 905
Right 1173885773 20:46457695-46457717 CCCACACCTTCGTTGACCGACGG 0: 1
1: 0
2: 0
3: 0
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173885765 Original CRISPR GAGGTGAGCTGGGCTGAGGA TGG (reversed) Intergenic
900384273 1:2402407-2402429 GAGCTGTGCTGGGCTGTGGTGGG + Intronic
900486816 1:2926550-2926572 GAGCTGGGCTGGGCTGAGCTGGG + Intergenic
900486826 1:2926610-2926632 GGGCTGAGCTGGGCTGAGCTAGG + Intergenic
900486892 1:2926930-2926952 GAGCTGAGCTGGGCTGTGCTGGG + Intergenic
900486898 1:2926970-2926992 GTGCTGAGCTGGGCTGAGCTGGG + Intergenic
900486917 1:2927050-2927072 GGGCTGAGCTGGGCTGAGCTGGG + Intergenic
900486933 1:2927120-2927142 GGGCTGAGCTGGGCTGAGCTGGG + Intergenic
900486946 1:2927200-2927222 GGGCTGAGCTGGGCTGAGCTGGG + Intergenic
900486948 1:2927210-2927232 GGGCTGAGCTGGGCTGAGCTGGG + Intergenic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
900777255 1:4594426-4594448 GAGCTGAGCTGAGCTGAGTGAGG - Intergenic
900861446 1:5235659-5235681 AAGGTGAGCTGGGGTGGAGAGGG - Intergenic
901039723 1:6356562-6356584 GTCGTGTGCTGGGCTGTGGAAGG - Intronic
901143952 1:7052889-7052911 GAGGGGAGCAGGGTGGAGGAGGG - Intronic
901185001 1:7367344-7367366 GGAGTGAGCAGGGCTGGGGACGG - Intronic
901203422 1:7479647-7479669 GAGCTGAGCTAGGCTGAGCTGGG - Intronic
901238602 1:7680360-7680382 GAGGGGAGGAGGGCTGGGGAAGG + Intronic
901526446 1:9825670-9825692 GAGGTCAGCTGGGTGGAGGATGG - Intergenic
902203467 1:14851114-14851136 GAGGTGGGCTGGGCACTGGAAGG - Intronic
902251342 1:15155662-15155684 GGGGTGTGCTGGGCTGGGGAAGG + Intronic
902386439 1:16078512-16078534 GAGGTGTTCTGGGCTGGGCACGG + Intergenic
902399734 1:16151304-16151326 GCAGAGAGCTGGGCTGAGCAGGG + Intronic
902409602 1:16205331-16205353 GAGGTGAGCTGGGCAGGGCAGGG - Exonic
902583948 1:17426540-17426562 GAGCTGTGGTGGGCTGAGCAGGG - Intronic
902628069 1:17688420-17688442 GAAGCCAGCTGGGGTGAGGATGG - Intronic
902830977 1:19012429-19012451 GAGTTTAGCTGGGCTCAGGGAGG - Intergenic
902834821 1:19040199-19040221 GAGGAGAGATGGGTTGAGAACGG + Intergenic
903155632 1:21440534-21440556 CACGAGAGCTGGGCTGAGGGCGG - Intronic
903282558 1:22258161-22258183 GGGCTGGGCTGGGCTGGGGATGG + Intergenic
903332361 1:22602624-22602646 GAGGAGACCTGGGCCGTGGAGGG - Exonic
903442829 1:23401255-23401277 CCGGTGAGGTGGGCTGGGGATGG + Intronic
903650141 1:24917070-24917092 GGGGTGGGCTGGGCTGAGCATGG + Intronic
903661951 1:24983839-24983861 GAGGTGTGGTGGGATGAGGGTGG + Intergenic
903808323 1:26021006-26021028 GAGGAGTTCTGGGCTGATGAGGG - Intronic
904306272 1:29592300-29592322 GGGTTGAGTTGGGCTGAGGGGGG - Intergenic
904471635 1:30740049-30740071 GAGGTGACCTCAACTGAGGAGGG - Intronic
904477762 1:30775822-30775844 GAGGGGAGCTGAACTGAGGAGGG + Intergenic
904563917 1:31415889-31415911 AAGGTGAACTGGGCTGAAGGTGG + Intronic
904652399 1:32014832-32014854 GAGGTGAGGTGGGGTGAGGCTGG + Intronic
904824158 1:33263958-33263980 GAGCTGGGCTGGGCAGAGAAAGG - Intronic
905239102 1:36571091-36571113 GGGGACAGCTGGGCTGAGGCAGG - Intergenic
905239158 1:36571319-36571341 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905239175 1:36571379-36571401 GGGGAGAGCTGGGCTGAAGTGGG - Intergenic
905239231 1:36571592-36571614 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905239249 1:36571655-36571677 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905239293 1:36571800-36571822 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905239331 1:36571926-36571948 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905239345 1:36571967-36571989 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905239359 1:36572008-36572030 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905239386 1:36572091-36572113 GGGGACAGCTGGGCTGAGGTGGG - Intergenic
905471131 1:38192825-38192847 GTGGTCAGCTGGGCTGAGGTGGG - Intergenic
905791158 1:40790381-40790403 TAGGTGTGCTGGGCTCAGCAAGG + Intronic
905890429 1:41515431-41515453 GATGAGAGCAGGGCTGGGGATGG + Intronic
906297736 1:44659354-44659376 GGAGAGATCTGGGCTGAGGAGGG + Intronic
906304318 1:44706926-44706948 GAGGTGAGGTGGGGAGAGGAAGG - Intronic
906901902 1:49844610-49844632 GTGGTGAGATGGGAAGAGGAAGG - Intronic
907275022 1:53312157-53312179 GAGGTGAGCAGGGCAGAGATGGG + Intronic
907276501 1:53319726-53319748 GAGAGGAGCTGGGGTGAGCAGGG + Intronic
907425364 1:54375946-54375968 GAGGAGAGCAGGGAAGAGGAAGG + Intronic
907573863 1:55507921-55507943 GAGTTGACCTGGGTTGAGGTGGG - Intergenic
907939837 1:59076995-59077017 GAGGAGAGATGGGCTGGGCAAGG + Intergenic
908990593 1:70083517-70083539 GAGGTCAGATGAGATGAGGATGG - Intronic
909022717 1:70450015-70450037 GAGATGACCTGGGCATAGGAAGG - Intergenic
909925439 1:81432666-81432688 GAGGGGAGCGGCGCCGAGGAGGG - Intronic
910854669 1:91683691-91683713 GAGCTGAGCTGGGCTGGGCTGGG + Exonic
911152832 1:94611418-94611440 GGGGAGAGCTGGTCTGAGAATGG + Intergenic
912474772 1:109928474-109928496 GAGATGACCTCGCCTGAGGAGGG + Intronic
912682651 1:111739078-111739100 GACGTAAGCAGGGCGGAGGAGGG - Intronic
912798074 1:112704919-112704941 CGGGTGAGCTGGACTGAGGGAGG - Intronic
912812012 1:112802027-112802049 GGGGTGGGCTGGGAAGAGGAGGG - Intergenic
913271979 1:117103216-117103238 TAGGTGAGCTGGGGCGAGGAGGG - Exonic
913280580 1:117181541-117181563 GAGCTGAGCTAGGCTCTGGATGG - Intronic
913546328 1:119872353-119872375 GAGGGGTGCTGTGGTGAGGAAGG + Intergenic
914322965 1:146583070-146583092 TGGCTGAGCTGGGCTGAGGCAGG + Intergenic
914323104 1:146584368-146584390 TGGCTGAGCTGGGCTGAGGCAGG - Intergenic
915163042 1:153933094-153933116 GAGGTGGGAGGGGCTGGGGAAGG - Intronic
915203960 1:154255324-154255346 CAGGTGATTTGGGGTGAGGATGG + Exonic
915298155 1:154936452-154936474 GAGGAGCACTGGGCTGGGGAAGG - Intronic
915318460 1:155042958-155042980 GAGGTGACCAGGGGTGAGGGAGG + Intronic
915511914 1:156391228-156391250 GAGGTGAGCTGGCCGGGGAAAGG - Intergenic
915951165 1:160190690-160190712 GAGGTTAGCTGGGGTAGGGAGGG - Exonic
915981011 1:160419992-160420014 GAAGTGACCTGGCCAGAGGAGGG + Intronic
916071185 1:161170959-161170981 GAAAACAGCTGGGCTGAGGAGGG + Intronic
916371289 1:164098062-164098084 GAGGTGGGCTGGACTGAATAAGG + Intergenic
916550969 1:165849523-165849545 GAGGTGAAGTGAGATGAGGAAGG + Intronic
917539413 1:175898590-175898612 GAGAAGAGTTCGGCTGAGGACGG + Intergenic
918078321 1:181187398-181187420 GGGGTTAGCTGGGCTGAGTATGG + Intergenic
918107385 1:181426348-181426370 GAGATGAGCTGGGTTGAGTTAGG - Intronic
919062476 1:192651234-192651256 GAAGTCAGCTGAGGTGAGGAAGG + Intronic
919673956 1:200362999-200363021 GAGGTGAGATGGGGTGGGGTGGG - Intergenic
919913111 1:202123913-202123935 CAGGGGAGAAGGGCTGAGGAAGG - Intronic
919920838 1:202165626-202165648 CAGGTGAGGTGGGATGAGGGTGG + Intergenic
920035291 1:203061289-203061311 GAGGAGAGTTGGGCTGGGGAGGG + Intronic
920256476 1:204658573-204658595 GGGGTGACATGGGGTGAGGAAGG + Intronic
920672350 1:208014177-208014199 GCGGTGGTCTGGGGTGAGGAAGG - Intergenic
921077659 1:211712708-211712730 GCGGTGAGGTGGGGAGAGGAGGG - Intergenic
921195255 1:212750304-212750326 TAGGTGAGCTGGGAGGAGGTGGG + Intronic
922223858 1:223628449-223628471 TAGGGGAGCTGGGAAGAGGATGG + Intronic
922354814 1:224765616-224765638 TAGGCGAGCTGGGCTGGTGAAGG + Intergenic
922870790 1:228900356-228900378 CAGGAGAGCTGGCCAGAGGATGG - Intergenic
924566014 1:245198973-245198995 GAGCTGAGCTGAGCTGAGGCTGG + Intronic
924635768 1:245786193-245786215 GAGTTGAGTTGGGGTGTGGACGG + Intronic
924704952 1:246493216-246493238 GAGGAGAGGGGGGCTGAGGTAGG + Intronic
924922516 1:248645538-248645560 GAGGTGAGGCGAGCTGAGGTTGG + Intergenic
1062779295 10:186580-186602 GTGGTGAGCTGAGCTGAGATCGG + Intronic
1063127681 10:3150088-3150110 AAGATGAGCAGCGCTGAGGACGG - Intronic
1063970760 10:11379891-11379913 GAGGAGTGCTGGGCAGTGGATGG - Intergenic
1064122154 10:12629119-12629141 GAGCTGAGCTTGGGTGAGGCGGG + Intronic
1064308404 10:14188960-14188982 GAGGTGAGCTGGGTTGCTCAGGG - Intronic
1064737723 10:18399888-18399910 GAGGTGAGTGAGGCTGAAGAAGG - Intronic
1065168589 10:23005909-23005931 GAAGAGAGCTGGGCAGAGGGAGG + Intronic
1065732417 10:28721698-28721720 GCGGTGGGCAAGGCTGAGGATGG + Intergenic
1065875855 10:29996506-29996528 GAGGTGAGGGGGGGTGAGGGAGG + Intergenic
1066245005 10:33574292-33574314 GATGTGAGCTGGGCTGGGCGCGG + Intergenic
1066395931 10:35021842-35021864 GAGGTGAGGTGAGGTGAGGTGGG + Intronic
1066395938 10:35021857-35021879 GAGGTGGGGTGGGGTGAGGTGGG + Intronic
1066395942 10:35021867-35021889 GGGGTGAGGTGGGGTGAGGTGGG + Intronic
1066395946 10:35021877-35021899 GGGGTGAGGTGGGGTGAGGTGGG + Intronic
1066395950 10:35021887-35021909 GGGGTGAGGTGGGGTGAGGTGGG + Intronic
1066447060 10:35492939-35492961 GGGGAGAGCTGGCCTGAGGGTGG - Intronic
1067147594 10:43704421-43704443 GTGGTTGGCTGGGCTGAGGAAGG - Intergenic
1067295298 10:44972171-44972193 ATGGTGTGATGGGCTGAGGACGG - Intronic
1067340742 10:45401239-45401261 GAAGTTACCTGGGCTGTGGAGGG + Intronic
1068961428 10:62870409-62870431 GAGGTTAGCTTTGGTGAGGAGGG + Intronic
1069139247 10:64803144-64803166 GAGGTGACCTCAGCTGTGGAGGG - Intergenic
1069352858 10:67550970-67550992 GAGAAGAGCTGGGTAGAGGAGGG + Intronic
1069712007 10:70495618-70495640 GAGGTGGGCTTGGATGGGGATGG + Intronic
1069750860 10:70744187-70744209 CAGGTGAGCCGGGCTGGGGCTGG + Exonic
1070484007 10:76912476-76912498 GAGGTGAAATGGTCTGAGGAGGG + Intronic
1070791106 10:79190024-79190046 GGTGGGAGCTGGGCTGAGGCTGG - Intronic
1070808043 10:79282322-79282344 GAGGTGAGCTTGGGTGAGCTGGG + Intronic
1070818066 10:79337712-79337734 GAGGTGAGGTGGGGTGGGGATGG + Intergenic
1070819332 10:79345899-79345921 GAGGTGAGCAGGCCTGAGTGGGG - Intergenic
1072521346 10:96232498-96232520 GAGGTGAAATGGGGTCAGGAAGG + Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1072749919 10:97970545-97970567 GGGGAGAGCTGGCCTGAGGCAGG - Intronic
1073293605 10:102425343-102425365 GAGGTGAGATGGGCGGAGGAGGG - Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1074436580 10:113439518-113439540 GAGGGGACCAGGGCTGAGAAAGG - Intergenic
1074884950 10:117686075-117686097 GCTCGGAGCTGGGCTGAGGAAGG - Intergenic
1074918949 10:117987785-117987807 CAGGAGAGCAGGGCTGGGGAGGG - Intergenic
1075942782 10:126405688-126405710 GAGGAGGGATGGGCAGAGGAGGG + Intergenic
1076107375 10:127834433-127834455 GATGTGAGCATGGGTGAGGACGG - Intergenic
1076163854 10:128266816-128266838 GGGGTGAGCTGGGGTGTGGATGG + Intergenic
1076347991 10:129793829-129793851 GGGGTGAGGTGGGGTGAGGTGGG - Intergenic
1076401523 10:130188620-130188642 GTGGAGTGCTGGGCTGTGGATGG + Intergenic
1076543302 10:131227962-131227984 GAGGAGGGGTGGGGTGAGGAGGG - Intronic
1076662859 10:132067102-132067124 AAAGTGAGCCGGGCCGAGGAAGG + Intergenic
1076802261 10:132836056-132836078 GAGGTGAGCAGGGCTGTGTCGGG - Intronic
1076874898 10:133211128-133211150 GAGGGGTGGTGGGCTGAGGGGGG + Intronic
1077227890 11:1446285-1446307 GGGCTGAGCTGGGCTGAGCTGGG + Intronic
1077331834 11:1987333-1987355 GGGATGAGCTGGGCTGGGCAGGG + Intergenic
1077331878 11:1987453-1987475 GGGATGAGCTGGGCTGGGCAGGG + Intergenic
1077440576 11:2566939-2566961 GTGCTGAGCTGGCCTGAGAAGGG + Intronic
1077538405 11:3135200-3135222 GAGCTGTGCTGGGCTGGGCAGGG + Intronic
1077839399 11:5958784-5958806 GAGGTGATCAGGGAGGAGGAGGG - Intergenic
1077976986 11:7257176-7257198 AATGTGAGCTGAGCTGAGAAGGG - Intronic
1077995605 11:7449755-7449777 GAGAACAGCTGGTCTGAGGATGG - Intronic
1078074747 11:8148127-8148149 GAGTGGAGCTTGGCTGAGAAAGG - Intronic
1078364152 11:10692904-10692926 GAGGTGAGCAGGGCCGGGCACGG + Intronic
1078402083 11:11037389-11037411 GGGCTGGGCTGGGCTGAGGCTGG + Intergenic
1078710735 11:13788552-13788574 GAGGTGGGCTGGGCAGATTAAGG - Intergenic
1079250045 11:18780566-18780588 GAGGAGACCTGGGCTGAGGTGGG - Intronic
1079641896 11:22816159-22816181 GAGGTGGGCGGGGAGGAGGAGGG - Intronic
1080293421 11:30697758-30697780 CAGGTTAGCAGGGATGAGGAGGG + Intergenic
1080653819 11:34243002-34243024 GAGGTGGGCAGGGCTGTGGAGGG - Intronic
1080822006 11:35816316-35816338 GAGCTGAGTTGGGAAGAGGATGG - Exonic
1081502615 11:43681077-43681099 GAGGAGAGCTGGGGAGGGGAAGG - Intronic
1081687628 11:45053829-45053851 CAGGGGAGCTGACCTGAGGAAGG - Intergenic
1081739224 11:45426466-45426488 AAAGTGAACTGGGCAGAGGAGGG + Intergenic
1081770773 11:45649555-45649577 GGGGTGAGCTGGGGGCAGGAAGG + Exonic
1081782608 11:45723570-45723592 GAGGTGAGCATGGGTAAGGAGGG + Intergenic
1081998222 11:47377999-47378021 GGAGGGTGCTGGGCTGAGGATGG - Intronic
1082051909 11:47777343-47777365 GAGCTGGGCTGGGTTGAGCATGG + Intergenic
1083144873 11:60750608-60750630 GAAGTGAGCTGTGCTGTAGATGG - Intergenic
1083490183 11:63009924-63009946 GAGGAGGGCCAGGCTGAGGAGGG + Intronic
1084183405 11:67457692-67457714 GTGGTGAGGTGGGCAGAGGGGGG + Intronic
1084263099 11:67991387-67991409 GAGGTGACCTGGGCTCTGGGAGG + Exonic
1084413697 11:69018219-69018241 GAGGTGGACAGGGCAGAGGAGGG - Intergenic
1084632821 11:70365950-70365972 GAGGGAAGCTGGGCTCAGGTTGG + Intronic
1084810292 11:71607734-71607756 GAGGTGACCTGGGCTCTGGGAGG - Intergenic
1084927283 11:72523606-72523628 GAGGATGGCTAGGCTGAGGAAGG + Intergenic
1084943534 11:72626810-72626832 CATGAGTGCTGGGCTGAGGAAGG - Intronic
1085245357 11:75096804-75096826 TAGGTGAGCTGGGCTGGGGATGG - Intergenic
1085463641 11:76710012-76710034 GTGTGGAGCTGGGCTTAGGATGG + Intergenic
1085739877 11:79069665-79069687 CAGGTGAGCTTGGCTCAGGTAGG - Intronic
1087944005 11:104136038-104136060 CAGGTGAGATGGGATGAGGAGGG + Intronic
1088310683 11:108457198-108457220 GAGATAAGCAGGGCTGTGGAGGG + Intronic
1088396911 11:109379130-109379152 CAGGTAAGCTGGACAGAGGATGG + Intergenic
1088748536 11:112824493-112824515 GAGAGGAGCTCGGCTGGGGACGG + Intergenic
1089081604 11:115780840-115780862 GAAGGGAACTGGGCTGGGGAGGG + Intergenic
1089198250 11:116707835-116707857 GAGACGAGGTGGCCTGAGGATGG + Intergenic
1089406487 11:118201880-118201902 TTGGGGAGATGGGCTGAGGAGGG + Intronic
1089447533 11:118565489-118565511 GGGGTGGGGTGGGCTGAGGCGGG + Intronic
1089615894 11:119694603-119694625 GAAGTGATGTGGGCTGAAGAGGG + Intronic
1089682246 11:120125172-120125194 CTGTTGAGCTGGGCTGGGGACGG - Intronic
1089833393 11:121348869-121348891 GTAGTGAGGTGGGGTGAGGAAGG + Intergenic
1090332331 11:125941828-125941850 AGGGACAGCTGGGCTGAGGAGGG - Intergenic
1090571527 11:128052460-128052482 GAGGTGGACTGGGCTGCTGAAGG + Intergenic
1090717086 11:129440368-129440390 CAGGTGAACTGGGCTCGGGAAGG + Intronic
1091162475 11:133437636-133437658 GAGGTGAGCGGGGTTGAGAGGGG - Intronic
1091162482 11:133437660-133437682 GAGGTGAGCGGGGTTGAGAGGGG - Intronic
1091162489 11:133437684-133437706 GAGGTGAGCGGGGTTGAGAGGGG - Intronic
1091162496 11:133437708-133437730 GAGGTGAGCGGGGTTGAGAGGGG - Intronic
1202814815 11_KI270721v1_random:42509-42531 GGGATGAGCTGGGCTGGGCAGGG + Intergenic
1202814859 11_KI270721v1_random:42629-42651 GGGATGAGCTGGGCTGGGCAGGG + Intergenic
1091379404 12:46262-46284 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1091697314 12:2636640-2636662 GAAGTGAGCTGGCCCCAGGAGGG - Intronic
1092773350 12:11918589-11918611 GAGTTGAGCTTGGCAGAGGCTGG - Intergenic
1093098474 12:14999039-14999061 GAGGGGCTCTGGGCTCAGGAGGG - Intergenic
1094462937 12:30717400-30717422 GAGGTTAGCAGAGCTGTGGAGGG + Intronic
1095446319 12:42286773-42286795 GAGGGGAGCCAGGCTGAGGGTGG + Intronic
1095521633 12:43073808-43073830 GGGATGAGCTGGCCTAAGGAGGG - Intergenic
1096094489 12:48925346-48925368 GCGGTGTGCCGGGCTGAGGCTGG - Exonic
1096111665 12:49032437-49032459 GCAGAGAGCTGGGCTGAGGCTGG + Exonic
1096220559 12:49826137-49826159 GAGGTGGGCAGGGCTGGGGGTGG + Intronic
1096466558 12:51849924-51849946 GAGGAGGGCTGTGCTGATGATGG + Intergenic
1096487728 12:51994948-51994970 GAGGAGAGCTGTGCTGATGCTGG - Intronic
1096524100 12:52200515-52200537 GGGTTGGGCTGGGCTGGGGAAGG + Intergenic
1096575131 12:52548132-52548154 AAGGTGAGCTGGGCTGAGGTGGG - Exonic
1096588538 12:52642137-52642159 GAGGTGAGCTGTCCTGAAGGAGG + Intergenic
1096766662 12:53896571-53896593 TAGTTGAGCTGCTCTGAGGAAGG - Intergenic
1096981589 12:55730627-55730649 GTGGTGAGATGGGCTGAAGGTGG + Intergenic
1097134219 12:56837922-56837944 GAGGTGAGCAGGGCAGGAGAGGG - Intergenic
1097277852 12:57825345-57825367 GATGAAAGCTGGGATGAGGAAGG - Intronic
1097707345 12:62881703-62881725 GATTTGAGCTGAGGTGAGGAGGG - Intronic
1097987463 12:65799045-65799067 GAGGAGAGCTGGGATGAGGGAGG + Intergenic
1098218235 12:68242039-68242061 GTGGTAAGCTGGGCACAGGAGGG + Intergenic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1098393901 12:69997943-69997965 AAGGTGATCTGGGCTGTGCAGGG + Intergenic
1101336571 12:103802060-103802082 GAGGTGAGCTGGACTCTGGAGGG - Intronic
1102546908 12:113663997-113664019 GAGGTGAGATGGTGTGAGGGTGG - Intergenic
1102927344 12:116836280-116836302 CAGGTGAGCAGGGCTCAGGCGGG + Exonic
1102952979 12:117042346-117042368 GTGGTGAGGTGGGCTGAGTGGGG - Intronic
1103568482 12:121829103-121829125 GGGGTGGGCAGGGCTGAGGGTGG + Intronic
1103922160 12:124404653-124404675 GAGGAGAGCTGCGGTGGGGAAGG - Intronic
1104080744 12:125428647-125428669 GAGGTGAGCTTGGTTGGGGCAGG - Intronic
1104235970 12:126936917-126936939 GAGGAGAGCTGGAGAGAGGATGG + Intergenic
1104289832 12:127456555-127456577 CAGGTGATCTGAGCTGAGGCAGG - Intergenic
1104406862 12:128525114-128525136 GAGGTGCCCTGGTCTCAGGAAGG + Intronic
1104431991 12:128724036-128724058 AAGGTGACCTGGGATGAAGACGG + Intergenic
1104729012 12:131094870-131094892 GCTGAGAGCTGGGCTGGGGATGG + Intronic
1104941909 12:132399243-132399265 GAGGGCAGCTGGGATGTGGAGGG - Intergenic
1105213303 13:18270639-18270661 GAGGTGAGCGGGGCAGGGCATGG - Intergenic
1105492668 13:20903148-20903170 GCGGTGTGCAGGGCTGAGAACGG - Intergenic
1106077767 13:26475798-26475820 TAGGAGGGCTGGGCTCAGGAGGG + Intergenic
1106077771 13:26475813-26475835 CAGGAGGGCTGGGCTCAGGAAGG + Intergenic
1106231649 13:27825599-27825621 GAGGAGAGGTGGCCTGAGGCTGG - Intergenic
1107698051 13:43020080-43020102 GAGGTGAGGTGGACTCAGCAGGG - Intergenic
1107771939 13:43796474-43796496 GAGTTGAGCTGGAAGGAGGAAGG - Intergenic
1107834059 13:44399230-44399252 CAGGTGCGATGGGCTGAGCATGG + Intergenic
1107928685 13:45288318-45288340 GAGGGGTGCTGGGCTGAGAGGGG + Intergenic
1108603219 13:52012175-52012197 GTGGGGGGTTGGGCTGAGGAGGG - Intergenic
1108760827 13:53562243-53562265 GAGGAGAGATGGGGAGAGGAAGG - Intergenic
1110760335 13:79223994-79224016 GAGGTGAGGTGAGAGGAGGAAGG + Intergenic
1112744535 13:102511850-102511872 GAAGGAAGCTGGGCTGAAGAAGG - Intergenic
1113033398 13:106019714-106019736 CAAGAGAGCTGGGCTGAAGAGGG - Intergenic
1113335723 13:109374047-109374069 CAGGTGACCTGGGCTGAGAGGGG - Intergenic
1113936625 13:113998288-113998310 GAGGAGGGCTGGGAAGAGGAGGG - Intronic
1114655326 14:24312162-24312184 CAGGGCACCTGGGCTGAGGAGGG - Intronic
1114674445 14:24431004-24431026 GAGGAGAGCAGGGAAGAGGAGGG + Intronic
1115361687 14:32510161-32510183 GAGAAGAGCTGGGCAGAGGGAGG - Intronic
1115770628 14:36661852-36661874 AACGTGGGCTGGGCTGAGCAGGG - Exonic
1116867192 14:50040421-50040443 GTGGTGAGCAGGGGTGAGGGAGG - Intergenic
1116905156 14:50396864-50396886 GAGCCGAGCTGGGCGGAAGAAGG - Intronic
1116948568 14:50858202-50858224 AAGGGGGGCTGGGCAGAGGAAGG + Intronic
1117376929 14:55125740-55125762 GAGGTGGCCAGGGCTGAGGTTGG + Intronic
1117508666 14:56427174-56427196 AGGGTGAGCCGGGCTGAGGCTGG + Intergenic
1117844545 14:59897156-59897178 GAGGTGAGACGGGCTGAAGCAGG + Intergenic
1118818050 14:69326557-69326579 GAGGAGAGCTGGAGTGAGCAGGG + Intronic
1119548887 14:75493637-75493659 GAGGTGGGCTGGGAGGAGGCGGG + Intergenic
1119627880 14:76197475-76197497 GAAAGGAGCTGGGCTCAGGAGGG - Intronic
1119705584 14:76780880-76780902 GAGCTGGGCTGGGCTGGGGTAGG + Exonic
1119890810 14:78180782-78180804 GAGTTGCCCTGGGCTGAGAAAGG - Intergenic
1120080524 14:80211231-80211253 CAGGTGAGCTGAGCTGAGAAGGG - Exonic
1120840738 14:89082899-89082921 GGGGTTAGCAGGGCTGAGAAGGG + Intergenic
1121104087 14:91269585-91269607 CAGGGGAGCTGGGTTGATGAGGG + Intergenic
1121469209 14:94138885-94138907 GGGGTGAGCAGGGCTGACGGGGG + Intergenic
1121586959 14:95069118-95069140 GAGGAGAGGAGAGCTGAGGACGG + Intergenic
1121702029 14:95961924-95961946 ATAGTGAGCTGTGCTGAGGAAGG - Intergenic
1121789671 14:96689710-96689732 AAGTTGGGCTGTGCTGAGGAGGG + Intergenic
1122145188 14:99684534-99684556 CAGGTGAGCGGGGCTGGGGGCGG + Exonic
1122227160 14:100286550-100286572 GAGGAGAGCAAGGCTGAGCAAGG + Intergenic
1122587993 14:102824312-102824334 GATGTGATCTGGTCTTAGGAAGG - Intronic
1122761616 14:104032958-104032980 GAGGGGAGGTGGGATGAGGGTGG + Intronic
1122819759 14:104335512-104335534 GGGCTGGGCTGGGCTGGGGAGGG - Intergenic
1123059768 14:105589248-105589270 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123059770 14:105589258-105589280 GGGGTGGGCTGGGCTGAGCTGGG - Intergenic
1123059783 14:105589308-105589330 GAGCTGAGCTGGGCTGGGCTGGG - Intergenic
1123059854 14:105589662-105589684 GAGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123059860 14:105589692-105589714 GAGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123059896 14:105589881-105589903 GAGCTGGGCTGGGCTGAGCTGGG - Intergenic
1123059919 14:105589986-105590008 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123059921 14:105589996-105590018 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123060015 14:105590336-105590358 GAGCTGAGCTGGACTGAGCTGGG - Intergenic
1123060057 14:105590476-105590498 GAGCTGAGCTGGACTGAGCCGGG - Intergenic
1123060089 14:105590586-105590608 GAGCTGAGCTGGACTGAGCTGGG - Intergenic
1123060117 14:105590691-105590713 GAGCTGAGCTGGACTGAGCTGGG - Intergenic
1123060158 14:105590826-105590848 GAGCTGAGCTGGACTGAGCTGGG - Intergenic
1123060185 14:105590926-105590948 GAGCTGAGCTGGACTGAGCTGGG - Intergenic
1123060227 14:105591071-105591093 GAGCTGAGCTGGACTGAGCTGGG - Intergenic
1123060255 14:105591188-105591210 GAGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123084174 14:105709862-105709884 GGGCTGAGCTGGGCTGAGCTAGG - Intergenic
1123084186 14:105709912-105709934 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123084320 14:105710599-105710621 GAGCTGAGCTGGGCTGACCTGGG - Intergenic
1123084345 14:105710704-105710726 GAGTTGGGCTGGGCTGAGCTGGG - Intergenic
1123084351 14:105710734-105710756 GAGCTGAGTTGGGCTGAGCTGGG - Intergenic
1123084384 14:105710869-105710891 GGGGTGAGCTGGGCTGGGCTGGG - Intergenic
1123084393 14:105710894-105710916 GAGCTGAGCTGAGCTGAGCTGGG - Intergenic
1123084417 14:105710989-105711011 GAGCTGAGCTGAGCTGAGCTGGG - Intergenic
1123084601 14:105711599-105711621 GAGCTGAGCTGGGCTGGGCTGGG - Intergenic
1123084609 14:105711634-105711656 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123084642 14:105711784-105711806 GAGCTGTGCTGGGCTGAGCTGGG - Intergenic
1123084672 14:105711919-105711941 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123084684 14:105711959-105711981 GAGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123084686 14:105711969-105711991 GAGCTGAGCTGAGCTGAGCTGGG - Intergenic
1123084710 14:105712079-105712101 GGGCTGAGCTGGGCTGAGCTAGG - Intergenic
1123084736 14:105712194-105712216 GGGCTGAGCTGGGCTGAGCTAGG - Intergenic
1123084745 14:105712249-105712271 GGGCTGGGCTGGGCTGAGCAAGG - Intergenic
1123109184 14:105857504-105857526 GGGCTGAGCTGGGCTGAGCCGGG - Intergenic
1123109186 14:105857514-105857536 GAGCTGAACTGGGCTGAGCTGGG - Intergenic
1123109215 14:105857734-105857756 GAGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123109347 14:105858370-105858392 GAGCTGAGCTGGGCTGAGTGGGG - Intergenic
1123109352 14:105858395-105858417 AAGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123109389 14:105858595-105858617 GAGCTGAGCTGAGCTGAGCTGGG - Intergenic
1123109434 14:105858804-105858826 GAGCTGAGCTGAGCTGAAGTAGG - Intergenic
1123109442 14:105858874-105858896 AGGGTGAGCTGGGCTGAGCCAGG - Intergenic
1123109453 14:105858934-105858956 GAGCTGAGCTGGGTTGGGCAAGG - Intergenic
1123109527 14:105859324-105859346 GAGCTGAGCTGGGTTGGGCAGGG - Intergenic
1123109654 14:105859960-105859982 GGGCTGAGCTGGGCTGAGCTAGG - Intergenic
1123109660 14:105859990-105860012 GAGCTGGGCTGGGCTGAGCTGGG - Intergenic
1123109673 14:105860065-105860087 GAGCTGAGCTGGGCTGAGCAAGG - Intergenic
1123109679 14:105860105-105860127 GGGCTGAGCTGGGCTGAGCAAGG - Intergenic
1123109680 14:105860115-105860137 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123109682 14:105860125-105860147 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123109702 14:105860205-105860227 GAGCTGGGCTGGGCTGAGCTGGG - Intergenic
1123109712 14:105860245-105860267 GGGCTGAGCTGGGCTGAGCTGGG - Intergenic
1123109719 14:105860285-105860307 CAGGTGAGCTGAGCTGAGCTGGG - Intergenic
1123109723 14:105860319-105860341 GAGCTGAGCTGAGCTGAGCTGGG - Intergenic
1123185048 14:106508672-106508694 GTGATGAGCTGGGAAGAGGAAGG + Intergenic
1123205863 14:106712898-106712920 GGGATGAGCTGGGAAGAGGAAGG + Intergenic
1123225427 15:17019577-17019599 GATGTGAGGTGGGGGGAGGAGGG + Intergenic
1123723928 15:23083754-23083776 GAGGTGTGCGGAACTGAGGAGGG - Intergenic
1124111316 15:26791749-26791771 GAGGTGAGGGAGGCTGAGGTGGG - Intronic
1124437491 15:29663049-29663071 GAGCTCAGCTGGGCTGGGCACGG - Intergenic
1124618823 15:31262407-31262429 GAGGTGTGCTGTGGAGAGGAAGG + Intergenic
1124791511 15:32731514-32731536 GATGTGAGCCGGGGTGAGGTGGG - Exonic
1125433961 15:39626298-39626320 GTGTTGAGCTGGCCTGAAGATGG + Intronic
1125591777 15:40858803-40858825 GAGGTGCTCTGGGCTCAGGGTGG - Intergenic
1125845123 15:42845210-42845232 GAGTTAAGGTGGGCTGAGGTGGG + Intronic
1126469651 15:48994768-48994790 GAAGTGAGGAGGGATGAGGAAGG - Intronic
1127968610 15:63942188-63942210 GAGGTGAGCCTGTGTGAGGAAGG - Intronic
1128317610 15:66671112-66671134 GAGGGGGGCGGGGCAGAGGAGGG - Intronic
1128430330 15:67587231-67587253 GAGGGGTGCTGGGTTGGGGAAGG + Intronic
1128999261 15:72319472-72319494 GAAGGGGGCTGGGCTGAGGTGGG + Intronic
1129416475 15:75385145-75385167 ACCGTGAGCTGGGGTGAGGAAGG + Intronic
1129684452 15:77677239-77677261 GTGGGGAGCTGTGCTGAGGTGGG - Intronic
1129740850 15:77988861-77988883 CAGGTGAGCCGGGCTGTGGCGGG + Intronic
1129805702 15:78455335-78455357 GAGGTGAGATGGGGAGAGTAGGG + Intronic
1129844564 15:78762351-78762373 GAAGTGAGGTGGGGTGGGGAGGG - Intronic
1130948895 15:88570242-88570264 GAGGAGAGCAAGGCTGGGGAAGG + Intergenic
1131073914 15:89483047-89483069 AAGGTGAGCAGGGCTCAGAATGG - Exonic
1131117078 15:89802258-89802280 GAGGAGAGCTTGGCTTAGGAGGG + Intronic
1131186941 15:90282464-90282486 ACTGTGAGCTGGGGTGAGGAGGG + Intronic
1132482098 16:171905-171927 GAGGGGATGTGGGGTGAGGAAGG - Intergenic
1132615765 16:840496-840518 GGGCTGGGCTGGGCTGGGGAGGG + Intergenic
1132671146 16:1102773-1102795 GAGGTGAGGGGGGCTGGGGGAGG - Intergenic
1132689408 16:1175808-1175830 GAGTTGGGCTGGGCTTGGGATGG + Intronic
1132708031 16:1254877-1254899 AAGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132764245 16:1526343-1526365 CAGGTCAGCAGGGCTGAGCACGG - Intronic
1132847170 16:2005953-2005975 GCGGGGAGCTGGGCAGAGGCAGG + Intronic
1133303434 16:4796419-4796441 GAGGGGAGCTGGTCTCAGGCCGG + Exonic
1133304405 16:4800594-4800616 GGGGTGAGCTGGGCAGTGGGGGG + Intronic
1133440928 16:5820386-5820408 GAGAAGAGGTGGGGTGAGGAAGG + Intergenic
1133558983 16:6932395-6932417 GAGATGATCTGGGCTGGGCATGG - Intronic
1134031211 16:10993898-10993920 AAGGTGACCTGGGATGGGGAAGG + Intronic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1134649580 16:15898143-15898165 GAGGAGGGCTGGGAGGAGGAAGG - Intergenic
1134788677 16:16968545-16968567 GAGGTGAGGTGGGGAGAGGTGGG - Intergenic
1135324173 16:21515452-21515474 GAGGTGGGCTTGGCTGAGTCTGG - Intergenic
1135892549 16:26370657-26370679 GGGTAGAGTTGGGCTGAGGATGG - Intergenic
1136044151 16:27602229-27602251 GAGTTGAGAAGGGCTGAGGGAGG - Intronic
1136139286 16:28278316-28278338 GAGGTGGGGTGGGGTGAGGGAGG - Intergenic
1136186902 16:28593612-28593634 GAGATGAGCTGGCCTGGGGCAGG - Intronic
1136335654 16:29608724-29608746 GAGGTGGGCTTGGCTGAGGCTGG - Intergenic
1136449117 16:30342785-30342807 GAGGGCAGGTGGGCGGAGGAGGG - Intergenic
1136890996 16:33973440-33973462 GGGATGAGCTGGGAAGAGGAAGG + Intergenic
1137508194 16:49075299-49075321 AAGATGACCTGGGCTGAGCATGG + Intergenic
1137666675 16:50253777-50253799 GTGGTGAGGTGGGTTGAGGTGGG + Intronic
1138183782 16:54961212-54961234 GAGGGGAGATGGGATGGGGAGGG + Intergenic
1138416709 16:56875844-56875866 GAGGTGAGCTGGGTAGAGGTGGG - Intronic
1138439205 16:57024201-57024223 GGGGTGAGCAGGGATGGGGAGGG + Intronic
1138445350 16:57059749-57059771 GGGCTGAGTTGGGCTTAGGATGG - Intronic
1138887906 16:61102751-61102773 GAGGTGAGCTTGGCAAGGGAGGG - Intergenic
1139331987 16:66200070-66200092 GAGGTGTGGTGGGCTGGGGGAGG - Intergenic
1139849748 16:69943824-69943846 GGGACCAGCTGGGCTGAGGAGGG - Intergenic
1139878742 16:70166821-70166843 GGGACCAGCTGGGCTGAGGAGGG - Intergenic
1140010455 16:71126482-71126504 TGGCTGAGCTGGGCTGAGGCAGG + Intronic
1140010595 16:71127780-71127802 TGGCTGAGCTGGGCTGAGGCAGG - Intronic
1140212682 16:72983297-72983319 GAGGTAATCTGGGCAGAGGAAGG + Intronic
1140373774 16:74428671-74428693 GGGACCAGCTGGGCTGAGGAGGG + Intergenic
1140725455 16:77807530-77807552 GAGGGAAGCTGGACTGGGGACGG - Intronic
1141258992 16:82433324-82433346 GAGGAGAGCAGGGGAGAGGAGGG - Intergenic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1141693134 16:85607612-85607634 GAGGTGACCTGGGCTACTGAGGG + Intergenic
1141763914 16:86046321-86046343 AAGGTGAGAGGGGGTGAGGAGGG + Intergenic
1142036384 16:87864560-87864582 GAGGTGGGCTTTGCTGAGGCTGG - Intronic
1142260358 16:89039949-89039971 GGGGTGAGCTGGGCTGAGCTGGG - Intergenic
1142274633 16:89111341-89111363 GAGATGAGATGGGCTGGGGCTGG + Intronic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1203082039 16_KI270728v1_random:1150166-1150188 GGGATGAGCTGGGAAGAGGAAGG - Intergenic
1143371269 17:6441545-6441567 GAGGTGTTAGGGGCTGAGGAAGG + Intergenic
1143379010 17:6484196-6484218 GAGGTAGGCTGGGCTTCGGAGGG - Exonic
1143497903 17:7322902-7322924 CAGGTGGTCTGGGCTGAGGGTGG + Intronic
1143642996 17:8210242-8210264 GAGGAGAGCTGGGCGGAGAAGGG + Exonic
1143712937 17:8746160-8746182 GAGGGGAGCAGGGCTGGGGTGGG - Intergenic
1144468820 17:15518801-15518823 AAGGTGACTTGGCCTGAGGAAGG - Intronic
1144670509 17:17130175-17130197 GGGCTGAGCTGGGCTGAGGGTGG + Intronic
1144783237 17:17818134-17818156 GAGGTGGGCAGGGCAGAGGGTGG + Intronic
1144825737 17:18104751-18104773 GAGGTGCCCTGGGCTGGGGGTGG + Intronic
1145934365 17:28706233-28706255 CAGCTCAGCTGTGCTGAGGAAGG - Intronic
1145960248 17:28883030-28883052 GAGGTGTGCAGGGCTGGGCAGGG - Intronic
1146374680 17:32286045-32286067 GAGCTGAGCTGAGCAGGGGAGGG + Intronic
1146655717 17:34633615-34633637 GAGGTGGGCGGGGCTGGAGAGGG + Intronic
1146945445 17:36870127-36870149 CAGGGGAGCTGGGGAGAGGAGGG + Intergenic
1147338330 17:39739878-39739900 GGGGTGAGCAGGGAGGAGGAAGG - Intronic
1147816174 17:43212264-43212286 GAGCTGAGCTGGGCGGTGGTGGG - Exonic
1148083446 17:44980054-44980076 CAGGTGAGCTGTGGTGAGGGTGG - Intergenic
1148347147 17:46910893-46910915 GAGGTGGGTTGGTCTGGGGAAGG + Intergenic
1148617880 17:49014033-49014055 TAGGTGAGAGGGGCTGGGGAGGG + Intronic
1148684943 17:49495927-49495949 GGGGCGAGCTGGGCTGGGGCGGG + Intronic
1148693565 17:49546280-49546302 GTGGTGAGCTGGGTGGAGGTGGG + Intergenic
1148732333 17:49845121-49845143 GAGGTGAGTGGGGATAAGGAGGG - Intronic
1148771974 17:50072545-50072567 GGGGTGGGGTGGGGTGAGGATGG + Intronic
1148794185 17:50189323-50189345 GAGGTGTGCAGAGCTGGGGAGGG - Intronic
1148886658 17:50778337-50778359 GAGGGGAGCTGTGCTGTGTATGG + Intergenic
1149428492 17:56577968-56577990 GAGGGGGGCTGGGCAGAGGTTGG + Intergenic
1150561889 17:66302223-66302245 GAGGAGAGCCGGGCGCAGGAAGG + Intergenic
1151215772 17:72575486-72575508 GGGGTGGGCTGGGCTGAGGGTGG - Intergenic
1151415162 17:73957297-73957319 GCGCTGAGCTGGGCTGAGCTGGG - Intergenic
1151476070 17:74344966-74344988 GACCTGGGCTGGGCAGAGGAGGG + Intronic
1151656421 17:75498378-75498400 GAGGTAGGCTGGGGTGGGGAGGG - Intronic
1151728884 17:75899468-75899490 CAGGGGAGCTGGCCTGAGGCCGG + Intronic
1151826722 17:76527902-76527924 GTGGGGAGCTGGTCTGAGAAGGG + Exonic
1151966094 17:77432568-77432590 GGGTTAAGCTGGCCTGAGGAGGG - Intronic
1151977871 17:77492606-77492628 GCGGTGATCTGGGATAAGGAGGG - Exonic
1152092841 17:78256606-78256628 GAAGTGAGCAGGGGTGGGGATGG + Intergenic
1152162462 17:78677350-78677372 GAGGGGGGCTGGGCTGCGGTCGG + Intronic
1152410407 17:80120211-80120233 GAGGTGAGGTGGGGTGGGGAGGG - Intergenic
1152410441 17:80120288-80120310 GAGGTGAGGTGGGGAGGGGAAGG - Intergenic
1152410464 17:80120334-80120356 GAGGTGAGGTGGGGTGGGGAGGG - Intergenic
1152410550 17:80120538-80120560 GAGGTGAAGTGGGATGGGGACGG - Intergenic
1152840155 17:82561973-82561995 GATGTGTGCTGGGCTGAGTGTGG + Intronic
1152848591 17:82617795-82617817 GAGGTCAGCTGGGCTGGGGCAGG + Intronic
1152861342 17:82698386-82698408 GAGGGGCGCGGGGCTGGGGAGGG - Intronic
1153027659 18:686338-686360 GAGGAGAGCGGGGCTGAAAAGGG + Intronic
1153448190 18:5196980-5197002 GAGGGGAGCAGGGTAGAGGACGG - Intronic
1153622202 18:6989819-6989841 GATGTGTGGGGGGCTGAGGAAGG - Intronic
1153622290 18:6990435-6990457 GATGTGTGGGGGGCTGAGGAAGG + Intronic
1155155924 18:23157405-23157427 TAAGTGAGATGGGCTGAGGCAGG - Intronic
1155505854 18:26532087-26532109 GTGGTATGCTGGGATGAGGATGG + Intronic
1156479619 18:37427729-37427751 GAGGTGATCAAGGCCGAGGAAGG - Intronic
1157477792 18:48034519-48034541 GAGGAGTGCTGGGAGGAGGAGGG - Intronic
1157576529 18:48747408-48747430 GAGGTACGCTGGGCAGGGGAAGG + Intronic
1157844854 18:50993770-50993792 GTGGTGTGCAGGGCTGGGGAGGG - Intronic
1158227312 18:55214718-55214740 TAGGTGAGCTGGGCTCAGTGGGG - Intergenic
1158346757 18:56523834-56523856 GAGGTGGGCTGGGCTGGTTAGGG - Intergenic
1158580251 18:58674479-58674501 GAGGTTGGCTGGGGTGAGAAGGG + Intronic
1158963378 18:62604245-62604267 GGGGAGAGATGGGCTGAGGGAGG + Intergenic
1158973458 18:62689265-62689287 GAGACGAGCAGGGGTGAGGATGG - Intergenic
1160065100 18:75566959-75566981 GAGGTGAGATAGGCTGACCAAGG + Intergenic
1160327969 18:77968059-77968081 GAGGTGCACTGGGCTGAATAGGG + Intergenic
1160906467 19:1453802-1453824 GAGGTCAGCCGGGCTGGGGAGGG - Intronic
1160914429 19:1490017-1490039 AAGCTGAGCTTGGCTGAGGCAGG + Intronic
1161400836 19:4065763-4065785 GAGGGGAGGGGGGCTGGGGACGG + Intronic
1161410072 19:4112237-4112259 GAGGAGACCTGGGGTCAGGACGG + Intronic
1161611603 19:5246086-5246108 GGGGTGAGGTGGGGTGAGGTTGG + Intronic
1161777395 19:6271029-6271051 GGAGTGAGCTGGGCTGAGCTGGG - Intronic
1162722963 19:12673266-12673288 GTGGTCAGCTGTTCTGAGGACGG + Exonic
1162801371 19:13112605-13112627 AAGCTGAGCAGGTCTGAGGAGGG + Intronic
1162813772 19:13180971-13180993 GAGGATAGATGGGCTGAGGCAGG + Intergenic
1162974023 19:14198155-14198177 GAGGTGAGGGCGGCTGGGGAGGG + Intronic
1163039905 19:14594475-14594497 GGTGAGGGCTGGGCTGAGGATGG - Intronic
1163263905 19:16206946-16206968 GAGGTCAGCTGGGAAGAGGGCGG + Intronic
1163448589 19:17362197-17362219 GATGGGAGCTGGGCAGAGGCTGG - Intronic
1163792710 19:19317318-19317340 GAGATGATCTGGGCAGAAGAAGG + Intronic
1164394580 19:27851669-27851691 GGGGTGAGCCAGGCTCAGGATGG + Intergenic
1164807726 19:31129737-31129759 GAGGCGGGCTGAGCTGAGGGAGG - Intergenic
1164920866 19:32087677-32087699 GAGGTCAGCTGGACTGGGGGTGG - Intergenic
1164996063 19:32720765-32720787 GAGGTGGGGTGGGCTGCGGCTGG - Intronic
1165064914 19:33223474-33223496 AAGGTGGGGTGGGCTGGGGAGGG + Intronic
1165312196 19:35035144-35035166 GAGGTGAGATGGGGAGAGGGTGG + Intronic
1165479095 19:36051400-36051422 GAAGGGATCTGGGCAGAGGAGGG + Intronic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1165805850 19:38580203-38580225 CCGGGCAGCTGGGCTGAGGAGGG + Intronic
1165827141 19:38711892-38711914 GAGGTCAGCTGGGCCCAGGAGGG - Intronic
1165849703 19:38842707-38842729 GAGGTGACCTGGAGTGAGGGCGG - Intronic
1166808437 19:45500559-45500581 CAAGTGAGTTGGGGTGAGGAAGG + Exonic
1166827225 19:45616953-45616975 GAAGTGACCTGGGCTGGGCACGG + Intronic
1167045750 19:47047923-47047945 GAGGTGATCTAGGCTGCAGAGGG - Intronic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
1167602012 19:50459845-50459867 GAGGTGAGGAGGGATGAGGGTGG + Intronic
1167613267 19:50517468-50517490 AAGGTGGGCTGGGCTGTGGGAGG + Exonic
1167622177 19:50566526-50566548 GAGGTGAGGAGGTCTGGGGAAGG + Intronic
1168187262 19:54708255-54708277 GAGGGGCACTGGGCTGAGGTGGG + Intergenic
1168318265 19:55493724-55493746 GCCGAGAGCTGGGCTGCGGAGGG + Exonic
1168647106 19:58066660-58066682 GTGGTGAGATGGGAAGAGGAAGG - Intronic
925018312 2:548223-548245 GAGGGGCGCTGTGCTCAGGAGGG - Intergenic
925246368 2:2387156-2387178 GAGGTGTGGAGGGCTGTGGAAGG - Intergenic
925259987 2:2520682-2520704 GAGGAGAGCTGGGCTGACAGGGG - Intergenic
925266162 2:2568005-2568027 CAGGCGACCTGGGCTGAGGACGG - Intergenic
926105424 2:10146663-10146685 GAGCTGAGATGGGGTGGGGATGG + Intronic
926119208 2:10232481-10232503 GAAGTCTCCTGGGCTGAGGATGG - Intergenic
926243231 2:11103733-11103755 GAGGTGAGCCCGGCTGGGGTGGG + Intergenic
926843695 2:17110053-17110075 AAGGTTAACTAGGCTGAGGATGG + Intergenic
927257656 2:21054232-21054254 GAGCTGACCTGCCCTGAGGATGG - Intergenic
927304126 2:21550798-21550820 GAGATGAACTGGGCAAAGGATGG + Intergenic
927515063 2:23667496-23667518 GAGGTGACCTGCCCAGAGGAGGG - Intronic
927681735 2:25144076-25144098 GAGATGGCCTGGCCTGAGGATGG + Intronic
927713707 2:25340544-25340566 GAGGGGAACTGGGGTGAGGGCGG + Intronic
927990905 2:27446240-27446262 AAGGTGAGCTGGGACAAGGAAGG - Exonic
928229559 2:29485692-29485714 GGGGTGAGCCTGGCTGGGGAAGG - Intronic
928233532 2:29520767-29520789 GGGGTGAGCCAGGCTCAGGAGGG + Intronic
928283208 2:29966592-29966614 AATGTGAACTGGGCTGAGCAGGG - Intergenic
929195490 2:39180406-39180428 GAGGTCAGCTGGGGTCAGGGAGG - Intronic
930232957 2:48860960-48860982 GGGCTTAGCTGAGCTGAGGAAGG + Intergenic
930752015 2:54943414-54943436 GAGGAGAGCTGGGTGGAGGTGGG - Intronic
931664263 2:64599043-64599065 GAGGTGGGACGGGCAGAGGAAGG - Intergenic
932430981 2:71673369-71673391 CAGGCGAGCTGGTCTGAGGGAGG + Intronic
932485275 2:72080848-72080870 AAGCTGAGGGGGGCTGAGGAGGG + Intergenic
932773039 2:74512377-74512399 GCTGTTAGCAGGGCTGAGGAGGG + Intergenic
933022271 2:77208628-77208650 GAGGTGAGGTTTTCTGAGGATGG + Intronic
934301020 2:91776105-91776127 GAGGTGAGCGGGGCAGGGCATGG + Intergenic
934572645 2:95382508-95382530 GAGGGGAGCCTGGCAGAGGAAGG + Intronic
935539802 2:104336101-104336123 GAGGTGAAGTGGGGTGAGGGTGG - Intergenic
935667521 2:105525479-105525501 GAGGTGGGGAGGGCTGAGGGTGG + Intergenic
936428239 2:112436947-112436969 GAGCAGAGCTGGGCTGTGTAGGG + Intergenic
936564362 2:113571665-113571687 CAGGAGAGCTGGACAGAGGAAGG + Intergenic
937275463 2:120681320-120681342 GGCTTGTGCTGGGCTGAGGATGG - Intergenic
937639954 2:124200914-124200936 GAGGTGATTTGGCCTGAAGATGG - Intronic
937891202 2:126940335-126940357 GAGAGGAGTTTGGCTGAGGATGG - Intergenic
937920036 2:127122385-127122407 GGAGGGAGCTGGGCCGAGGATGG - Intergenic
938383441 2:130849078-130849100 GAGGTGCTCTTGGCTGGGGATGG - Intronic
939026651 2:137021915-137021937 GAGATCAGCAGGGCTCAGGATGG + Intronic
939026696 2:137022732-137022754 GAGATCAGCAGGGCTCAGGATGG + Intronic
939053531 2:137334317-137334339 GAGCTGGGATGAGCTGAGGAGGG - Intronic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941169498 2:162119411-162119433 GAGCTGAGCTGAGCTGAGACAGG - Intergenic
942708333 2:178802305-178802327 GAGGTGAGCTGGTTTAGGGATGG - Exonic
944809315 2:203312310-203312332 GAGCAGAGCTGGGGAGAGGAAGG + Intergenic
944860330 2:203810165-203810187 GAGGTGATCCTGGCAGAGGAGGG + Intergenic
944933414 2:204544058-204544080 GAAGAGAGCTGGCCTGAGAATGG + Intergenic
945519256 2:210802880-210802902 AAAGTGAGCTGGGATGAGCATGG - Intergenic
945943914 2:215975994-215976016 TGGGGGAGCTGGGCTGAGGCAGG + Intronic
946058530 2:216921327-216921349 GAGGTGGGCTGCCCTGAGAAGGG - Intergenic
946143332 2:217710350-217710372 GATGTGAGATGGCCTGAGAAAGG - Intronic
946253204 2:218425939-218425961 GAGGTGACCTGGGGCGGGGAAGG + Intronic
946306531 2:218859757-218859779 GAGGGGAGCGGGGCCGAGGCGGG - Intergenic
946368549 2:219266314-219266336 CAGCTGAGGTGGGCAGAGGAGGG - Intronic
946420616 2:219562551-219562573 GAGGTGCGCTGGACCAAGGATGG - Exonic
946705464 2:222454415-222454437 TAGGAGAGCTTGGATGAGGAAGG + Intronic
946811539 2:223530776-223530798 GAGGAGAGCTGGAGAGAGGATGG - Intergenic
946903731 2:224396413-224396435 GAGGGGAGCTAGGCCGAGGAGGG - Intronic
947232788 2:227904788-227904810 GCGGTTGGCTGGGGTGAGGATGG - Intronic
947579081 2:231300881-231300903 GAAGTGAGATGAGTTGAGGAAGG + Intronic
947701853 2:232241011-232241033 GTGGGGAGCTGGGTGGAGGAAGG + Intronic
947743805 2:232497380-232497402 GAGGTGGTCTGTGCTGGGGATGG - Intergenic
948073298 2:235144872-235144894 GGGGTGATCTGGGCTTAGGCTGG + Intergenic
948173943 2:235928590-235928612 GAGGAGAGCAGGGCGGAGAAGGG + Intronic
948310876 2:236985689-236985711 GTGGAGAGCTAGGCTGGGGAAGG - Intergenic
948348762 2:237321333-237321355 AAGGTGGCCTGGGCTGAGTATGG - Intergenic
948372821 2:237501051-237501073 ACGGTGAGCAGGGGTGAGGAGGG - Intronic
948376182 2:237521987-237522009 GAGTGGAGCTGGGCTGAGACTGG + Intronic
948376225 2:237522231-237522253 GAGTGGAGCTGGGCTGAGACTGG + Intronic
948376266 2:237522475-237522497 GAGTGGAGCTGGGCTGAGACTGG + Intronic
948386593 2:237584632-237584654 CAGGTGAGCTGGACTGGGGATGG - Intronic
948454205 2:238097174-238097196 GGGGTGGGCTGGGGTGGGGATGG + Intronic
948584361 2:239009680-239009702 GCGGGAAGCTGGTCTGAGGAAGG - Intergenic
948696950 2:239737465-239737487 GGGCTGGGCTGGGCTGGGGATGG - Intergenic
948792340 2:240385546-240385568 GAGCTGGGCTGGGCTGAGCCGGG + Intergenic
948792414 2:240385837-240385859 GAGCTGGGCTGGGCTGAGCTGGG + Intergenic
948792424 2:240385887-240385909 GAGCTGGGCTGGGCTGAGCTGGG + Intergenic
948792439 2:240385972-240385994 GAGCTGAACTGGGCTGAGCTTGG + Intergenic
948792468 2:240386087-240386109 GAGGTGGGCTGGGATGAGCTTGG + Intergenic
948850836 2:240704540-240704562 CAGGGGGGCTGGGCTGGGGAGGG - Intergenic
948856661 2:240733416-240733438 GATGGTGGCTGGGCTGAGGAGGG - Intronic
948861517 2:240754958-240754980 GAGGGGAGCAGGGCTGGGGAGGG - Intronic
949033303 2:241806307-241806329 GAGGTTCCCTGGGCTGAGGGGGG - Intergenic
1168785742 20:538685-538707 GAGCTGAGCTGGGGTGGGGTGGG + Intronic
1168797365 20:620507-620529 GAGCTGAGCAGGGCTCTGGAGGG + Intergenic
1168893889 20:1310765-1310787 GGGGTGAGGAGGGGTGAGGAGGG + Intronic
1169111891 20:3039573-3039595 GTGGTGAGCTGCTCTGAGGCTGG - Intergenic
1169196021 20:3682254-3682276 GGGTGGAGCTGGGCGGAGGAGGG + Intergenic
1169393701 20:5211768-5211790 GAGGTGAGAGGGGGTGGGGAGGG - Intergenic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1170743180 20:19075613-19075635 GAAGGAAGCTGGGCTGGGGAGGG - Intergenic
1170770722 20:19330201-19330223 GGGCAGGGCTGGGCTGAGGAGGG + Intronic
1172226291 20:33307145-33307167 AAGGTTGGCTGTGCTGAGGATGG + Intronic
1172526289 20:35602087-35602109 GAAGTGAGCCGGGGTGAGGTGGG - Intergenic
1172757874 20:37299944-37299966 CTGGAGAGCTGGGCTGAGGCTGG + Intronic
1172764300 20:37342975-37342997 AGGGTGAGCTGGGCTGGGGCTGG + Intergenic
1172894754 20:38292589-38292611 GAGGCGAGCTGGGGTGGGGTTGG + Intronic
1172919721 20:38471443-38471465 GAGGAGGGCTGTGCTGAGGAAGG - Intergenic
1172950752 20:38722254-38722276 GAGATGATCTGGGCAGAGGCTGG - Intergenic
1172951205 20:38724448-38724470 GGCGCGAGCTGGGCTGCGGAGGG - Exonic
1173153121 20:40584712-40584734 GAGCTGAGCTGAGCTGGAGAAGG - Intergenic
1173256315 20:41396249-41396271 CAGGAGAGCTGGGCCGAGGAAGG - Intergenic
1173461632 20:43247762-43247784 GAGATGTCCTGGGTTGAGGAAGG + Intergenic
1173480318 20:43393474-43393496 GTGCTGGGCTGGGGTGAGGAAGG - Intergenic
1173827019 20:46054677-46054699 GTCCTGTGCTGGGCTGAGGAGGG + Intronic
1173878641 20:46393791-46393813 GAGGTGTGCAGAACTGAGGAGGG + Intronic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1174064213 20:47852939-47852961 GAGCTGGGCTGGGCTGGGCAGGG + Intergenic
1174393141 20:50230411-50230433 GACTTGAGCTGAGCTGAGGTGGG - Intergenic
1174443725 20:50576470-50576492 GAGGTGAGCAGGTGTGAGGGAGG + Intronic
1174517464 20:51103587-51103609 GAGATGGGCTGGTCAGAGGAGGG - Intergenic
1174548210 20:51342274-51342296 GAGGGGCGCCGGGCTGAGGCAGG + Intergenic
1175581127 20:60100645-60100667 AATGTGAGTTGGGCTGTGGAGGG + Intergenic
1175766119 20:61594133-61594155 GAGGTGAGCTGGGGGGAAGAGGG + Intronic
1175766153 20:61594225-61594247 GAGGGGGGCTGAGCTGAGCAGGG + Intronic
1175780715 20:61680328-61680350 GAGGGGCGCTGGGCTGGGCAAGG + Intronic
1175856459 20:62123111-62123133 GAGGTGGGCTGGGCGGCCGAGGG - Intronic
1175988631 20:62776751-62776773 GAGGAGGGCAGGGCGGAGGAGGG + Intergenic
1176001233 20:62832187-62832209 CAGGTGAGCTGGGCACAGGCTGG + Exonic
1176032251 20:63018171-63018193 GAGGTCCTCTGGGCTGAGCAGGG + Intergenic
1176102328 20:63370216-63370238 GGGGAGGGCAGGGCTGAGGAGGG - Intronic
1176242518 20:64081605-64081627 CAGGTGAGCTGGGCAGTTGATGG + Intronic
1176249578 20:64114019-64114041 GAGACGAACTGGGCTGGGGAAGG + Intergenic
1176310404 21:5146104-5146126 GAGGTGTGGTGGGCTGTGGCGGG - Intronic
1176374013 21:6078264-6078286 GAGCAGAGCTGGGCTGTGTAGGG - Intergenic
1176937716 21:14885785-14885807 GAGGTGACCTGAACTGAGGTGGG - Intergenic
1177832856 21:26158772-26158794 AAGGTGAACTGGGGTGGGGAGGG - Intronic
1178205873 21:30464381-30464403 GAGATGAGCTAGGCTTTGGAAGG - Intergenic
1178792720 21:35714727-35714749 GAGGTGAGGTGAGGTGAGGGAGG + Intronic
1178818078 21:35949903-35949925 GTGATGAGATGGGATGAGGATGG - Intronic
1179099947 21:38347661-38347683 AGGATGTGCTGGGCTGAGGAGGG - Intergenic
1179416595 21:41203454-41203476 TAGGTGAGCTGTGGGGAGGAAGG + Intronic
1179598098 21:42456763-42456785 GAGGGGGCGTGGGCTGAGGAGGG - Intergenic
1179647474 21:42784601-42784623 GGGGTGAGGTGGGGTGAGGTAGG - Intergenic
1179647482 21:42784622-42784644 GGGGTGAGGTGGGGTGAGGTAGG - Intergenic
1179647490 21:42784643-42784665 GGGGTGAGGTGGGGTGAGGTAGG - Intergenic
1179647530 21:42784737-42784759 GGGGTGAGGTGGGGTGAGGCAGG - Intergenic
1179749464 21:43459979-43460001 GAGCAGAGCTGGGCTGTGTAGGG + Intergenic
1179846651 21:44115931-44115953 GAGGTGTGGTGGGCTGTGGCGGG + Intronic
1179928321 21:44550597-44550619 GTGCTGAGCTGTGCTGAGGCTGG + Exonic
1179939359 21:44628122-44628144 GTGTTGAGCTGTGCTGAGGCTGG - Exonic
1180037796 21:45258711-45258733 GAGGTGAGCTGGGCGGCCGCGGG + Intergenic
1180041369 21:45282062-45282084 GGGCTGAGCTGGGCTGGGGGCGG - Intronic
1180816130 22:18791039-18791061 GAGGTGAGCGGGGCAGGGCATGG - Intergenic
1180855368 22:19041751-19041773 GGGGTGACCTGGGGTGGGGATGG + Intronic
1181045334 22:20211591-20211613 GAGGAGAGGTGGGCTGTGGCTGG + Intergenic
1181183121 22:21080937-21080959 GATGTGTGCCGGGCAGAGGATGG - Intergenic
1181202317 22:21225371-21225393 GAGGTGAGCGGGGCAGGGCATGG - Exonic
1181521271 22:23450010-23450032 GAGCTGAGCTGGGCTGGGCCTGG + Intergenic
1181699383 22:24611243-24611265 GAGGTGAGCAGGGCAGGGCATGG + Exonic
1182092040 22:27602537-27602559 GAGGTGGGCGGGGCTGGGGTGGG + Intergenic
1182098169 22:27639588-27639610 GAGGGGAGCGGGGCTGGGTAAGG + Intergenic
1182312297 22:29417881-29417903 GTAGTGAGCTGGGGTGATGAGGG + Intronic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182503306 22:30764279-30764301 GGGGTGGGCGGGGATGAGGAGGG + Intronic
1182511162 22:30821529-30821551 GAGGTGGGGAGGGTTGAGGAAGG + Intronic
1183094408 22:35543489-35543511 GAGGTCAGCCTGGCTGAGGATGG + Intronic
1183252867 22:36742810-36742832 GAGAGAAGCTGGGCAGAGGAGGG + Intergenic
1183394915 22:37566274-37566296 GAGGTGGGCTGGGCTTGGGATGG - Exonic
1183653367 22:39171603-39171625 GAGGGGAGCTGGGCAGAACAGGG - Intergenic
1183780953 22:39998518-39998540 GAGGGGGGAGGGGCTGAGGATGG + Intronic
1184067154 22:42127412-42127434 GTGCTGAGCTGGGGTGAGGAGGG + Intronic
1184069879 22:42141117-42141139 GTGCTGAGCTGGGGTGAGGAGGG + Intergenic
1184071626 22:42150720-42150742 GTGCTGAGCTGGGGTGAGGAGGG + Intergenic
1184173835 22:42774868-42774890 GAGTAAAGCTGGGCTGAGCAGGG + Intergenic
1184407400 22:44307971-44307993 GGGGCGTGGTGGGCTGAGGAGGG - Intronic
1184516579 22:44966073-44966095 GAGGAGAGTTGAGCTGTGGAAGG - Intronic
1184663821 22:45977332-45977354 GAAGGGAGCTGGCCTGGGGAGGG - Intergenic
1184955852 22:47885502-47885524 GAGGTGACCGGGGCTGAAGGAGG - Intergenic
1185276446 22:49951998-49952020 GAGGTGGGCTGGGCTGAGTGGGG - Intergenic
1185293471 22:50040844-50040866 GAGAGGAGCTGGGCAGAGGTGGG - Intronic
1185299821 22:50073414-50073436 GAGGGGATCTGGGGTGTGGAGGG + Intronic
1185326299 22:50227436-50227458 CAGGGGAGCTGGGCTGTGAAGGG - Intronic
1185391062 22:50562122-50562144 GGGGTGAGGCGGGGTGAGGAGGG + Intronic
1185391182 22:50562445-50562467 GGGGTGAGGCGGGGTGAGGAGGG + Intronic
1203224593 22_KI270731v1_random:70042-70064 GAGGTGAGCGGGGCAGGGCATGG + Intergenic
1203266233 22_KI270734v1_random:16750-16772 GAGGTGAGCGGGGCAGGGCATGG - Intergenic
949675439 3:6447920-6447942 GAGGGGAGCTGGGAAGGGGACGG + Intergenic
949736501 3:7178495-7178517 GAGGTGAGCTGAGGTGTGCAAGG - Intronic
949943664 3:9173680-9173702 GAGGTGGGCAGGGGTGGGGAGGG - Intronic
950000077 3:9649752-9649774 GAGGTGCGATGAGCTGGGGAAGG + Intronic
950384349 3:12645743-12645765 GAGGTGGGGTGGGGTGAGGGGGG + Intronic
950706920 3:14788566-14788588 GAGGTGAGATGGGCTGGGCTGGG + Intergenic
950706923 3:14788576-14788598 GGGCTGGGCTGGGCTGAGGTGGG + Intergenic
952118368 3:30211951-30211973 GAGGTGAGCGGAGCGGGGGAGGG - Intergenic
952251671 3:31662255-31662277 AAGAGCAGCTGGGCTGAGGAGGG - Intronic
952258327 3:31714590-31714612 GAGGGGAGCTGAGATGAGAACGG - Intronic
952932266 3:38369480-38369502 GAGGTGGGCTGGGATGCTGATGG - Intronic
952935761 3:38397202-38397224 GACATGGGGTGGGCTGAGGAGGG + Intronic
953383928 3:42493987-42494009 GAGGGGACCTGGGCCCAGGACGG - Intronic
953410490 3:42688078-42688100 GAGTGGGGCTGGGCTGAGGCTGG + Intronic
953574399 3:44101415-44101437 GAGTTCAGGTTGGCTGAGGAGGG - Intergenic
953681156 3:45039374-45039396 GGGATGGGCTGGGGTGAGGAAGG - Intergenic
953887006 3:46719797-46719819 GAGGAAAACTGGGCTCAGGAAGG + Exonic
953982409 3:47419308-47419330 GAGGTGAGCTGGGCCGTGCCAGG - Exonic
954293804 3:49663201-49663223 GAGCAGAGCTGGGCTGAGAGTGG - Exonic
954365671 3:50144902-50144924 CATGTGGGCTGGGCTGAGGTGGG - Intergenic
954795629 3:53160233-53160255 GAGGTGGCCTGAGCTGAGAAAGG - Intronic
955947898 3:64212966-64212988 AAGGTGTGCTGGACTGAGCAAGG + Intronic
956736607 3:72243392-72243414 CAGGTGGGCTGGGAGGAGGAGGG + Intergenic
956763785 3:72466755-72466777 GCAGTCAGCTGGGCTGAGGTTGG - Intergenic
957163274 3:76637295-76637317 GAGCTGACCTGGACTTAGGAAGG + Intronic
958514295 3:95092527-95092549 GAGGTGGACTTGGCTGAGGATGG + Intergenic
959587552 3:108039302-108039324 GAGGAGAGCAGGGCTGTGGTGGG - Intergenic
960575006 3:119220654-119220676 GGGGTGAGCTGGAGTGGGGAGGG + Intronic
960914266 3:122680865-122680887 GCGGAGAGCGGAGCTGAGGATGG + Exonic
961059427 3:123815955-123815977 AATCTGAGCTGGGCTGAGCAGGG - Intronic
961591166 3:127982858-127982880 GCTGTGAGCGGGGCTTAGGAAGG - Intronic
961594611 3:128006624-128006646 GAGGTGGGATGGGCTGAGGGAGG + Intergenic
961635592 3:128330779-128330801 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635608 3:128330836-128330858 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635623 3:128330892-128330914 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635632 3:128330921-128330943 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635640 3:128330949-128330971 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635649 3:128330978-128331000 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635665 3:128331035-128331057 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635698 3:128331148-128331170 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635710 3:128331197-128331219 GAGGGGAGATGTACTGAGGAAGG - Intronic
961635717 3:128331226-128331248 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635726 3:128331255-128331277 GAGGGGAGATGTACTGAGGAAGG - Intronic
961635751 3:128331341-128331363 GAGGGGAGATGCACTGAGGAAGG - Intronic
961635784 3:128331460-128331482 GAGGGGAGATGCACTGAGGAAGG - Intronic
961650945 3:128416375-128416397 GAGCTGGGCGGGGCTGAGGTGGG - Intergenic
962605385 3:137028638-137028660 GAAGGGAACTGGGCTCAGGAAGG + Intergenic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
964627286 3:158771864-158771886 AAGGTGTGCTGGGCCGAGGGAGG - Intronic
965541685 3:169877790-169877812 GAGGTGAGCTGGCTTGGGGGTGG - Intergenic
966551791 3:181213571-181213593 GTGGTGTGCTGGGCTGAGTGGGG + Intergenic
966863727 3:184244724-184244746 GGGGTGAGCAGGGGAGAGGAAGG + Intronic
967009824 3:185422266-185422288 GGAAGGAGCTGGGCTGAGGAAGG + Intronic
967762545 3:193241531-193241553 GAGGTGTGCTGGGCGGAGTGGGG + Exonic
967888343 3:194347818-194347840 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888366 3:194347896-194347918 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888422 3:194348075-194348097 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888445 3:194348153-194348175 GGGCTGAACTGGGCAGAGGATGG - Intronic
967941207 3:194768032-194768054 GAGTAGAGCTGGGGTGAGGTGGG + Intergenic
968469143 4:770291-770313 GGGGAGGGCTGGGGTGAGGAAGG - Exonic
968524582 4:1049487-1049509 GAGGTGAGCAAGGCTGAGGGAGG - Intergenic
968528616 4:1077920-1077942 GAGGTGAGCTGGGCAGGGAGAGG + Intronic
968596165 4:1486813-1486835 GAGGAGAGCAGGGCTGTGGGAGG - Intergenic
968612828 4:1564820-1564842 TTGTTGAGCTGGGCTGCGGAGGG - Intergenic
968697677 4:2040985-2041007 GAGGTCGGCTAGGCTGGGGAGGG + Intronic
968844269 4:3031239-3031261 GACGTGAGCAGGGCTGTGAACGG + Intronic
968909858 4:3472171-3472193 GAGGTGGGCACGGCTGGGGAGGG + Intronic
968984155 4:3866211-3866233 GGGGTGAGCTGGGTGGACGAGGG + Intergenic
969202696 4:5618375-5618397 GAGGTGAGATGGGCTCAGGCTGG + Intronic
969335113 4:6503222-6503244 GGAGTGGGGTGGGCTGAGGAAGG - Intronic
969517266 4:7654668-7654690 CAGGAGAGCAGGGCTGAGGCAGG - Intronic
969878001 4:10150182-10150204 CCAGAGAGCTGGGCTGAGGATGG - Intergenic
969903164 4:10368606-10368628 GATGGTAGCTGGCCTGAGGAGGG + Intergenic
969941326 4:10734856-10734878 CAGGTGAGCTGAGTTGAGGTGGG + Intergenic
970088757 4:12378946-12378968 TTGGTGCGCTGGGCTGAGGTAGG - Intergenic
970922676 4:21413246-21413268 GAGCTAAGCTAGGCTGAGGTTGG + Intronic
971075894 4:23149020-23149042 GCAGTCATCTGGGCTGAGGAAGG + Intergenic
971771262 4:30899773-30899795 GGGGTGAGGTGGGCTGGGAATGG + Intronic
972226890 4:37023819-37023841 GAGCAGAACTGGGCTGGGGAGGG + Intergenic
973708387 4:53601955-53601977 CACGTGAGCAGGGGTGAGGAGGG - Intronic
975538119 4:75473547-75473569 GAGCTAAGGTGGGCTGTGGAAGG - Intergenic
976112243 4:81688294-81688316 GATGTCAGCTGGGTAGAGGATGG + Intronic
976544352 4:86317366-86317388 GAGGTGGGCAGGACTAAGGAGGG - Intronic
977142074 4:93386457-93386479 GAATTGAGCTGAGCTGGGGAGGG + Intronic
977441191 4:97070263-97070285 GAGAGGAGTTGGGCTGGGGACGG + Intergenic
978837887 4:113175481-113175503 GAGGAGTGCTGGGCTGGAGAGGG - Intronic
979442605 4:120769325-120769347 GAAGTGGGCAGTGCTGAGGAGGG + Intronic
981268827 4:142819960-142819982 GAGGTGATGTAGGCTGGGGAAGG - Intronic
981508135 4:145525626-145525648 GGGCTGAGCTGGGCTGAGCTGGG + Intronic
981937798 4:150253589-150253611 GGCGTGAGAGGGGCTGAGGATGG - Intronic
982037706 4:151362604-151362626 AAGGTGAGCAGGGCTGAAGCTGG + Intergenic
982117271 4:152108006-152108028 GAGGAGGGCTGGGCTGGGTAAGG + Intergenic
982137302 4:152283910-152283932 GAGGAGAGCAGTGCTGAGCAAGG + Intergenic
982324802 4:154119394-154119416 AAGGTGAGCTGGGAGGAGGAAGG + Intergenic
985835911 5:2271735-2271757 GAGGAGAGCTGGTCAGGGGAGGG + Intergenic
986259845 5:6134630-6134652 GAGTTCAGCTGGGCTGAGGAGGG + Intergenic
986535442 5:8782108-8782130 GATAGGAGGTGGGCTGAGGATGG + Intergenic
990780323 5:59353701-59353723 GAGGGGAGCAGGGCCGTGGAAGG - Intronic
991640139 5:68743755-68743777 GAGAGGAGCTGGGCTGAGTGGGG + Intergenic
992849904 5:80796846-80796868 GAGGTGGGCAGGGTGGAGGAGGG - Intronic
994788604 5:104195416-104195438 TAGGGGAGCGGGGCTGAGGTGGG - Intergenic
995199465 5:109410277-109410299 GAGGTGGGCTCGGCTGGGGCGGG - Intergenic
996040110 5:118800000-118800022 GAGGTGAGGTGGGTTGATGTGGG - Intergenic
996129309 5:119762349-119762371 GAGGAGAGCTCAGCTGAGGATGG - Intergenic
996532645 5:124542481-124542503 GAGGTGGGCTGGTGTGTGGAGGG - Intergenic
996747871 5:126860969-126860991 GAGTTGTACTGGGATGAGGAGGG + Intergenic
996808886 5:127491279-127491301 CATGTGAGCTGAGCTGGGGAAGG - Intergenic
997230073 5:132235844-132235866 GAGCAGAGCTTGGCTGAGGCGGG + Intronic
997283028 5:132660435-132660457 GAGGTCGGCTAGGCTGAAGACGG - Exonic
997542911 5:134679192-134679214 GTGGTGAGCTGGGTTGAAGTGGG - Intronic
997666181 5:135631157-135631179 AAGGTCAGCTGGGCTGAGCGTGG + Intergenic
999321552 5:150618479-150618501 GAGGAGAGCAGCGGTGAGGAGGG + Exonic
1000027679 5:157374290-157374312 GAGGTGAAATGTCCTGAGGAAGG - Intronic
1000616949 5:163437748-163437770 GAGGTGAGCAGGCCCGGGGAGGG + Exonic
1000898841 5:166889201-166889223 GTAGTGAGCTGGGCTGGGGGCGG + Intergenic
1001295622 5:170496824-170496846 GAGCAGAGCAGGGCTGAGGTGGG - Intronic
1001532355 5:172472428-172472450 GATGTACGCTGGGCAGAGGAGGG - Intergenic
1001846417 5:174925803-174925825 ACTGTGAGCTGGGGTGAGGAAGG - Intergenic
1001893382 5:175358293-175358315 GAGGTGAGCAGGTCAGAGCATGG - Intergenic
1002055729 5:176597079-176597101 GACGTGAGCTGGGACGAGAAGGG - Exonic
1002401131 5:178992096-178992118 AAGGACAGCTGGGCTGTGGATGG + Intronic
1002443474 5:179276024-179276046 GAGGTCAGCAGGGCTGTGGGAGG + Intronic
1002642719 5:180638088-180638110 GAGGGGAGCTGGGGAGAGGTAGG - Intronic
1002859375 6:1066531-1066553 GAGGTGTGCTGGGGAGTGGAGGG + Intergenic
1002999749 6:2319826-2319848 GAGGGGAGCTGGAAAGAGGATGG + Intergenic
1003204325 6:3993219-3993241 GACGTGAGCAGGGCAGAAGAGGG - Intergenic
1003488167 6:6597371-6597393 AACGGGAGCAGGGCTGAGGATGG + Intronic
1003612932 6:7629795-7629817 GATGTGTGATGGGCAGAGGAGGG - Intergenic
1003864342 6:10349637-10349659 CAGGGCAGCTGGGCAGAGGAGGG - Intergenic
1004201741 6:13555065-13555087 GGGAAGAGCTGGGCTGGGGATGG + Intergenic
1004314274 6:14572419-14572441 GGGGTGGGCTGGGGTGAGGCAGG - Intergenic
1005839280 6:29730862-29730884 CGAGTGAGCTGGGCTGAGAATGG - Intronic
1006075762 6:31531281-31531303 GAGGAGAGGTGAGCTGAAGATGG - Exonic
1006213792 6:32421011-32421033 GAGGTGTCATGGGCTCAGGAGGG + Intergenic
1007114018 6:39330550-39330572 GAGGGGTGCTGGCCTGGGGAGGG + Exonic
1007145315 6:39623911-39623933 GAGCTGAGCTGGCCTGAGAGAGG - Intronic
1007472251 6:42098623-42098645 GAGCAGAGCAGGGCTGGGGAAGG + Intergenic
1007692465 6:43711524-43711546 GGGGTGGGTTGGGCAGAGGAGGG + Intergenic
1007711266 6:43825818-43825840 GAGCTGGGCTGGGCTGAGGGTGG + Intergenic
1007748416 6:44057173-44057195 AACCAGAGCTGGGCTGAGGAAGG + Intergenic
1007807457 6:44461094-44461116 CAGGGGAGCTGGGGTGAGGGAGG + Intergenic
1008487458 6:52051557-52051579 GAGGTGAGGTGGGAGCAGGAAGG - Intronic
1009833867 6:68972339-68972361 CAGGAGAGCTGTGCTGAGGTTGG - Intronic
1010328999 6:74599692-74599714 TTGGAGAGCTGGGCTGAGGCTGG - Intergenic
1010767356 6:79791306-79791328 GAGGTTGGCTGGGATGAGGAGGG - Intergenic
1011501076 6:87990707-87990729 GTGGTAATCTGGGGTGAGGAAGG + Intergenic
1013468617 6:110440365-110440387 GAGGAGCTCTGGGCTGGGGATGG + Intronic
1013532137 6:111029854-111029876 GGGGTGAGATGGGTTGGGGAAGG - Intergenic
1018666309 6:166141469-166141491 GAGGTGAGCTGTCCTGTGCAAGG - Intergenic
1018833262 6:167462607-167462629 GAGGTTAGATGGGCTGAGCGTGG + Intergenic
1018844714 6:167547524-167547546 GAGGAGAGATGGGGTGAAGAAGG - Intergenic
1019121989 6:169811228-169811250 GAGGTGGGCTGGGGTGAGGGTGG + Intergenic
1019506266 7:1393036-1393058 GAGATGGGCTGGGGTGAGGTGGG + Intergenic
1019590066 7:1826468-1826490 GAGCTGAGCTGGGCTGGGCCTGG - Intronic
1019607753 7:1918578-1918600 CAGGTGAGCGGGGTAGAGGAAGG - Intronic
1019628294 7:2032588-2032610 GAGCTGTGCTGGGCTGAGTGGGG + Intronic
1019782749 7:2953811-2953833 GAGGTGGGAGGGGCTCAGGATGG - Intronic
1020389893 7:7646752-7646774 GAGGGGAGTTTGGCTGGGGACGG - Intronic
1022248918 7:28587540-28587562 GAGGTGGACTGGGCTGGGGGTGG + Intronic
1022893773 7:34728360-34728382 GAGGCGGGCTGGGCTGAGCTGGG + Intronic
1022947588 7:35302881-35302903 CAGGTGTACTGGGCTCAGGAAGG - Intergenic
1023184306 7:37516916-37516938 GACCTGAGCTGTCCTGAGGAGGG - Intergenic
1023625515 7:42111594-42111616 CAGGAGAGCAGGCCTGAGGAAGG + Intronic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1023759839 7:43455056-43455078 GGGCTGAGCTGGGGTGAGGTGGG - Intronic
1023995577 7:45157447-45157469 GAGGTGAGCTGGGGTGAGCGTGG - Intergenic
1024229523 7:47353731-47353753 GAGGGGTGCTGGGCTGTGGTAGG - Intronic
1024873901 7:53998940-53998962 GCTGTGAGATGGGTTGAGGAGGG + Intergenic
1025026180 7:55518072-55518094 GAGGTGAGCTGGCCTTGGGTAGG + Intronic
1025179686 7:56818447-56818469 GAGCTGGGCTGGGCTGAAGGAGG + Intergenic
1025730167 7:64101398-64101420 GAGGTCAGCTCTGCTGAGGCAGG + Intronic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026674385 7:72416856-72416878 GGGGTGGGCTGGGCTGAGCTGGG + Intronic
1026964570 7:74431042-74431064 GAGGAGTGCTGGGCTGCTGAGGG - Intergenic
1027035267 7:74920614-74920636 GAGGTGGGCGGGGGTGAGAATGG - Intergenic
1027224914 7:76237758-76237780 GAAGGGAGAGGGGCTGAGGATGG - Intronic
1028453797 7:91016547-91016569 CAGGTTGGGTGGGCTGAGGAGGG - Intronic
1028903576 7:96128090-96128112 GGGGTGAGCAGGGCTGAGTGTGG - Intronic
1029250525 7:99232970-99232992 GAGCTGAGCTGGGCGGGGGAGGG + Intergenic
1029394786 7:100300526-100300548 GAGGTGGGCGGGGGTGAGAATGG + Intergenic
1029458263 7:100681844-100681866 TGGGTGAGCTGGGCTGGGGCAGG - Exonic
1031973153 7:128078019-128078041 GAGCTGTGAGGGGCTGAGGATGG + Intronic
1032327820 7:130948405-130948427 CAGGGGAGCTGGGGGGAGGAGGG + Intergenic
1032508995 7:132456791-132456813 CAGGTGGGCTGGGCTGAGGGTGG - Intronic
1032533630 7:132642627-132642649 GTGGTGAGGTGGGCCCAGGAAGG - Intronic
1032698079 7:134355060-134355082 GAGGGGTACTGGGCAGAGGAAGG + Intergenic
1032759766 7:134928981-134929003 GGGTTGAGTTGGGCTGAGAAAGG - Intronic
1033232873 7:139615180-139615202 GCGGAGAGCAGGGCCGAGGAGGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034237537 7:149584438-149584460 GAGGTGTGCTAGGCTGGGGATGG - Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034306589 7:150048814-150048836 GGAGGGAGCTGGGCTGTGGAGGG - Intergenic
1034312410 7:150100321-150100343 GAGGCCAGCTGCACTGAGGATGG - Intergenic
1034401532 7:150864688-150864710 GAGGTGAGCCAGGCTGATCATGG - Intergenic
1034458779 7:151186719-151186741 GGGGTGAGGTGGGCAGAGGCAGG + Intronic
1034640651 7:152599652-152599674 GTGGTCAGCTGGGCCGAGCATGG - Intergenic
1034800258 7:154051829-154051851 GGAGGGAGCTGGGCTGTGGAGGG + Intronic
1034897956 7:154889777-154889799 GAGGGGAGCAGGGCTGGGGTGGG - Intronic
1034988148 7:155530409-155530431 GAGGGGAGAGGGGCTGAGGGAGG - Intronic
1035056669 7:156040584-156040606 GAGCTGGGCTGGGCTGGGGTGGG - Intergenic
1035177776 7:157064576-157064598 GAGGAGTTCTGGGCTGAGGTTGG - Intergenic
1035366441 7:158351857-158351879 GAGGGGAGCTGGGCTGGGAGTGG - Intronic
1035644151 8:1205623-1205645 GAGGCGAGCTGAGCAGAGGCTGG - Intergenic
1035757420 8:2044593-2044615 GAGTTGAGGTCGGCTGTGGAGGG - Intergenic
1035827630 8:2661382-2661404 GAGGTGAGCTGGGGTGATTCTGG + Intergenic
1036696029 8:10975724-10975746 GCGGTCAGCTGGGCTGAGCTGGG - Intronic
1037319983 8:17632770-17632792 GAGGAGGGCTGGGGAGAGGAGGG - Intronic
1037587445 8:20287939-20287961 CAGGTGGGCTGGGCTAGGGAAGG - Intronic
1037880457 8:22571121-22571143 GGGGTCAGCTGGGCTGCGCAGGG - Exonic
1037898065 8:22671412-22671434 GAGGGGCACTGGGCTGAGGAGGG + Intergenic
1037908019 8:22726853-22726875 GAGGGGAGCTGGGGGAAGGATGG + Intronic
1037996047 8:23352992-23353014 GAGGTGGGGTGGGGTGGGGAGGG + Intronic
1038151198 8:24943198-24943220 GAGGAGCTCTGGGCTGGGGAGGG - Intergenic
1038492906 8:27982825-27982847 CAGGTGAGATGGGAAGAGGAGGG - Intronic
1038733132 8:30145363-30145385 GAGGAGAGTTGTGGTGAGGAAGG - Intronic
1039967906 8:42297100-42297122 GATGTGAACAGGTCTGAGGAAGG - Intronic
1039985685 8:42445788-42445810 CAGGTGGGCTGGGCTGAGGTGGG - Intronic
1040551273 8:48439286-48439308 AAGGTGACCTGGGCCCAGGAAGG - Intergenic
1040604217 8:48913837-48913859 GAGCTGAGCAAGGCTGACGAGGG - Intergenic
1040874960 8:52141650-52141672 GAGAAGAGCTGCGCTGAGGGAGG + Intronic
1041131780 8:54709434-54709456 GAGCTGAGCTGAGCTGAGGCAGG + Intergenic
1041476944 8:58277647-58277669 GATGACAGCTGAGCTGAGGAAGG + Intergenic
1042163690 8:65923902-65923924 GTTTTGAGCTGGGCAGAGGAAGG + Intergenic
1042957582 8:74268108-74268130 GAGTTGTTCTGGGATGAGGACGG + Intronic
1043687552 8:83106869-83106891 GAGGGGAGCTGGGGAGGGGATGG - Intergenic
1044937813 8:97309875-97309897 GAGGACAGCTGGGGTGAGAAAGG - Intergenic
1044966501 8:97579115-97579137 GAGGCCAGGTGGGGTGAGGAGGG - Intergenic
1046386867 8:113517537-113517559 GAGATGAGCAGGGCAGAAGAAGG + Intergenic
1047489831 8:125365372-125365394 GAGGGCAGCTCGGCTGAGGGTGG - Intronic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1049112074 8:140652743-140652765 GAGTGGAGATGGGCTGAGGTTGG - Intergenic
1049243495 8:141550281-141550303 CAGGTGAGCAGGGAGGAGGATGG + Intergenic
1049253285 8:141600746-141600768 GAGGCTGGCTGGCCTGAGGAGGG + Intergenic
1049309835 8:141927995-141928017 GGGCTGAGCTGGACTGAGGACGG - Intergenic
1049324921 8:142016882-142016904 GAGGTGTGTAGGGCTCAGGAAGG + Intergenic
1049325196 8:142017982-142018004 GAGGGCAGCTGGGGTGGGGACGG - Intergenic
1049325482 8:142019380-142019402 GAGGGGCGCTGGTCTGAGGCTGG + Intergenic
1049582660 8:143419964-143419986 GAGCTGAGCTGGGCTGAGCTGGG + Intronic
1049673484 8:143879711-143879733 CCGGTGAGCAGGGCTGGGGATGG - Intergenic
1049717031 8:144097911-144097933 TTGCTGGGCTGGGCTGAGGAAGG + Intergenic
1049888061 9:41543-41565 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1050078552 9:1890509-1890531 GACGGGAGCTGGGCAGAGCATGG - Intergenic
1050092036 9:2025086-2025108 GAGGAGATTTGGGCTGAGGGAGG + Intronic
1050387866 9:5110187-5110209 GAGTGGAGCAGGGCTGAGGCTGG - Intronic
1050715307 9:8517828-8517850 GAGGTAAGTTTGGTTGAGGAGGG - Exonic
1050939707 9:11443332-11443354 GAGGGGAGCTGGAGAGAGGATGG - Intergenic
1051083327 9:13318205-13318227 AAGGTTAGCTGGGCTCAGCATGG + Intergenic
1051587540 9:18742552-18742574 GATGTGAGCTGGGATGGTGAGGG + Intronic
1051996132 9:23219952-23219974 GAGGGGAGCTGGGGAGGGGATGG + Intergenic
1052998842 9:34566166-34566188 GAGCAAAGCAGGGCTGAGGAGGG - Intronic
1053180278 9:35962415-35962437 GGGGAGAGCTGGGCTGGGGCGGG - Intergenic
1053197959 9:36134963-36134985 GAGGTGAGAGGGGCTGAGAGTGG - Intergenic
1054721793 9:68611075-68611097 GAGGTAAGCTGGCCTGGTGATGG - Intergenic
1054789462 9:69242122-69242144 GAGGAGAGCAGGGCAGAAGAAGG + Intronic
1055128640 9:72749566-72749588 GTGCTGGGCTGGGCTGAGGTAGG + Intronic
1056045752 9:82713889-82713911 GAGTGTAGGTGGGCTGAGGAAGG + Intergenic
1056089277 9:83188704-83188726 TGGGTGAGCTGGGCTGCGGTAGG - Intergenic
1056805002 9:89721642-89721664 GAGGTGGGGTGGGCTGGGGAAGG + Intergenic
1057073575 9:92121605-92121627 GAGGGGAGTTGGGATGAGGAAGG - Intergenic
1057710608 9:97439530-97439552 GAGTAGGGCTGGGGTGAGGAAGG - Intronic
1058648923 9:107156911-107156933 GAGGTGAGGTGAGGTGAGGCAGG - Intergenic
1058675407 9:107395928-107395950 GAGGTGTGCTGGGCTTCTGAAGG + Intergenic
1058743433 9:107966700-107966722 GAGGAGGGCTGGGCAGAGGGTGG + Intergenic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1059421641 9:114196106-114196128 CAGGGGAGCTGGGCTGGGGCTGG - Intronic
1059556100 9:115282002-115282024 GAGGTGAGCTGGGCAGAGAAAGG + Intronic
1060256549 9:122035880-122035902 CAGGTGAGCAGGGCAGGGGAGGG - Intronic
1060403225 9:123360429-123360451 GAGGGCAGCAGGGCGGAGGAGGG - Intronic
1060485160 9:124041948-124041970 GAGCTGAGCCTGCCTGAGGAGGG + Intergenic
1060795326 9:126508975-126508997 GAGGTGAGCCAGGCCCAGGAGGG - Intergenic
1061209688 9:129183651-129183673 GAGGTGCTCTGGGGTGAGGATGG + Intergenic
1061249405 9:129417655-129417677 CTGGCGAGCTTGGCTGAGGAAGG - Intergenic
1061386477 9:130293570-130293592 GGTGTGAGCTGGGGAGAGGAGGG + Intronic
1061442129 9:130612742-130612764 GAGGGGATCTGAGCTGAGGTGGG - Intronic
1061713573 9:132504317-132504339 GAAGTCAGCTGGGCTCAGAAAGG + Intronic
1061722631 9:132562213-132562235 GAGGTGACCTGGGGTGAGGGAGG - Intronic
1061804667 9:133131281-133131303 GGGGTGGGCTGGGCTGGGGTGGG + Intronic
1061886441 9:133593397-133593419 GAGGTGGCCTGGGCTGGGGGTGG - Intergenic
1061973605 9:134057429-134057451 GAGGTGAGGTGAGGTGAGGTGGG + Intronic
1062041893 9:134408139-134408161 TAGGTGAGCTGAGCTGGGGGGGG - Exonic
1062097124 9:134709290-134709312 GAGCTGTGCCTGGCTGAGGAGGG + Intronic
1062156328 9:135050671-135050693 GTGGTGAGCTGGGCGGTGGTGGG + Intergenic
1062238708 9:135524736-135524758 GGCCTGAGCTGGGCTGGGGAAGG - Intronic
1062457708 9:136647234-136647256 GAGCTGCCCTTGGCTGAGGAAGG + Intergenic
1062500704 9:136850818-136850840 GAGGTCACCTGGGCTAACGACGG + Exonic
1062580529 9:137227402-137227424 AAGGTGGGCAGGGGTGAGGAGGG + Exonic
1062599935 9:137315175-137315197 GAGGGGTGCTGGGCCAAGGAGGG - Intronic
1062675903 9:137743717-137743739 CAGGTGGGCTGTGGTGAGGAGGG - Intronic
1186779421 X:12898147-12898169 GAGGCGGGCTGCCCTGAGGAAGG + Intergenic
1189380828 X:40500940-40500962 GGGCAGAGCGGGGCTGAGGAAGG + Intergenic
1190829104 X:54044471-54044493 GAGGTGAGCGCGGCGGAGGCGGG + Intronic
1192944348 X:75949515-75949537 TGGGTGGGCTGGGCGGAGGAGGG + Intergenic
1193333267 X:80259257-80259279 GAGGTGGGCTGAGGGGAGGATGG - Intergenic
1193801877 X:85946457-85946479 GAGGTCATCTGAGCTGAGGCTGG - Intronic
1194239084 X:91422115-91422137 AAGGTGGGCTGGGCTGTGCAGGG + Intergenic
1194667336 X:96689652-96689674 GACATGAGCTGGGCTGTGAAAGG - Intronic
1195013206 X:100753020-100753042 GAGGTGAGGTGGGGTGGGGATGG + Intergenic
1195108785 X:101624656-101624678 GGGGTGACCTGGGATGGGGAGGG + Intronic
1195216989 X:102712496-102712518 GAGGAGAGCTGAGGAGAGGAGGG + Exonic
1195221130 X:102746118-102746140 GAGGAGAGCTGAGGAGAGGAGGG + Exonic
1195963952 X:110413425-110413447 GAGGAGTTCTTGGCTGAGGACGG - Intronic
1196812120 X:119636983-119637005 GAGCTGAGCTGGGCTGGGCTGGG + Intronic
1197273234 X:124448864-124448886 GAGGTGAGGTGTGAGGAGGATGG + Intronic
1197754587 X:129984549-129984571 GAGGTGAACTGGTCGGTGGAGGG + Intronic
1198023768 X:132684662-132684684 CAGGTGAGCTGTGCTAGGGAAGG - Intronic
1199527880 X:148812372-148812394 GAGGGGAGCTATGCAGAGGAAGG + Intronic
1199882507 X:151985831-151985853 GAAGAGAGCTGGGCAGAGGATGG + Intergenic
1200093094 X:153644804-153644826 GAGCTGGGCTGGAATGAGGACGG - Intronic
1200216327 X:154369638-154369660 GAGGGGAGCTGGGAGGAGGGAGG + Intronic
1201490640 Y:14537585-14537607 GAGGTGGGATGGGGAGAGGAAGG - Intronic