ID: 1173889012

View in Genome Browser
Species Human (GRCh38)
Location 20:46489168-46489190
Sequence CAGTACCAACATGATGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173888999_1173889012 25 Left 1173888999 20:46489120-46489142 CCGACCCCCTTCCCCCTCTATTT No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889005_1173889012 13 Left 1173889005 20:46489132-46489154 CCCCTCTATTTCAGAGACTCTAG No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889003_1173889012 18 Left 1173889003 20:46489127-46489149 CCTTCCCCCTCTATTTCAGAGAC No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173888996_1173889012 28 Left 1173888996 20:46489117-46489139 CCCCCGACCCCCTTCCCCCTCTA No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889004_1173889012 14 Left 1173889004 20:46489131-46489153 CCCCCTCTATTTCAGAGACTCTA No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173888998_1173889012 26 Left 1173888998 20:46489119-46489141 CCCGACCCCCTTCCCCCTCTATT No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889007_1173889012 11 Left 1173889007 20:46489134-46489156 CCTCTATTTCAGAGACTCTAGTT No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173888997_1173889012 27 Left 1173888997 20:46489118-46489140 CCCCGACCCCCTTCCCCCTCTAT No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889000_1173889012 21 Left 1173889000 20:46489124-46489146 CCCCCTTCCCCCTCTATTTCAGA No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889006_1173889012 12 Left 1173889006 20:46489133-46489155 CCCTCTATTTCAGAGACTCTAGT No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889002_1173889012 19 Left 1173889002 20:46489126-46489148 CCCTTCCCCCTCTATTTCAGAGA No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data
1173889001_1173889012 20 Left 1173889001 20:46489125-46489147 CCCCTTCCCCCTCTATTTCAGAG No data
Right 1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173889012 Original CRISPR CAGTACCAACATGATGAAGT TGG Intergenic
No off target data available for this crispr