ID: 1173891978

View in Genome Browser
Species Human (GRCh38)
Location 20:46519782-46519804
Sequence GAGTGGATCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173891978_1173891982 4 Left 1173891978 20:46519782-46519804 CCTCAATTTGCATTGATCCACTC No data
Right 1173891982 20:46519809-46519831 ATTTACATGTAATTGAAAGTGGG 0: 7
1: 29
2: 149
3: 245
4: 638
1173891978_1173891981 3 Left 1173891978 20:46519782-46519804 CCTCAATTTGCATTGATCCACTC No data
Right 1173891981 20:46519808-46519830 AATTTACATGTAATTGAAAGTGG 0: 6
1: 26
2: 122
3: 268
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173891978 Original CRISPR GAGTGGATCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr