ID: 1173893042

View in Genome Browser
Species Human (GRCh38)
Location 20:46528188-46528210
Sequence TTTGCCAGCTTGCAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173893035_1173893042 24 Left 1173893035 20:46528141-46528163 CCTGTTTTCCTACAGGCTGTGCT No data
Right 1173893042 20:46528188-46528210 TTTGCCAGCTTGCAGTTGGTGGG No data
1173893036_1173893042 16 Left 1173893036 20:46528149-46528171 CCTACAGGCTGTGCTATGCGTGA No data
Right 1173893042 20:46528188-46528210 TTTGCCAGCTTGCAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173893042 Original CRISPR TTTGCCAGCTTGCAGTTGGT GGG Intergenic
No off target data available for this crispr