ID: 1173895214

View in Genome Browser
Species Human (GRCh38)
Location 20:46545836-46545858
Sequence GGCTCTGGGCCCCACAGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 7, 3: 89, 4: 456}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173895214_1173895220 -2 Left 1173895214 20:46545836-46545858 CCTGGCCTGTGGGGCCCAGAGCC 0: 1
1: 0
2: 7
3: 89
4: 456
Right 1173895220 20:46545857-46545879 CCCTGGATGCTGCATGCAGCTGG 0: 1
1: 0
2: 3
3: 30
4: 256
1173895214_1173895223 13 Left 1173895214 20:46545836-46545858 CCTGGCCTGTGGGGCCCAGAGCC 0: 1
1: 0
2: 7
3: 89
4: 456
Right 1173895223 20:46545872-46545894 GCAGCTGGTGAGTGGTATTGAGG 0: 1
1: 0
2: 2
3: 18
4: 191
1173895214_1173895222 5 Left 1173895214 20:46545836-46545858 CCTGGCCTGTGGGGCCCAGAGCC 0: 1
1: 0
2: 7
3: 89
4: 456
Right 1173895222 20:46545864-46545886 TGCTGCATGCAGCTGGTGAGTGG 0: 1
1: 0
2: 3
3: 43
4: 305
1173895214_1173895224 25 Left 1173895214 20:46545836-46545858 CCTGGCCTGTGGGGCCCAGAGCC 0: 1
1: 0
2: 7
3: 89
4: 456
Right 1173895224 20:46545884-46545906 TGGTATTGAGGAGACTCTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 129
1173895214_1173895225 26 Left 1173895214 20:46545836-46545858 CCTGGCCTGTGGGGCCCAGAGCC 0: 1
1: 0
2: 7
3: 89
4: 456
Right 1173895225 20:46545885-46545907 GGTATTGAGGAGACTCTCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173895214 Original CRISPR GGCTCTGGGCCCCACAGGCC AGG (reversed) Exonic
900329669 1:2127754-2127776 GGCACTGGGCCACCCTGGCCAGG - Intronic
900377001 1:2359439-2359461 TGCTCTGGGCCCCGCTGGGCAGG + Intronic
900406644 1:2495790-2495812 GGCCCAGGTCCCCACAGCCCTGG + Intronic
900458180 1:2787379-2787401 GGCGCTGGACCCCACAGTCTGGG - Intronic
900658651 1:3772420-3772442 GGCTCTAGGCCGCCCAGCCCCGG - Intergenic
900892563 1:5460075-5460097 GGCTGCTGTCCCCACAGGCCTGG - Intergenic
900990463 1:6096132-6096154 AGCACTGGGGCCCACAGCCCTGG + Intronic
901201961 1:7472166-7472188 TGCTCTTGCCCCCACAGGCTTGG - Intronic
901391526 1:8949300-8949322 GTCTCTGGCCCCCACAGGCGGGG - Exonic
901451144 1:9337693-9337715 GGCTCAGGGCCCCGGTGGCCAGG - Intronic
901457249 1:9370236-9370258 GGATCTTGGGCCCTCAGGCCAGG - Intergenic
901604612 1:10449425-10449447 GGCTCTGGCCCACCCAGGCTGGG - Intronic
901830511 1:11889128-11889150 GGCACTGGGCCCCATGGGGCTGG + Intergenic
901931553 1:12599219-12599241 GGCTCTGGGCCCAGAGGGCCAGG + Intronic
902474468 1:16674171-16674193 GCCACTGTGCCCCGCAGGCCCGG + Intergenic
902817286 1:18923500-18923522 CGTTCTGGGCCCCACACACCCGG + Intronic
903335986 1:22625007-22625029 GGCTCAGAGCCAGACAGGCCCGG + Intergenic
903458741 1:23506364-23506386 GGATCTGGTCCCCGCAGGCTGGG - Intergenic
904082782 1:27882464-27882486 TGCCCTGGGCCCCATGGGCCTGG - Exonic
904264323 1:29309778-29309800 GCCCCTGGGCTCCTCAGGCCTGG + Intronic
904277958 1:29396377-29396399 GGCTCTGGGGCCCTCAGGGAAGG + Intergenic
904300250 1:29549497-29549519 AGGGCTGGGCCACACAGGCCTGG - Intergenic
904457985 1:30658618-30658640 AGGGCTGGGCCACACAGGCCTGG + Intergenic
904532707 1:31180035-31180057 TCCTCTGGCCCCCACAGGCATGG - Exonic
905468671 1:38175491-38175513 GGCTCAGAGCCCCACTGGGCAGG - Intergenic
905897377 1:41557638-41557660 GGCTCTGGGCCCCACAGGTTGGG - Intronic
906289489 1:44610537-44610559 GGGTCTAGGTCACACAGGCCTGG - Intronic
907313862 1:53555036-53555058 GGCTCAGGGACCCACGGGACTGG + Intronic
909610506 1:77546803-77546825 AGCTCTGTGCCCCAAAGGCCTGG - Intronic
910127497 1:83860509-83860531 GGCTCTGGTCCTAACCGGCCTGG + Intergenic
911073165 1:93847833-93847855 GGCCCTGGGCCACCGAGGCCCGG - Intergenic
911452033 1:98075303-98075325 GACTTTGGGCCCCTCAGGCCAGG + Intergenic
912494820 1:110084582-110084604 GGCTCCGCTCCCCGCAGGCCTGG - Intergenic
913229103 1:116726476-116726498 GACTCTGAGTTCCACAGGCCAGG - Intergenic
913959494 1:143327739-143327761 GGCTCTGGACCCAGCAGGCCCGG + Intergenic
913972412 1:143424542-143424564 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
914053853 1:144153312-144153334 GGCTCTGGACCCAGCAGGCCCGG + Intergenic
914066794 1:144250155-144250177 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
914112359 1:144716199-144716221 GGCTCTGGACCCAGCAGGCCCGG + Intergenic
914125293 1:144813053-144813075 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
915343177 1:155187200-155187222 GAGATTGGGCCCCACAGGCCAGG - Intronic
916695535 1:167232088-167232110 GGCTCTGAGGCCCAGGGGCCAGG - Intronic
917348829 1:174056478-174056500 GGCTCCGGGCCCCACAGGAATGG + Intergenic
922821948 1:228490672-228490694 GGCCCTGGGCCACACAGGGCAGG - Intronic
923541474 1:234891209-234891231 AGCTCTGGACCCCATAGCCCAGG + Intergenic
924928518 1:248706523-248706545 GTCTCTGGGTCCCCCAGGCATGG - Intergenic
1062958206 10:1554042-1554064 GGGCCTGGGTCCCACAGCCCAGG + Intronic
1063138685 10:3238340-3238362 GGCTCTGGGCTCCGCAGACCCGG + Intergenic
1067794631 10:49311792-49311814 GGCACAGGGCACCACAGGCCTGG + Intronic
1068116138 10:52739671-52739693 GGCTCTGGGGCTCAGAAGCCTGG + Intergenic
1068794062 10:61058466-61058488 AGCACTGGGCAGCACAGGCCTGG + Intergenic
1069866712 10:71508356-71508378 GGCTCTGAGCCCCAAATGCCTGG + Intronic
1069889663 10:71645084-71645106 GGCTCTGTGAGCCACAGCCCTGG + Intronic
1070675621 10:78409593-78409615 GGCTCTGGACCCCAACTGCCTGG - Intergenic
1070795972 10:79216424-79216446 GGCTCTGGGACCCACAGTTGGGG + Intronic
1074762321 10:116676275-116676297 GGATCTGGGAGCCACAGGCAAGG - Intronic
1075657487 10:124171823-124171845 GGCTCTGGGCTCCAGTGTCCAGG - Intergenic
1075725178 10:124607299-124607321 GGCTTTGGGGCCACCAGGCCAGG + Intronic
1075893432 10:125974247-125974269 GGCTGTGTGCCCCACTGGCCTGG + Intronic
1076109700 10:127851198-127851220 GGGTCTGGGCCCGAGAGGTCAGG + Intergenic
1076293969 10:129369710-129369732 GGCTCTGGGCCCCTCTGCCCAGG + Intergenic
1076479755 10:130777446-130777468 GCCTTTGGGCCACACAGGCCTGG - Intergenic
1076538544 10:131198779-131198801 GGCTCGGGGCCCCATCTGCCAGG - Intronic
1076561205 10:131365767-131365789 GGGTCTGGACCCCATAAGCCTGG + Intergenic
1076710738 10:132332391-132332413 CGCTCTGGGCCTCACATTCCAGG - Intronic
1076720575 10:132390829-132390851 GGCTGTGGGGCCCACAAGCATGG + Intergenic
1076919330 10:133443155-133443177 AGCACCGGGCCCCAGAGGCCGGG - Intergenic
1077138466 11:1013113-1013135 GGTTCTGGGCCCAGCAGGGCTGG + Exonic
1077248225 11:1549272-1549294 AGCTCTGGTCCCCACAGTCAGGG + Intergenic
1077307444 11:1874490-1874512 GGCTCTGGACCCAGCAGGCCCGG + Intronic
1077311191 11:1889772-1889794 GGCTATGGGCACCACAACCCTGG + Exonic
1077339320 11:2018929-2018951 GGCTCTGGCCCCCACACGCTTGG + Intergenic
1077353285 11:2102896-2102918 GGCTCTGGGGCCCTCAGAGCTGG + Intergenic
1077363899 11:2153769-2153791 AGGTCTGGGCACCACAGGCAAGG - Intronic
1077404556 11:2377366-2377388 GGCGCTGGGCGCCGGAGGCCTGG - Exonic
1077408173 11:2391839-2391861 GGCTCTGCCACCCACAGCCCAGG - Intronic
1077437448 11:2549702-2549724 GGCCCTGGGCTCCCCAGGCCTGG + Intronic
1077577506 11:3395718-3395740 GGCTGTGGAGCCCACAGGACTGG + Intergenic
1077604005 11:3594836-3594858 GTCTCTGGAGCCCACAGGACTGG + Intergenic
1078098140 11:8312988-8313010 GGGTCTGGGGCCCATAGGCTTGG - Intergenic
1078596048 11:12687809-12687831 GGTACTGGTCCCCACAGTCCTGG - Intronic
1078665292 11:13319863-13319885 GGCCTTGGGCCCCAGAGACCTGG + Intronic
1078909603 11:15718636-15718658 TGCTCTGGGCCCCCCAGAGCTGG - Intergenic
1079056164 11:17208113-17208135 GGCGCTGGGGCGCACGGGCCCGG + Intergenic
1079991240 11:27249057-27249079 GCCTCAGGGCTCCAGAGGCCTGG + Intergenic
1080230945 11:30017195-30017217 GGCTGTGGTCCCCACAGGCGAGG + Intergenic
1080954096 11:37072842-37072864 TGCACTGGGCTCCACAGTCCTGG - Intergenic
1081965557 11:47167018-47167040 GGCTCTGGGCCCCTCTCCCCTGG + Intronic
1081997342 11:47374161-47374183 GTCTCTGGGTCCCCCAGACCGGG + Intronic
1083006902 11:59355430-59355452 GGCCTGGGGCCCCACAGGGCTGG + Intergenic
1083203157 11:61132149-61132171 GCCTCTGGGCCCCACTTACCCGG - Exonic
1083211065 11:61186649-61186671 GGCTCTGGGCCCCGCATGCCTGG - Intergenic
1083431528 11:62615842-62615864 GGCTCGGGGACCCAGAGGCCTGG - Intronic
1083474778 11:62908836-62908858 GGCCCTGCCCCACACAGGCCTGG - Exonic
1083550822 11:63588930-63588952 GGCTGTGGCCCACAGAGGCCAGG + Intronic
1083770516 11:64864403-64864425 GGCTCTGAGCTCCACAGGAGAGG + Intronic
1083854334 11:65385208-65385230 AGCTCTGGGACCCTCAGACCAGG - Intergenic
1083892740 11:65604853-65604875 GGCACAGGGACCCACAGGCAAGG + Intronic
1083920961 11:65781187-65781209 GGGCCTGGGCCCCAGATGCCGGG + Intergenic
1084268945 11:68019019-68019041 GGCCCAGGGCCACACAGCCCGGG - Intronic
1084463512 11:69309117-69309139 GGCTGTGGGGCCCCCAGGCAGGG + Intronic
1084539238 11:69775919-69775941 AGGTCTTGGCCCCACAGGCTTGG + Intergenic
1084553995 11:69865061-69865083 GGCTCTGACCCCCAAAGGCCAGG - Intergenic
1084672749 11:70616742-70616764 GGCTCTGGGCCACCCCAGCCTGG - Intronic
1084784812 11:71435900-71435922 GGCTCGGGGGCCCAGCGGCCTGG + Intronic
1085048642 11:73368072-73368094 GGGTCTGGACCCCACGGGGCTGG + Exonic
1085303002 11:75469268-75469290 GACTCTGTTCCCCACAGCCCGGG - Intronic
1087141261 11:94768237-94768259 GGCTCTAGGGCCCAGCGGCCGGG + Intronic
1088746658 11:112809686-112809708 GCCTCTGGTCTCCCCAGGCCTGG - Intergenic
1088925646 11:114298430-114298452 TGCTCTTGTCCCCAAAGGCCTGG - Intronic
1089462426 11:118661005-118661027 GCCCTTGGGCCCCACAGCCCAGG + Intronic
1090389027 11:126375265-126375287 GTCTCTAGCCCCCACAGCCCTGG - Intronic
1090392276 11:126396513-126396535 GTCTCTAGCCCCCACAGCCCTGG - Intronic
1090609392 11:128456661-128456683 AGCTCTGGGAGCCACAGGCCTGG - Intergenic
1090634095 11:128678330-128678352 GGTTCTGGGCCCCACAGTCATGG + Intergenic
1091287393 11:134415299-134415321 GGGCCTGGGCCCCACAGGCCAGG - Intergenic
1091330675 11:134728902-134728924 GGCCACGGGCCCCTCAGGCCAGG - Intergenic
1202822304 11_KI270721v1_random:74111-74133 GGCTCTGGCCCCCACACGCTTGG + Intergenic
1091702792 12:2674797-2674819 GCCTCTGAGCCCCACAGGAAGGG - Intronic
1092914709 12:13179500-13179522 GGCTCAGGAGCCCACAGCCCTGG - Intergenic
1096239292 12:49951001-49951023 GGCTCTGGGCCACATAAGCGGGG + Exonic
1096482561 12:51952038-51952060 GGCTCGGGTCCCCAGGGGCCCGG - Intronic
1096650827 12:53061162-53061184 TGCTCTGGGCCCCAGGGTCCTGG - Exonic
1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG + Intergenic
1097180643 12:57169818-57169840 GAGGCTGGGCCCCAGAGGCCAGG - Intronic
1097185239 12:57193122-57193144 GGCACTGGGGCCCACAGCGCTGG + Intronic
1097233858 12:57527032-57527054 GGCTCTGGGCCCCACAGCTGGGG + Exonic
1100442156 12:94627241-94627263 GGCTTTGGGGGCAACAGGCCTGG - Intronic
1100685396 12:96982063-96982085 GGCTCTCGGCCCCACATCGCTGG - Intergenic
1101244772 12:102875036-102875058 GACCCCGGGGCCCACAGGCCTGG - Intronic
1101641302 12:106587208-106587230 GTCTCTGGGACCTGCAGGCCGGG - Intronic
1101926399 12:108975424-108975446 GGCTCTGAGCCTGCCAGGCCTGG + Intronic
1102042272 12:109808528-109808550 GTCTCTGGGTCCCTAAGGCCAGG - Intronic
1102049504 12:109852442-109852464 TGCTCTGGGGGACACAGGCCAGG + Exonic
1102574794 12:113849580-113849602 GGCTCTGCTCCCAACATGCCTGG + Intronic
1102580329 12:113882309-113882331 GTCACTGAGCCCCACAGGCCAGG - Intronic
1103410166 12:120705829-120705851 AGCTCTGGGCCCCACCTGCCTGG + Intergenic
1104682430 12:130760948-130760970 CTCTCTGGTCCCCACAGGCTTGG + Intergenic
1104688615 12:130807391-130807413 GGCTCTGGGGTCCACCTGCCTGG - Intronic
1104691486 12:130829611-130829633 GGCTGTGGGCCCGAGAGGCGGGG - Intronic
1104814777 12:131639433-131639455 GGCTCTGTGCCAGCCAGGCCCGG + Intergenic
1104919173 12:132281785-132281807 GGATCGGGGACCCCCAGGCCTGG - Intronic
1104919189 12:132281841-132281863 GGATGTGGGACCCCCAGGCCTGG - Intronic
1104919204 12:132281897-132281919 GGATCGGGGACCCCCAGGCCTGG - Intronic
1104919234 12:132282008-132282030 GGATCGGGGACCCCCAGGCCTGG - Intronic
1104919250 12:132282064-132282086 GGATCAGGGACCCCCAGGCCTGG - Intronic
1104919265 12:132282120-132282142 GGATCGGGGACCCCCAGGCCTGG - Intronic
1104919281 12:132282176-132282198 GGATCAGGGACCCCCAGGCCTGG - Intronic
1104976929 12:132556363-132556385 GGCTGTGGCCTACACAGGCCGGG + Intronic
1105410615 13:20168337-20168359 AGGCCTGGGACCCACAGGCCTGG - Intergenic
1105857751 13:24387349-24387371 GGCTGTGGGATCCACAGGGCTGG + Intergenic
1106142436 13:27022539-27022561 GGCTCTGGTCACCTCAGGCCAGG + Intergenic
1107277069 13:38689313-38689335 CACTCTGGGCCCCATAGTCCTGG + Exonic
1107394761 13:40003816-40003838 GACTCTGGCACCCACAGCCCTGG + Intergenic
1107508587 13:41060288-41060310 GGCTCTGGGGCGCCCAGGGCAGG + Intronic
1108056434 13:46489895-46489917 GGCTCTGCGCCTCAGAGTCCTGG - Intergenic
1108727897 13:53201574-53201596 GGACCTGGGCCCCAACGGCCAGG + Intergenic
1110450917 13:75636574-75636596 GCGTCTGGGCCCCACGGGCGGGG - Intronic
1112326102 13:98443718-98443740 GGCTCTAGTGCCCACAGGCTGGG - Intronic
1112504142 13:99965469-99965491 GGCTGGGGGCCCCACTGGCCTGG + Exonic
1112813932 13:103250862-103250884 GGCTTTGAGCCCCTCAGACCTGG + Intergenic
1113677865 13:112220647-112220669 AGCTGGGGGCCTCACAGGCCAGG - Intergenic
1113877065 13:113601283-113601305 AACTCAGGGCACCACAGGCCAGG - Intronic
1113885645 13:113657198-113657220 GGCTCTGGGACCCCCAGAGCCGG + Intronic
1114494664 14:23124339-23124361 TGCCCTAGGCCCCACAGACCAGG + Intergenic
1115993892 14:39175666-39175688 CGCTCTCGGCCCTGCAGGCCCGG + Intronic
1117665762 14:58054142-58054164 AGCTCTGGGCCCAACAGATCAGG - Intronic
1118001231 14:61525826-61525848 GGCTCAGGTCCACACAGGCCTGG + Intronic
1118641245 14:67794471-67794493 GGCTCTGAGACCCACAGGTTGGG - Intronic
1118821094 14:69346811-69346833 GGCTCTGGGACCCTCTGCCCTGG - Intronic
1118833860 14:69461813-69461835 GGCTCAGGGGCCCACAAGGCAGG - Intronic
1119483582 14:74974622-74974644 AGCCCTGGGCCCCACGCGCCTGG + Intergenic
1119536756 14:75409127-75409149 GACCCCAGGCCCCACAGGCCAGG - Intergenic
1119814701 14:77555404-77555426 CGCCCTGGGCCCCACAGGCCGGG - Exonic
1121434815 14:93912125-93912147 GTCTCAGCACCCCACAGGCCTGG - Intergenic
1121743909 14:96273128-96273150 GGAACTGGGCTCTACAGGCCAGG - Intergenic
1122438958 14:101717158-101717180 GGCACTGGGAGTCACAGGCCAGG + Intergenic
1122839794 14:104451644-104451666 GGCTCCGGGGCCCACAGCGCCGG + Intergenic
1122892016 14:104736360-104736382 AGCCCTGGGCCCCACATGGCAGG + Intronic
1122973891 14:105163279-105163301 GGCCCTGGGGCCCAGAGCCCTGG - Intronic
1122974194 14:105164333-105164355 GGCCCTGGGGCCCAGAGCCCTGG - Intronic
1122974195 14:105164337-105164359 GGCTCTGGGCCCCAGGGCCATGG + Intronic
1202929060 14_KI270725v1_random:23006-23028 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
1123423301 15:20148490-20148512 GGCTCTGGACCCAGCAGGCCTGG + Intergenic
1123449539 15:20351272-20351294 GGCCCTGTGCCCCACATTCCTGG - Intergenic
1123532522 15:21155011-21155033 GGCTCTGGACCCAGCAGGCCTGG + Intergenic
1124068789 15:26371675-26371697 GGCTCAGGGCACCACATGTCTGG - Intergenic
1124109677 15:26773639-26773661 GGCTCTGAGCCCCGCAGGTGAGG - Intronic
1124708049 15:31981863-31981885 GGCTCTGGGCTCTACAGCACTGG + Intergenic
1125730202 15:41888813-41888835 AGCTCTGGGGCCCAGAGGGCAGG - Intronic
1126344253 15:47676014-47676036 GGCTCTGGCTCCTACAGGCTAGG + Intronic
1128074369 15:64816991-64817013 GGCTCTGGGTCAGACAGGCGTGG + Intronic
1128473321 15:67974937-67974959 GACACTGGGCCCCACTGGGCAGG - Intergenic
1129332326 15:74834052-74834074 GGCTTTTGTCCCCAGAGGCCGGG - Intergenic
1129666167 15:77580651-77580673 GGCTCAGTCCCCCACTGGCCGGG - Intergenic
1130661009 15:85831312-85831334 GGCCCTGGGGCCCAGAGGGCTGG + Intergenic
1131118106 15:89806601-89806623 GGCTCAGGGAGCCTCAGGCCAGG + Exonic
1131156180 15:90077148-90077170 TTCTCTGGGGCCCACAGGACGGG + Intronic
1132509569 16:331927-331949 GTCTCTGGAACCCACAGGCCTGG - Intronic
1132645707 16:998403-998425 GGCTCTGGGCGCCACCTGCCTGG - Intergenic
1132750883 16:1457109-1457131 GGCTCTGGGAGCCACCCGCCAGG + Intronic
1132875573 16:2135562-2135584 GGCGCTGGGCCGCAGAGGCAGGG + Exonic
1133167460 16:3958192-3958214 GGCTCTGGGACCCTCCCGCCAGG + Intronic
1133271708 16:4613745-4613767 GCCTCTGGGCAGCACAAGCCAGG + Intronic
1133839678 16:9396196-9396218 TCCTCTGGGCCCCACCTGCCAGG + Intergenic
1135038174 16:19095890-19095912 GGCTGTTGGCCCCTCAGGCTAGG - Intergenic
1135189535 16:20343809-20343831 GACTCTGTCCCCCACTGGCCAGG + Intronic
1135189865 16:20346097-20346119 GGTTCTGTCCCCCACTGGCCAGG + Intronic
1135546693 16:23371551-23371573 GGATCTGGGCCCCCCAGCCCTGG + Intronic
1135807321 16:25554700-25554722 GGCCCTGGGCCCCACAGTTATGG - Intergenic
1137852106 16:51756113-51756135 GACTCTTTGCCACACAGGCCTGG - Intergenic
1141002669 16:80323233-80323255 GGCTCAGGTCCCCACTTGCCTGG + Intergenic
1141423120 16:83930147-83930169 GGCCCAGGTGCCCACAGGCCTGG + Intronic
1141686748 16:85574638-85574660 GGCTCTTGGCATCACAGCCCAGG - Intergenic
1141699513 16:85636036-85636058 GCCGCTGGTCCCCACTGGCCAGG + Intronic
1141791916 16:86242868-86242890 GGCTCTGGGCCGCAGGGGCCTGG - Intergenic
1142042794 16:87905932-87905954 GGCTCTGGCCCCCAGAGTCATGG + Intronic
1142231566 16:88902518-88902540 GGCTCCGTGCCCCCCAGTCCCGG - Intronic
1142400480 16:89855855-89855877 GGCCCAGGGCCACACAGCCCCGG - Intronic
1142591887 17:1009888-1009910 GGGTCTGCTCCCCAAAGGCCTGG - Intronic
1142607152 17:1088180-1088202 TGGTCTTGGCTCCACAGGCCTGG - Intronic
1143183467 17:4997814-4997836 CTCGCTGGGCCCCACAGGCCAGG + Intergenic
1143651568 17:8266859-8266881 GGAGCTGGGCCACACAGGCGAGG + Exonic
1144495358 17:15742070-15742092 CGCCCTGGCCCCCATAGGCCAGG + Intronic
1144638267 17:16924439-16924461 AGGGCTGGGCCCCACAGGCCTGG + Intergenic
1144638866 17:16926813-16926835 AGCCCTGGGCCCCACAGGCCAGG - Intergenic
1144703744 17:17354241-17354263 TGCTCTGAGCCCCTCAGGTCTGG - Intergenic
1144749368 17:17637832-17637854 GGGGGTGGGCCCCAAAGGCCTGG - Intergenic
1144786046 17:17832120-17832142 GGCTCTGGAGCCCACAGCCTGGG + Intronic
1144855260 17:18264009-18264031 GGCACCAGGCTCCACAGGCCCGG - Exonic
1145062005 17:19739453-19739475 GGTCCTGGGGCCCACAGACCTGG - Intronic
1145973754 17:28972400-28972422 GGCTCAGGGCCCCTCAGACTGGG + Intronic
1146052447 17:29564762-29564784 GGGTCTGGCCCCCACATCCCAGG + Intronic
1146616670 17:34362269-34362291 GGCTCTGGACCCCACACCCTGGG + Intronic
1146972554 17:37084573-37084595 GGCTCTGGGCTTCCAAGGCCTGG + Intergenic
1146975800 17:37110566-37110588 GGCTCAGGGCTCCAAATGCCTGG + Intronic
1147263523 17:39222362-39222384 GGCTGTGGGCCCCAGATCCCAGG + Intronic
1147375174 17:40018808-40018830 GGCTCAGGGCCCCACAGTGCTGG - Intergenic
1147587092 17:41658940-41658962 GGCTCTGGGCCTGCCTGGCCTGG - Intergenic
1147847415 17:43414280-43414302 GGCTCTGAGCCCCATTGGACTGG + Intergenic
1148754046 17:49963218-49963240 GGCTCTTGGGTCCCCAGGCCTGG - Intergenic
1149496431 17:57121111-57121133 TGCTCTTGGCCCCTCTGGCCAGG + Exonic
1150336229 17:64332625-64332647 GGCTCTGGGCCTCACAGGATGGG + Intronic
1150479285 17:65497035-65497057 GGCTCCGTGTCCCACTGGCCAGG + Intergenic
1150575901 17:66430584-66430606 GGCTCAGTGCACCACAGGGCTGG - Intronic
1150806866 17:68326286-68326308 TGCTCTGGTCTCCACAGGGCTGG - Intronic
1151576791 17:74956498-74956520 GGCTGAGGGCTCCACAGGGCAGG + Intronic
1151723756 17:75873204-75873226 GCCTCAGGGCGCCCCAGGCCTGG + Intergenic
1151757701 17:76083964-76083986 GGCTGTGGGCAGCACAGGCTGGG + Intronic
1151954251 17:77372828-77372850 GGCTCTTGAGCCCACAGGCCGGG + Intronic
1151960608 17:77403497-77403519 GGCCCTGTGTCCCACAGGACTGG - Intronic
1152109080 17:78347479-78347501 GGCCCTGGGACCATCAGGCCAGG - Intergenic
1152339093 17:79714618-79714640 GGCCCTGTGCCCCACATCCCGGG + Intergenic
1152462205 17:80447309-80447331 GGCTCTGGGCCCCTCCCCCCAGG - Intergenic
1152485086 17:80585564-80585586 GGCCCTGGGTCCTACAGCCCCGG + Intronic
1152545880 17:80999930-80999952 GGCTCGGGGACCCGCAGGGCAGG - Exonic
1152580680 17:81164388-81164410 GGCTCTGGGGCCCACCTACCAGG - Intronic
1152587071 17:81193890-81193912 GGGTCCTGGCCCCACCGGCCTGG + Intronic
1152587185 17:81194325-81194347 AGCCCTGAGCCCCACAGGCTGGG - Intronic
1152699609 17:81812446-81812468 GGCCCTGGGCCACATAGCCCTGG - Intronic
1156362890 18:36399889-36399911 GGCTGCTGGCCCAACAGGCCAGG + Intronic
1156453022 18:37277304-37277326 AGCTCTGGACCCCAGAGCCCAGG + Intronic
1156475195 18:37401618-37401640 GGCTCTGTGGCTCACAGGCTGGG - Intronic
1157224926 18:45854035-45854057 GGCCCTGGGCTGCCCAGGCCTGG - Intronic
1157307057 18:46525069-46525091 GGCCTTGGACCCCACAGGCTCGG - Intronic
1157543760 18:48533156-48533178 GGCTCTGAGGCCCACAGCTCTGG + Intergenic
1160375316 18:78406974-78406996 GGCTCTGGGCATCAGAGGCCTGG + Intergenic
1160401085 18:78612021-78612043 GGTTCTGGGGAGCACAGGCCGGG - Intergenic
1160662137 19:306149-306171 GGCTCTGTGCCCCACGGGGTTGG + Exonic
1160737592 19:671079-671101 GGCTCTGTGGCCCACGGGGCTGG + Intergenic
1160812585 19:1019397-1019419 GGCTCTGGGGTCCACAGACGGGG - Intronic
1160862557 19:1243923-1243945 GGCCCTGGGCCCAACATGGCGGG - Intronic
1160903857 19:1442923-1442945 GTCTCTGGGCAGCACTGGCCAGG + Intergenic
1161012848 19:1968557-1968579 GGCTCTGGGGCCCTCAGCTCTGG + Intronic
1161060018 19:2210208-2210230 TGCTTGGGGCCCCGCAGGCCAGG - Intronic
1161070145 19:2255898-2255920 GGCTCTGGTCGTGACAGGCCGGG + Intronic
1161590746 19:5128135-5128157 GTCCCTGGCCCCCACAGCCCCGG + Intronic
1161681290 19:5681073-5681095 GGCGCTGGGTCCCCGAGGCCCGG + Exonic
1161840870 19:6679549-6679571 GGATCTGGGCCTCCCAGGCATGG - Intronic
1162003942 19:7765287-7765309 GGGTCTGGGGTCCCCAGGCCTGG + Intronic
1162449167 19:10744215-10744237 GGCTCCCTGCCCCACAGGCTTGG - Intronic
1162534401 19:11254294-11254316 AGCTCTGGGCCCCGCAGGCCAGG - Intronic
1162780010 19:13002104-13002126 GGCCCTGGGCCCCACACCCCTGG + Intronic
1162799520 19:13103031-13103053 GGCCCGGGTCCCCAGAGGCCCGG - Intronic
1162821199 19:13224685-13224707 GGCTCTGATCCGCACAGCCCTGG - Exonic
1163018849 19:14472281-14472303 GGCTCTGGCGCCCACGGGCCCGG + Intergenic
1163234336 19:16022284-16022306 GGCCCTGGGTCCCATGGGCCAGG + Intergenic
1163514689 19:17755787-17755809 GGCTCTGGGTCCCCCAGACTGGG - Intronic
1164444846 19:28308185-28308207 GGGGCTGGGCCCCAAGGGCCAGG - Intergenic
1165095435 19:33407377-33407399 GGCTCTGGTGCCCACAGCCCAGG + Intronic
1165113717 19:33516434-33516456 GTCTCTGAGCCCCAGAGGCCAGG + Intronic
1165733183 19:38159336-38159358 AGCTCGGGGTCCCACAGGCCTGG + Intronic
1165886738 19:39084222-39084244 GGCCCCGGGTCCCACAGGTCCGG - Intronic
1165906728 19:39198884-39198906 GGCTCAGGGTCACACAGGCCAGG + Intronic
1166046891 19:40235168-40235190 GGCTCAGGGACCCTGAGGCCAGG + Intronic
1166108927 19:40611175-40611197 GCCCCTCGGCCACACAGGCCTGG - Exonic
1166915195 19:46190702-46190724 GGCTCTTTGCCCCACAGGAGAGG - Intergenic
1167299722 19:48671703-48671725 GGCTCTGATCCCTGCAGGCCTGG - Intronic
1167429933 19:49448339-49448361 AGGTCTGAGCCCCACAAGCCTGG + Intronic
1167610523 19:50505894-50505916 GGCTCTCGGCCCCACACACCAGG + Intergenic
1167818387 19:51904473-51904495 GCCTCTGAGCCCCACATGCCTGG + Intronic
1168097807 19:54125522-54125544 GGTTCTGGGACAGACAGGCCTGG + Intronic
1168168685 19:54572511-54572533 GGTGCTGGGCTCCACAGTCCAGG - Intergenic
1168327938 19:55547413-55547435 GCCTCTGAGTCACACAGGCCTGG - Intergenic
1202693329 1_KI270712v1_random:105970-105992 GGCTCTGGACCCAGCAGGCCCGG + Intergenic
925155678 2:1647629-1647651 GGCAGGTGGCCCCACAGGCCTGG + Intronic
925180671 2:1815174-1815196 AGCTCCGGCCGCCACAGGCCTGG + Intronic
926075361 2:9938354-9938376 GGCTCTGGGCACCACTGGAGGGG + Intergenic
926712383 2:15891664-15891686 AGCCCTGGGACCCGCAGGCCTGG + Intergenic
927178075 2:20424369-20424391 GGTGCTTGGCCCCTCAGGCCAGG + Intergenic
927213723 2:20654042-20654064 GGCTCTGTAGCCCCCAGGCCTGG - Intergenic
927216466 2:20670329-20670351 GGCGCTGGCTCCAACAGGCCTGG + Intronic
927505005 2:23607178-23607200 GGCTCTGCCACCCACAGACCAGG + Intronic
927507452 2:23623624-23623646 GACTCCGGCCCCCACAGGGCAGG - Intronic
927679327 2:25129681-25129703 TGCTCTGAGCCCCATGGGCCAGG - Intronic
928022509 2:27715751-27715773 GCCTCTGGGCCCCTCTGGCCGGG - Intergenic
929093719 2:38244706-38244728 TGCTCAGGGCCCCACAGCACTGG + Intergenic
929521566 2:42657327-42657349 GGCTCTGGACTCCAAATGCCTGG - Intronic
930641739 2:53860074-53860096 GGCTCTGGGCCCCAGGAGGCAGG - Intergenic
933953239 2:87348589-87348611 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
934177105 2:89585480-89585502 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
934237470 2:90244934-90244956 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
934287412 2:91659839-91659861 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
934459896 2:94208240-94208262 GGCTCTGGACCCAGGAGGCCTGG - Intergenic
934988290 2:98902746-98902768 GACTCCGGGTCCCAGAGGCCAGG - Intronic
936156074 2:110048213-110048235 GGCTCTGGGCACCAGACTCCTGG + Intergenic
936188614 2:110323215-110323237 GGCTCTGGGCACCAGACTCCTGG - Intergenic
936234556 2:110732287-110732309 GGACCTGGGCACCAGAGGCCCGG - Intergenic
936614996 2:114039574-114039596 GGCTCTGTAACCAACAGGCCTGG - Intergenic
938376975 2:130814354-130814376 TGCCCTGGGCCCCGCAGGCCAGG - Intergenic
944413892 2:199464796-199464818 GGCGCAGGGCCCGACACGCCGGG - Intronic
945417406 2:209591180-209591202 GGCTTTGGGCCAGACAGACCTGG - Intronic
946311726 2:218885688-218885710 GGCTCTGCTCTCCACAGCCCCGG + Intronic
947745883 2:232507065-232507087 CTCCCTGGACCCCACAGGCCCGG + Intergenic
948107509 2:235427436-235427458 GGCTCTGCCCCTCACAGGCGGGG + Intergenic
948480834 2:238249481-238249503 GGCTCAGGTCCACACAGGCATGG + Intronic
948574596 2:238941532-238941554 CCAGCTGGGCCCCACAGGCCAGG + Intergenic
949031370 2:241798962-241798984 GGCCTTGGGCCACACAGGTCTGG - Intronic
949063649 2:241975740-241975762 AGCTCTGGGCCCCGCAGGTCTGG + Intergenic
1168972030 20:1937678-1937700 GGCTCTGGGACCCAGGGGCCAGG + Exonic
1169569006 20:6886619-6886641 GGCTCAGGCTCCCACTGGCCAGG - Intergenic
1170140128 20:13117599-13117621 GGCCGTGGGCCCAACCGGCCGGG + Exonic
1170307471 20:14955544-14955566 GCTTCTTGGCCACACAGGCCTGG - Intronic
1170607093 20:17882550-17882572 GGCGGTGGGCCCTCCAGGCCAGG - Intergenic
1170766264 20:19292053-19292075 GGGCCTGGGCATCACAGGCCTGG + Intronic
1170928074 20:20744019-20744041 GGCCCTGGCCACCACAGACCCGG + Intergenic
1172038827 20:32029625-32029647 GGCTCTGGGCCTTTCAGGCAGGG + Intronic
1172629594 20:36369003-36369025 GTCACTGGGCCACACACGCCAGG - Intronic
1172896797 20:38305645-38305667 GGCTCTGGGACCAGAAGGCCTGG + Intronic
1173394849 20:42669751-42669773 GCCTGTGGGTCCCACAGGCAAGG - Intronic
1173867876 20:46324039-46324061 GGCTCTGGTCCTGACAGGGCTGG + Intergenic
1173895214 20:46545836-46545858 GGCTCTGGGCCCCACAGGCCAGG - Exonic
1174145662 20:48450853-48450875 GGCTGTGGGACCCCCAGGTCTGG - Intergenic
1175242081 20:57557100-57557122 TCCTCTGGGTCCCCCAGGCCAGG - Intergenic
1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG + Intronic
1176591079 21:8651594-8651616 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
1178329149 21:31672057-31672079 GGCCCTGGGCCCCCGAGCCCTGG + Exonic
1178975951 21:37221198-37221220 GGGTCTGGGCTCCACAGCCGGGG - Intergenic
1179113057 21:38463804-38463826 GGTTCTGGTTTCCACAGGCCTGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179503057 21:41821821-41821843 GGCTGTGGGCCCCACACAGCAGG - Intronic
1179681187 21:43022332-43022354 GGCTCAGGGGCCCACAGTCAGGG - Intronic
1179998727 21:44985625-44985647 GGCTGTGGGCCCCACAAAGCTGG + Intergenic
1180273907 22:10628627-10628649 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
1180982548 22:19885611-19885633 GGCTGTGGTCCCTGCAGGCCGGG + Intronic
1180999138 22:19979863-19979885 TGCGCAGTGCCCCACAGGCCCGG + Exonic
1181356309 22:22298259-22298281 GGCTCTGGACCCAGCAGGCCCGG + Intergenic
1181464814 22:23105222-23105244 GGCTCTGGGCCCCCTTGGTCAGG - Intronic
1181509368 22:23382183-23382205 GGCTCAAGGCCCCTCAGGCAGGG + Intergenic
1181863787 22:25839797-25839819 GGCTCTGGGGCCCAAAGCCTGGG - Intronic
1182038672 22:27219273-27219295 GTCTCTGGGCCCCACATCCAGGG + Intergenic
1182297490 22:29318377-29318399 GGCTCTGGAGCCCAAGGGCCTGG - Intronic
1182374270 22:29835050-29835072 ACCTCTAGGCCCCACAGTCCAGG + Intronic
1182424798 22:30266348-30266370 GGCCCTGGGGCCCCCAGGCCTGG + Intronic
1182470289 22:30544193-30544215 GGCTCTGGGACCCAGGGGCCAGG + Intronic
1182472950 22:30559904-30559926 CGCCCTGGGCCCCTGAGGCCAGG + Intronic
1183323393 22:37178494-37178516 GACGCTGTGCCCCACAGACCTGG + Intergenic
1183326994 22:37199631-37199653 GGCTCTGTGCTCCCCAGGCCCGG - Intergenic
1183346079 22:37309123-37309145 TGCTCAAGGCCACACAGGCCAGG + Intronic
1183380414 22:37487898-37487920 GACTCTGTACCCCACAGACCAGG + Intergenic
1183465166 22:37976413-37976435 GACTATGGGCCCCTGAGGCCAGG + Intronic
1183481935 22:38070014-38070036 GGCTCTGGGGAACCCAGGCCTGG + Intronic
1183727439 22:39597538-39597560 GGGGCTGGGCCCCTCAGTCCTGG - Intronic
1183740482 22:39666061-39666083 GGCTCTGGGAATCACAGACCTGG + Intronic
1183746898 22:39697369-39697391 GGTTCAGGCCCCCACAGCCCTGG + Intergenic
1183957079 22:41387267-41387289 GGCAGTGAGCCTCACAGGCCTGG - Intronic
1184036835 22:41922421-41922443 TTCTCTGGGGACCACAGGCCAGG + Intergenic
1184407380 22:44307895-44307917 GCCTCAGGCTCCCACAGGCCTGG + Intronic
1184482172 22:44754093-44754115 GACTCTGGGCCCCTGAGGGCAGG - Intronic
1184683204 22:46084081-46084103 GGCTCTGCGGCCCAGAGGCTGGG - Intronic
1184694621 22:46132618-46132640 GGCGCTGGCCAGCACAGGCCAGG - Intergenic
1184892695 22:47389492-47389514 TGCTCTGAGCCCCAGAAGCCTGG - Intergenic
1185112055 22:48905584-48905606 GGCTGTGGTCCTCACAGGCGTGG - Intergenic
1185187763 22:49413158-49413180 GGTTGTGGGCCCCCCATGCCTGG - Intergenic
1185258499 22:49849279-49849301 GGCTCTGGGATCCCCCGGCCTGG - Intergenic
1185275010 22:49946983-49947005 GGCTCTGGGCCACAAAGTCAGGG - Intergenic
1185308890 22:50141693-50141715 GGCTCTGGGTCTCACGGGCCTGG - Intronic
1185314231 22:50171796-50171818 ACCTCTGGGCCACACAGGCCAGG - Intronic
949105627 3:197548-197570 GGGTCTGAGCCCCACACACCAGG - Intronic
950529833 3:13546890-13546912 GGCCCTGGGCCCCAAATTCCTGG + Intergenic
950665089 3:14490440-14490462 GGGTCTGGGACCCAGAGGCCAGG - Exonic
950726539 3:14920813-14920835 AGCTCTGGTCCACACAGTCCTGG - Intronic
952764754 3:36944639-36944661 GGCTGTGGGCCCCACAGGGATGG + Intronic
953387183 3:42513297-42513319 GGCCCTGGGAACCAGAGGCCAGG + Intronic
953977252 3:47391320-47391342 GGCTCTGGAGCCCAAATGCCTGG + Intronic
954435801 3:50495299-50495321 GGCTCAGGAGCCTACAGGCCAGG - Intronic
954577706 3:51685948-51685970 GGCTCTGCTCCCCTCTGGCCTGG + Intronic
954702124 3:52455892-52455914 GGATCTGGGCCCCGCAGGTCCGG + Intronic
955010256 3:55006957-55006979 GGCTCTGGGCTCCAGATGTCAGG - Intronic
960294352 3:115925035-115925057 GACTATGAGCCCCACAGGCAGGG - Intronic
960955217 3:123026829-123026851 GGCTCAGGGCCCCGCACTCCCGG - Intronic
961878085 3:130039450-130039472 GGCTGTGGAGCCCACAGGACTGG + Intergenic
962254045 3:133858177-133858199 GGCTCTGTGCCCCTCGTGCCTGG - Intronic
962448646 3:135492755-135492777 GGCTGCTGGCCCCACAGCCCAGG + Intergenic
962846673 3:139279631-139279653 TGCTGAGGGCCCCACAGTCCTGG + Intronic
964641079 3:158911170-158911192 GCCTCTGGGCCCCTTAGGTCAGG - Intergenic
965924426 3:173959237-173959259 GGCTGTGGGCTCCACAGAGCAGG - Intronic
967921685 3:194618939-194618961 GCCTCTGGGCCCAGCGGGCCAGG - Intronic
968519808 4:1030204-1030226 GGCACTGGGCCCCTCGGGCTGGG + Intergenic
968556654 4:1249214-1249236 GGCTCAGGGCCCGCCCGGCCGGG + Intronic
968574294 4:1357845-1357867 GGCCCTGGCCCCCACAGACCAGG - Intronic
968629501 4:1642703-1642725 GGCGCTGGGCACCACAGACGGGG - Intronic
968661759 4:1801553-1801575 GGCTCTGGGCCTGGCAGGCGCGG + Intronic
968662674 4:1805254-1805276 GGCTCTGGGCCTCAAGGGCTGGG + Intronic
968726723 4:2251309-2251331 GGCACTGGGGCACCCAGGCCTGG + Intronic
968869787 4:3235926-3235948 GGCTCTGGAGCCCCCAGGGCTGG + Intronic
968905197 4:3447671-3447693 GGCCCTGTGCTCCCCAGGCCAGG + Intronic
968915066 4:3493708-3493730 GGCTCTGGGTCCGGCAGGTCGGG + Exonic
969045000 4:4330285-4330307 GGGTGAGGCCCCCACAGGCCAGG + Intergenic
969313340 4:6366967-6366989 GGCTCTGGGCAGGACAGGGCGGG + Intronic
969330268 4:6470774-6470796 GGGTCAGAGCCCCACCGGCCCGG + Intronic
969611817 4:8231850-8231872 GAGCCTGGGCCCCACAGGCGGGG - Intronic
970324459 4:14909033-14909055 TTCTCTGGGCCCCACCAGCCAGG + Intergenic
970602630 4:17652598-17652620 GGGTCTCGGGCTCACAGGCCAGG - Intronic
970602640 4:17652628-17652650 GGCTCTCAGGCACACAGGCCAGG - Intronic
971197455 4:24483057-24483079 GGCTCTGAGTCAGACAGGCCTGG + Intergenic
977694018 4:99947081-99947103 GCCTCTGGGCCCCTCAAGCGAGG + Intergenic
978407399 4:108394890-108394912 GGCTCCTGCCCCCACAGGACAGG + Intergenic
982209585 4:153023567-153023589 GACCCTGGGCCCCTCAGGGCTGG + Intergenic
983514442 4:168641501-168641523 GGCTCTGAGCACCACAGTCCTGG - Intronic
984167627 4:176320681-176320703 GGCTCTGGAGGCCACAGGACGGG + Intronic
985719338 5:1481164-1481186 GGCTCTGGGGACCTCAGGCTGGG - Intronic
987847524 5:23305286-23305308 GTCTCTGGGATCCCCAGGCCTGG - Intergenic
988263766 5:28926377-28926399 GGCTCTGGACCCAGCAGGCCCGG + Intergenic
992787610 5:80184830-80184852 GGCTCTGGGCACCCAAGGACAGG + Intronic
996083686 5:119282684-119282706 GGGTCTATGCCCCACATGCCAGG - Intronic
997283334 5:132662076-132662098 GGCTCTGGGCTCCCCAGGGAGGG - Intergenic
997412021 5:133697694-133697716 GGCTCTGGCCCTCAGAGGCAGGG + Intergenic
997869929 5:137498333-137498355 GGCTCCGCGCCCCCCAGGGCCGG + Intronic
997976506 5:138444615-138444637 GGCTCTGGGCCCCACAGGGAGGG - Intronic
999302646 5:150500688-150500710 GTCACTGGGCCACCCAGGCCAGG - Intronic
1001304368 5:170560972-170560994 CCCTCTGGGGCCCAGAGGCCAGG + Intronic
1001455969 5:171859845-171859867 ATCTCTGGGCCCCAAAGCCCAGG + Intergenic
1001580048 5:172792054-172792076 GGCTTTGGGCCACACTGTCCAGG + Intergenic
1002174614 5:177394520-177394542 GGCTGTGAGCCCCTCAGGGCAGG - Intronic
1002461018 5:179373897-179373919 AGAGCAGGGCCCCACAGGCCTGG + Intergenic
1002567332 5:180119310-180119332 TGCACTGGGGGCCACAGGCCAGG + Intronic
1002842967 6:922071-922093 GGCTTTGGGTCCCTCAGACCTGG - Intergenic
1002898896 6:1394298-1394320 GGCTCAGGGCAGCACAGGCCAGG + Intronic
1007177429 6:39906500-39906522 GGCTCGGGGCCCCACCGGGGTGG - Exonic
1007478147 6:42132919-42132941 CTCTCTGGGCCCCTCAGACCTGG + Intronic
1011784701 6:90830727-90830749 AGCTTTGGGCCCCAAAGTCCTGG - Intergenic
1011822552 6:91270956-91270978 ACCTCAGGGCCCCCCAGGCCAGG - Intergenic
1013462928 6:110392953-110392975 GGCTTGAGGCCCTACAGGCCAGG - Exonic
1013524034 6:110958439-110958461 GGCTCTCGGCCCCGCTGGCGGGG - Intergenic
1014613146 6:123568731-123568753 GGCTCAGGGCCCCACTGCCCTGG - Intronic
1015718280 6:136214333-136214355 GGCTCTGGACCCAGCTGGCCTGG - Intergenic
1015863586 6:137705527-137705549 GGCTCTGGGCTCCACTTGTCTGG + Intergenic
1016235078 6:141854772-141854794 AGCCATGGGCCCAACAGGCCAGG - Intergenic
1019142340 6:169956819-169956841 GCCTCTGGGCACCACAGGGAAGG - Intergenic
1019330328 7:457762-457784 CTCTGTGGGCCCCAGAGGCCTGG - Intergenic
1019442849 7:1056131-1056153 GGCTCTGGGCTCCACTCGCCGGG - Intronic
1019743623 7:2687999-2688021 GGCTCTGGGGCCCCCCTGCCCGG + Intronic
1020272823 7:6607291-6607313 GCCTCCGGGCCCCAGAGGCCTGG - Intronic
1023601681 7:41887046-41887068 GGCTCTGGGCCCTCCAGGATGGG + Intergenic
1023861815 7:44221274-44221296 GCCCCTGGGCCCACCAGGCCTGG + Intronic
1024192869 7:47030661-47030683 GGCTCTGGGGCCCTCACGTCTGG + Intergenic
1024352539 7:48381536-48381558 GACGCTGAGCCCCGCAGGCCAGG - Intronic
1024529425 7:50379151-50379173 GGCTCTGTGCTCCACAAGCTGGG - Intronic
1024980767 7:55155864-55155886 AGCTGTCGGCCCCACAGGCTCGG - Exonic
1026177518 7:68010849-68010871 GCCTCTGGGTCCCAAAGGGCTGG - Intergenic
1027048638 7:75007704-75007726 GGATCTTGGGCCCTCAGGCCTGG + Intronic
1029384369 7:100233945-100233967 GGATCTCGGGCCCTCAGGCCTGG - Intronic
1029402281 7:100353647-100353669 GGCCCTGGGCCCCAAGGGTCAGG - Intronic
1031593534 7:123621888-123621910 TACTCTGGGCTCCACTGGCCAGG - Intronic
1032154704 7:129458429-129458451 TGCCCTGGGCCCCAAAGGTCAGG + Exonic
1032855952 7:135833617-135833639 GGCTGTGGGCCACAGAGACCTGG - Intergenic
1033122352 7:138677232-138677254 GGCTCTGGGCTCTCCAGTCCAGG - Intronic
1034090303 7:148357930-148357952 GAACCTGGGCCCCACAGGTCAGG - Intronic
1034093115 7:148382203-148382225 TGCTCACAGCCCCACAGGCCTGG + Intronic
1034197917 7:149262274-149262296 CGCCCCGGGCCCGACAGGCCGGG + Exonic
1034393264 7:150801672-150801694 GGCCCCGGGCCACCCAGGCCAGG + Exonic
1034434346 7:151056050-151056072 GGCTCTGGTCCCCACCTTCCTGG + Intronic
1034551547 7:151823732-151823754 GACTCTGGGCCCCACATCCCTGG - Intronic
1034946613 7:155266608-155266630 GGCTCTGTGCCCCAAGGCCCTGG + Intergenic
1035015940 7:155766091-155766113 GGCTCTGGGACTCTCAGGACAGG + Intronic
1035024990 7:155819360-155819382 GGCTCTGGGCTCCAGGGGCCTGG + Intergenic
1035091831 7:156319265-156319287 GTCTCTGGGCCTCACAGCCCAGG + Intergenic
1035258229 7:157645749-157645771 GGGGCTGGGCCCCAGAGTCCCGG + Intronic
1035298018 7:157877709-157877731 GGCTCTGAGGCCCACAGGGAGGG - Intronic
1035595213 8:852272-852294 GGATCTGGAGGCCACAGGCCTGG + Intergenic
1036157013 8:6351617-6351639 GGCTTTGGAATCCACAGGCCTGG + Intergenic
1036688437 8:10926598-10926620 GGCACCAGGCCCCCCAGGCCAGG + Intronic
1037662788 8:20941683-20941705 GACTCTGAGCCCCCCAGTCCTGG - Intergenic
1037696436 8:21228161-21228183 GGCTCTGGCACACACAGGCCTGG - Intergenic
1039680452 8:39730125-39730147 GTCTCTGGGATCCACAGACCTGG + Intergenic
1040532398 8:48276418-48276440 GTCTCTGGGCCTCACAGAGCAGG - Intergenic
1044924309 8:97196986-97197008 GACTCTGGACCCCGCACGCCGGG + Intergenic
1047073987 8:121378983-121379005 GGCTGGTGGCCACACAGGCCTGG + Intergenic
1048956620 8:139542855-139542877 GGGTCTGGGTCCCACTGCCCTGG - Intergenic
1048993518 8:139775096-139775118 GGCTAGGTGCCCCACAGACCCGG - Intronic
1049011956 8:139893142-139893164 TCCTCTGTGCCCCACAGCCCTGG + Intronic
1049235489 8:141510379-141510401 GGCTCTGGGGTCCACAGGGTGGG + Intergenic
1049573098 8:143378660-143378682 GCCACTGGGCCCCACCGCCCTGG - Intronic
1049659577 8:143813764-143813786 GGCTATGGGTCCCACAGCCCTGG - Intronic
1049788375 8:144462174-144462196 GCCGCCGGGCCCCGCAGGCCTGG + Intronic
1049951044 9:644427-644449 GGCTCAGGGTTCCGCAGGCCAGG + Intronic
1051367535 9:16331807-16331829 GGCCCTGGGCACCCCAGGCCGGG - Intergenic
1052821335 9:33139855-33139877 GGCTCTCGGCCCCGCTGGGCTGG + Intronic
1053282894 9:36832490-36832512 GGCTTTGGGGCCCAGAGGCGAGG + Intergenic
1053690399 9:40584048-40584070 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
1054301651 9:63385009-63385031 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
1056845453 9:90033411-90033433 GGCTTAGGGCCACACAGGGCTGG - Intergenic
1057386088 9:94606991-94607013 CGCACTGGGTCCCCCAGGCCTGG + Intronic
1057897568 9:98921994-98922016 GGCTTTGGAGTCCACAGGCCAGG - Intergenic
1059934692 9:119297936-119297958 GGCACTGGGGCACCCAGGCCCGG - Intronic
1060114057 9:120927162-120927184 AGCTTGGGGCCCCACAGCCCTGG - Exonic
1060514630 9:124258107-124258129 GCCGCGGGGCCCCACCGGCCCGG - Intronic
1060683399 9:125585791-125585813 GGCTGTGCTGCCCACAGGCCTGG - Intronic
1060835978 9:126755483-126755505 GGCCCAGGGCCCCACAGAGCAGG - Intergenic
1061368366 9:130184299-130184321 CTCTCAGGGACCCACAGGCCTGG + Intronic
1061502831 9:131013557-131013579 GGCCCTGAGCCCCTCAGGACAGG - Intronic
1061676294 9:132217827-132217849 TCCCCTGGGCCCCACTGGCCTGG - Intronic
1061700344 9:132410591-132410613 AGCTCTGGTCCAGACAGGCCTGG + Intronic
1061875244 9:133540277-133540299 GGCCCTGGGCACCCCAGCCCTGG - Intronic
1061946587 9:133911869-133911891 GGCCCAGAGCCCCACAGGTCAGG + Intronic
1062036838 9:134386234-134386256 GGCTCAGGGTCCCACAGCCTCGG - Intronic
1062079915 9:134618377-134618399 TGCACTGGAGCCCACAGGCCGGG + Intergenic
1062268911 9:135699901-135699923 GTCCCTGGGTCCCCCAGGCCTGG - Intergenic
1062309566 9:135928705-135928727 GGCTGTGGACCTCACAGCCCAGG - Intergenic
1062324128 9:136004351-136004373 GGCACTGTGGCCCTCAGGCCAGG - Intergenic
1062580128 9:137225752-137225774 GGCACAGGGCCCCACTGGCAGGG - Exonic
1062590529 9:137272594-137272616 GGCCCTGGAGCCTACAGGCCAGG + Exonic
1062609797 9:137368825-137368847 GGCCCTGCGCCCCATGGGCCTGG - Intronic
1062709659 9:137967791-137967813 GGCTCAGGGCCCCTCTGGCGCGG + Intronic
1203621096 Un_KI270749v1:130317-130339 GGCTCTGGACCCAGCAGGCCCGG - Intergenic
1186452997 X:9688666-9688688 GGCACTGGGCCCCAGAGACTGGG + Intronic
1188444056 X:30238257-30238279 GGCTCTGGATCCCCCAGCCCAGG - Intergenic
1192201544 X:69069439-69069461 TCCTCTGGGCCCCACAAGTCAGG + Intergenic
1193091034 X:77494199-77494221 GACTCTGGGCCCCAGTGGCGTGG - Intergenic
1193546499 X:82836963-82836985 GGCTATGGTCCCCACAGTTCTGG + Intergenic
1195918405 X:109958209-109958231 GGCTCTGGAGCCCAAATGCCTGG - Intergenic
1198458249 X:136838444-136838466 GGCTCAAGGCCCCAGAGCCCAGG + Intergenic