ID: 1173896372

View in Genome Browser
Species Human (GRCh38)
Location 20:46554056-46554078
Sequence CACTGACCTTTCTGTAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173896372_1173896375 -6 Left 1173896372 20:46554056-46554078 CCATCATTACAGAAAGGTCAGTG No data
Right 1173896375 20:46554073-46554095 TCAGTGGGTAGTGCTGCTCTAGG No data
1173896372_1173896379 28 Left 1173896372 20:46554056-46554078 CCATCATTACAGAAAGGTCAGTG No data
Right 1173896379 20:46554107-46554129 CGTGACCGCTAATGCTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173896372 Original CRISPR CACTGACCTTTCTGTAATGA TGG (reversed) Intergenic
No off target data available for this crispr