ID: 1173898049

View in Genome Browser
Species Human (GRCh38)
Location 20:46565830-46565852
Sequence GTTTCAACACTGTTGATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173898049_1173898052 -5 Left 1173898049 20:46565830-46565852 CCAACTATCAACAGTGTTGAAAC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1173898052 20:46565848-46565870 GAAACCCCTGCTTTAGAGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 154
1173898049_1173898056 30 Left 1173898049 20:46565830-46565852 CCAACTATCAACAGTGTTGAAAC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1173898056 20:46565883-46565905 TTCCATTAGAATTTCTCCTATGG 0: 1
1: 0
2: 4
3: 31
4: 363
1173898049_1173898051 -8 Left 1173898049 20:46565830-46565852 CCAACTATCAACAGTGTTGAAAC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1173898051 20:46565845-46565867 GTTGAAACCCCTGCTTTAGAGGG 0: 1
1: 0
2: 2
3: 15
4: 165
1173898049_1173898050 -9 Left 1173898049 20:46565830-46565852 CCAACTATCAACAGTGTTGAAAC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1173898050 20:46565844-46565866 TGTTGAAACCCCTGCTTTAGAGG 0: 1
1: 0
2: 2
3: 24
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173898049 Original CRISPR GTTTCAACACTGTTGATAGT TGG (reversed) Intronic
906084649 1:43120964-43120986 GTTTCAACACTGTTTTTGTTGGG + Intergenic
909249671 1:73336188-73336210 GTTAAAAGACTGTTGATATTAGG + Intergenic
909635154 1:77809333-77809355 GTTACAAAACTGATGATATTTGG + Intronic
911925228 1:103821198-103821220 GTAATAACAGTGTTGATAGTGGG - Intergenic
914833838 1:151190799-151190821 TTTTCTACACTGCTGCTAGTAGG + Intronic
915825796 1:159075201-159075223 GTCTGAACACTTTTTATAGTTGG - Intronic
916191452 1:162182660-162182682 ATTTCAACAATGTTCATAGCGGG + Intronic
917370767 1:174291173-174291195 GTTTCAACACTGTTCACAGGGGG - Intronic
917909545 1:179628612-179628634 GTTTCTTCATTGTTCATAGTTGG + Intronic
919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG + Intronic
920793252 1:209112972-209112994 GTTTCAACACTGGTCATATATGG - Intergenic
1063987664 10:11523329-11523351 TTTTCCACACTTGTGATAGTTGG - Intronic
1064363580 10:14687385-14687407 GGTTCAACACTCTTGTTATTTGG + Intronic
1068684135 10:59852077-59852099 ATTTGAACACGGTTGATTGTGGG + Intronic
1071258534 10:83897131-83897153 TTTTCAACTCTGTTGAAGGTGGG + Intergenic
1072096034 10:92180885-92180907 GTTTCTACATTCTTGATTGTTGG - Intronic
1073219267 10:101856224-101856246 TGCTCAACCCTGTTGATAGTTGG + Intronic
1073857608 10:107695531-107695553 GTGTCATCACTGTAGATAGTAGG + Intergenic
1074521526 10:114229319-114229341 GTTTTAACACAGTTGGCAGTTGG - Intronic
1076364378 10:129912265-129912287 AATTCCACACTGTTGATAGTGGG - Intronic
1078812738 11:14784882-14784904 GTTTAAAAACTGTTGAAATTAGG - Intronic
1079655343 11:22979805-22979827 GTTTAAAAAGTGTTGAAAGTGGG - Intergenic
1081477968 11:43454253-43454275 ATTTCCATACTGTTCATAGTAGG + Intronic
1083333173 11:61908440-61908462 GTAACAACACTGATGATAGCTGG - Intronic
1086843293 11:91716386-91716408 CTTTCAATACTCTTGATATTTGG - Intergenic
1087416781 11:97866690-97866712 GTCTCAACACTGTTCACAATAGG - Intergenic
1087684281 11:101245578-101245600 TTTTCAACACAGTTCCTAGTGGG - Intergenic
1088096138 11:106103345-106103367 ATTTCAACACAGTTGACTGTAGG - Intergenic
1091635702 12:2194867-2194889 ATTTCATCACTGTTGAAAATAGG + Intronic
1094053360 12:26244334-26244356 GTTTCAAACCTGTTGAAATTAGG - Intronic
1097312732 12:58138642-58138664 CTTTCACCATTGTTGAAAGTGGG + Intergenic
1098648379 12:72934336-72934358 GTAACAACAGTGTTGAAAGTTGG + Intergenic
1101304617 12:103515097-103515119 ACCTCAACACTATTGATAGTTGG - Intergenic
1102657964 12:114499214-114499236 GCTTCAGCACTATTGATATTGGG - Intergenic
1103233827 12:119355128-119355150 GTTTCAAGACTTTTAAAAGTAGG - Intronic
1108206005 13:48091339-48091361 GTTTCAAACTTGTTGATAGATGG + Intronic
1110231585 13:73173017-73173039 GTCTCAACACTATTGACATTTGG + Intergenic
1110555331 13:76853207-76853229 CTGTCAACTCTGGTGATAGTAGG - Intergenic
1112973092 13:105284828-105284850 GTTTCAGTACTGTTCATATTTGG + Intergenic
1114341672 14:21752056-21752078 CTTTCAGCACTGATGATACTGGG + Intergenic
1119688173 14:76649572-76649594 GGCTCAGCACTGTTGATATTTGG - Intergenic
1120190823 14:81437717-81437739 GGGTCAACACTGTTCAGAGTGGG - Intergenic
1129018431 15:72490631-72490653 GTTTCAAAAATGTTCATATTTGG + Intronic
1131877031 15:96819051-96819073 GTTTCAACACGTCTGAGAGTTGG + Intergenic
1134619518 16:15677025-15677047 ATCTCAACCCTGTTGAGAGTAGG + Intronic
1135037329 16:19089296-19089318 CTTTCCACAGTGTTGATATTAGG + Intergenic
1138859005 16:60732368-60732390 TTTTCAAAACTGTTGTTAGATGG - Intergenic
1140822240 16:78673417-78673439 TTTTGAACACTGTTGATCATCGG + Intronic
1141022040 16:80506548-80506570 ATTTCAACACTGTTGATTAGTGG + Intergenic
1143592635 17:7894758-7894780 GTTTCAGAAATGTTGATTGTGGG - Intronic
1145256678 17:21328133-21328155 ATTTCAATATTGTTCATAGTAGG - Intergenic
1145319933 17:21759815-21759837 ATTTCAATATTGTTCATAGTAGG + Intergenic
1146419307 17:32667950-32667972 GTTTCAATAGTGTTGATATTGGG - Intronic
1146668233 17:34719221-34719243 GGTTAAAAACTGTTAATAGTTGG - Intergenic
1150057856 17:62035784-62035806 TTTACAACACTGTTTATAGTAGG + Intronic
1151310603 17:73290429-73290451 GGTTCCACACTGTTGCTATTTGG + Intronic
1153830143 18:8914682-8914704 TTTTCAACATAGTTCATAGTGGG - Intergenic
1158777573 18:60603310-60603332 GTTTCTACACTGTAGATACGTGG + Intergenic
1159985609 18:74837123-74837145 CTTTCAACACATTTAATAGTAGG - Intronic
1162794975 19:13082248-13082270 GTATCAGCACTGTTGACATTTGG + Intronic
1167835952 19:52070180-52070202 ATTTCTACACTCTTGATATTTGG - Intronic
927879031 2:26677497-26677519 GTCTCAGCACTATTGATATTTGG - Intergenic
931469831 2:62527678-62527700 GCTTCAAAACTGCTGATATTTGG - Intergenic
934334963 2:92120329-92120351 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934335978 2:92135953-92135975 GCTTCAACACTGTTAGTTGTGGG - Intergenic
934339969 2:92249507-92249529 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934351096 2:92426106-92426128 GGTTCAACACTGTTAATTGAGGG - Intergenic
934366347 2:92668233-92668255 GCTTCAACACTGTTAATTGAGGG - Intergenic
934368044 2:92695741-92695763 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934372323 2:92764066-92764088 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934377424 2:92845782-92845804 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934377695 2:92850192-92850214 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934377882 2:92853249-92853271 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934380723 2:92898349-92898371 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934383953 2:92950833-92950855 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934385932 2:92982595-92982617 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934390340 2:93053913-93053935 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934391282 2:93069192-93069214 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934391934 2:93079713-93079735 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934393185 2:93099736-93099758 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934396293 2:93150490-93150512 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934399148 2:93196541-93196563 GCTTCAACACTGTTAATTGAGGG - Intergenic
934402666 2:93254101-93254123 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934403621 2:93269385-93269407 GGTTCAACACTGTTAATTGAGGG - Intergenic
934407194 2:93326454-93326476 GATTCAACACTGTTAATTGAGGG - Intergenic
934412199 2:93406138-93406160 GGTTCAACACTGTTAATTGAGGG - Intergenic
934414882 2:93449945-93449967 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934426803 2:93641046-93641068 GCTTCAACACTGTTAATTGAGGG - Intergenic
934427019 2:93644445-93644467 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934429277 2:93680773-93680795 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934436665 2:93800241-93800263 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934442443 2:93893493-93893515 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934443927 2:93917605-93917627 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934448342 2:93989081-93989103 GCTTCAACACTGTTAATTGAGGG - Intergenic
934451152 2:94034402-94034424 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934451621 2:94042037-94042059 GCTTCAACACTGTTAATTGAGGG - Intergenic
934454799 2:94142919-94142941 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934879926 2:97967627-97967649 TTTTCAAGAGGGTTGATAGTGGG + Intronic
940103216 2:150066690-150066712 GATTCATCACTGTTGATTCTAGG - Intergenic
942824871 2:180163603-180163625 GCTTCAACACTTTTGAAAGTGGG + Intergenic
945765331 2:213969425-213969447 TTCTTAACACTGTTGATATTTGG - Intronic
946824788 2:223666291-223666313 TTTTCCTCACTGTTGAGAGTAGG + Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
947443451 2:230143387-230143409 ATTTCCTCACTGTTGAGAGTTGG + Intergenic
948959751 2:241324290-241324312 GTTTTCAGACTGTTGACAGTCGG + Intronic
1171445962 20:25205228-25205250 GTTTCATCACTGCTGGTGGTGGG + Intronic
1171585043 20:26510509-26510531 GGTTCAACACTGTTAGTAGAGGG - Intergenic
1171717475 20:28505190-28505212 GGTTCAACACTGTTAGTAGAGGG - Intergenic
1173898049 20:46565830-46565852 GTTTCAACACTGTTGATAGTTGG - Intronic
1174826218 20:53771072-53771094 CTCTCAACACTATTGACAGTTGG + Intergenic
1174969410 20:55256979-55257001 TTTACAACAGTGTTGATACTGGG + Intergenic
1175364103 20:58439497-58439519 GCCTCAACACTGTTGATATTTGG + Intronic
1177584832 21:23077724-23077746 GTTGCACCACTGTTTACAGTAGG + Intergenic
1180715195 22:17866932-17866954 GTTTCAACAGTTTCTATAGTAGG - Intronic
1202717296 2_KI270715v1_random:21833-21855 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202717521 2_KI270715v1_random:25224-25246 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202719145 2_KI270715v1_random:50694-50716 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202719186 2_KI270715v1_random:51374-51396 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202719808 2_KI270715v1_random:61228-61250 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202720910 2_KI270715v1_random:78559-78581 GCTTCAACACTGTTAATTGAGGG - Intergenic
1202721258 2_KI270715v1_random:83999-84021 GCTTCAACACTGTTAATTGAGGG - Intergenic
1202729612 2_KI270716v1_random:50341-50363 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202730682 2_KI270716v1_random:67327-67349 GCTTCAACACTGTTAATTGAGGG - Intergenic
1202731145 2_KI270716v1_random:74469-74491 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202735260 2_KI270716v1_random:140234-140256 GTTTCAACACTGTTAGTTGAGGG - Intergenic
949250004 3:1972638-1972660 GTTTCAACACTGGAAAAAGTCGG + Intergenic
951585450 3:24210580-24210602 GTCTCAGCACTGTTGACATTTGG - Intronic
951761637 3:26153509-26153531 GTCTTAAAACTGGTGATAGTGGG - Intergenic
953592538 3:44273131-44273153 GTTTCAACAGTGTGAACAGTGGG - Intronic
955588519 3:60508780-60508802 GTTTCAACAATCTTTAGAGTAGG + Intronic
955918991 3:63934819-63934841 GTCTCAACACTGTTGACATTTGG + Intronic
955938859 3:64128930-64128952 ACTTCGACACTGTTGATATTTGG + Intronic
958898246 3:99854553-99854575 TCTTCAGCACTGTTGATATTTGG + Intronic
961347775 3:126275225-126275247 GTTTCAACAGTGTTGGAAATTGG + Intergenic
961971056 3:130968732-130968754 GTTTAAACATTTTTGATATTTGG + Intronic
962426989 3:135278933-135278955 GTGTCAAAACTGTGGAGAGTCGG + Intergenic
965440368 3:168705619-168705641 CTTTCTACACTCTTGCTAGTTGG + Intergenic
967572399 3:191045229-191045251 ATTTCAACAATATTCATAGTAGG - Intergenic
967939593 3:194755937-194755959 GTGTCATCACTGTAGATAGCCGG - Intergenic
969004519 4:4008526-4008548 GTTTCAGCACTATTGACATTTGG - Intergenic
970863239 4:20728726-20728748 ATTTCTACACTGGTGATAGCAGG + Intronic
976570647 4:86605336-86605358 GTTTCAAAACAGATGAAAGTTGG + Intronic
976921135 4:90444442-90444464 GTTTCATAACTATTTATAGTTGG + Intronic
977971063 4:103214984-103215006 GTTGCAGCACTGTTTATAATAGG + Intergenic
978136247 4:105264216-105264238 TTTTAAACACTATTAATAGTTGG + Intronic
985412753 4:189703355-189703377 GTTTCAACAATGTTGATGTTTGG + Intergenic
988456592 5:31392421-31392443 ATTTTAATACTGTTGATATTTGG - Intergenic
988856337 5:35231197-35231219 GTTTCAGCACTGTTAAATGTGGG - Intergenic
992393686 5:76352371-76352393 AGTTCAACACTGTTGAGAGGTGG + Intronic
993861941 5:93146851-93146873 ATTTTAACAGTGTTGAGAGTTGG - Intergenic
994801725 5:104385987-104386009 ATTTCATCACTGTGGATAGCTGG + Intergenic
997740975 5:136253716-136253738 ATTTCAACAATATTGATATTAGG + Intronic
1002810355 6:622285-622307 GTGTGAAGACTGTTGTTAGTAGG - Intronic
1006201109 6:32291916-32291938 GTTTCAAAACTTTTGAAACTAGG - Intronic
1010013277 6:71074552-71074574 GTTGCATCACTGTTCATAATAGG + Intergenic
1013796117 6:113891002-113891024 GATGCAACACTGTTGAAAGTAGG + Intergenic
1014038413 6:116795181-116795203 ATCTCATCCCTGTTGATAGTTGG + Intronic
1016189478 6:141245709-141245731 GATACAACACTGGTGATGGTTGG + Intergenic
1018153394 6:160961974-160961996 GTTTCAGACATGTTGATAGTTGG - Intergenic
1018552976 6:165019877-165019899 GTTTCAACACTGTTTGTTGAAGG - Intergenic
1020484863 7:8709156-8709178 TTTTGAACACTGTTGATTGTTGG + Intronic
1022846354 7:34214143-34214165 GTTTCATAACTGTTTTTAGTAGG + Intergenic
1024109329 7:46129438-46129460 GTTTCAACAGTGTGGATATGAGG + Intergenic
1026374194 7:69733790-69733812 GTTTTAACAATGTTGAATGTTGG - Intronic
1027903852 7:84153248-84153270 ATTTCAAGTCTGTTGATAATTGG - Intronic
1028413420 7:90555326-90555348 CTTTCTACGCTGATGATAGTTGG - Intronic
1028559662 7:92160085-92160107 TTTGCAACACTTTTTATAGTAGG - Intronic
1032010270 7:128342127-128342149 CTGTCAACCCTGTTGACAGTTGG - Intronic
1035845584 8:2860999-2861021 TTTTAAACACTGTCAATAGTTGG - Intergenic
1037270899 8:17129213-17129235 GATACTACACTGTTGACAGTAGG - Intergenic
1041893611 8:62899289-62899311 GTTTCAGCACTGTTTACAATAGG + Intronic
1043106491 8:76119320-76119342 GTTTCAACAATTGTGATATTGGG + Intergenic
1043182041 8:77097156-77097178 CTTTCTACACTGATGATATTTGG - Intergenic
1043418252 8:80073618-80073640 GTGTCAACACTGTGGATAAATGG + Intronic
1045334672 8:101188845-101188867 GTTACAACACTGATGATCATAGG + Intronic
1047664057 8:127070579-127070601 GATTCATCACTGTAGATATTAGG + Intergenic
1048528417 8:135225799-135225821 GTTCAGACACTGTTGATTGTGGG + Intergenic
1050307883 9:4323977-4323999 GTTTCAAAAATTTTGATATTAGG + Intronic
1052127396 9:24794291-24794313 AATGCAACACTGTTGATAGGTGG + Intergenic
1052776193 9:32735419-32735441 ATGTCAACACTGTTGCTTGTCGG + Intergenic
1054890879 9:70250455-70250477 GTCTCAGCACTGTTGACATTTGG - Intergenic
1058024362 9:100124644-100124666 GTTTCATGAGTGTTCATAGTTGG + Intronic
1062723443 9:138057655-138057677 GTTTCAACACTCTTGATAGGTGG + Intronic
1188871385 X:35377721-35377743 GTTTCAACAGTGTTGCTTGGAGG - Intergenic
1189008348 X:37018554-37018576 GTTTCATAACAGTTGATAGAAGG - Intergenic
1189065848 X:37807925-37807947 ATTTCAGCACTGTTGATATTTGG - Intronic
1189732024 X:44031286-44031308 ATTTCACCAATGTTGATATTTGG + Intergenic
1190733557 X:53240384-53240406 GTCTCATCACTGTTGACATTTGG - Intronic
1193125452 X:77865837-77865859 ATGTCAGCACTGTTGATTGTTGG - Intronic
1193764942 X:85516188-85516210 TTGTCAACACTGATGATAATTGG - Intergenic
1199195717 X:145027455-145027477 GTTTCAAGACAATTGCTAGTGGG + Intergenic
1199444378 X:147904626-147904648 GTTTTGACACTGTTGCTAGATGG - Intergenic
1201946058 Y:19511462-19511484 GTTGCAACACTGTTCACAATAGG + Intergenic