ID: 1173898766

View in Genome Browser
Species Human (GRCh38)
Location 20:46571682-46571704
Sequence CATGCCCACAGGATCATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173898762_1173898766 6 Left 1173898762 20:46571653-46571675 CCATTCTAGTAAGAGACACAATC No data
Right 1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG 0: 1
1: 0
2: 3
3: 12
4: 187
1173898760_1173898766 20 Left 1173898760 20:46571639-46571661 CCCTCATGGAGCTTCCATTCTAG 0: 4
1: 78
2: 435
3: 1194
4: 2704
Right 1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG 0: 1
1: 0
2: 3
3: 12
4: 187
1173898759_1173898766 24 Left 1173898759 20:46571635-46571657 CCTGCCCTCATGGAGCTTCCATT 0: 6
1: 76
2: 329
3: 1236
4: 2811
Right 1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG 0: 1
1: 0
2: 3
3: 12
4: 187
1173898761_1173898766 19 Left 1173898761 20:46571640-46571662 CCTCATGGAGCTTCCATTCTAGT 0: 3
1: 54
2: 323
3: 1090
4: 2324
Right 1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG 0: 1
1: 0
2: 3
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173898766 Original CRISPR CATGCCCACAGGATCATTTG GGG Intronic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
901330429 1:8403596-8403618 CAAGGCCAGAGGATCACTTGAGG - Intronic
902192644 1:14774306-14774328 CAACCCCACAGGCTCATTAGGGG + Intronic
902316249 1:15621347-15621369 AATGCACACAGCATGATTTGTGG + Intronic
904276369 1:29387380-29387402 CATGGCCCCAGGATCCTTGGCGG - Intergenic
904296029 1:29520318-29520340 CAGGATCACAGAATCATTTGTGG + Intergenic
904922962 1:34023066-34023088 CAAGGCCAGAGGATCATTTGAGG - Intronic
905324984 1:37145522-37145544 CAAGCCCACAGGACCCTTTATGG + Intergenic
906879526 1:49575292-49575314 AATGACCACAGGATGAGTTGAGG - Intronic
907367795 1:53976937-53976959 CAAGGCAAGAGGATCATTTGAGG + Intergenic
907741314 1:57168821-57168843 CAAGGCAAGAGGATCATTTGAGG + Intronic
908805430 1:67926009-67926031 CAAGGTGACAGGATCATTTGAGG - Intergenic
909559817 1:76997764-76997786 CAAGGCCAGAGGATCACTTGAGG + Intronic
909804029 1:79852308-79852330 CAAGGCCAGAGGACCATTTGGGG - Intergenic
910637763 1:89428364-89428386 CATGCCCACAGCTACAGTTGAGG + Intergenic
911722457 1:101206173-101206195 CAAGGCCAGAGGATCACTTGAGG + Intergenic
911778326 1:101843234-101843256 CATGCCCACAGGTTCCTTCGAGG + Intronic
915667821 1:157460820-157460842 AATGACCACAGGATGATTTCAGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919167471 1:193913947-193913969 CATCCTCATAGGATCCTTTGGGG - Intergenic
922652656 1:227354581-227354603 CATGACCACAGGTCCATTTAGGG + Intergenic
923481791 1:234392129-234392151 CAAGGCCAGAGGATCACTTGAGG + Intronic
1066088100 10:31990839-31990861 CAAGGCAAGAGGATCATTTGAGG + Intergenic
1066352084 10:34645083-34645105 CAAGGCGAGAGGATCATTTGAGG - Intronic
1067294806 10:44969394-44969416 CAAGCCCACAGGATCATTAGTGG - Intronic
1070767103 10:79063098-79063120 CATGGCCACAGGATGAGGTGAGG + Intergenic
1072119068 10:92390314-92390336 CAAGGCCAGAGGATCAGTTGAGG + Intergenic
1072356275 10:94614755-94614777 CAGTCCAACAGGATCGTTTGAGG + Intergenic
1072520178 10:96224096-96224118 AATGCCCCGTGGATCATTTGTGG - Intronic
1072770706 10:98134976-98134998 CTTTCCGCCAGGATCATTTGGGG - Intronic
1073458587 10:103652534-103652556 CATGGCCACAGGATAAGCTGGGG + Intronic
1074816726 10:117147511-117147533 CATGCCCTCAAGAGCACTTGAGG - Intergenic
1082090816 11:48088387-48088409 CATTCCCACAAGATAATTTATGG - Intronic
1082642502 11:55681487-55681509 CATGCCGACAGTATAATTGGAGG + Intergenic
1083116699 11:60467106-60467128 CATCCACAAAGGATCATTTATGG + Intronic
1083500412 11:63101852-63101874 CATGTTCTCAGGAACATTTGTGG + Intronic
1085946426 11:81278357-81278379 CATGCCCACACGAGCACTGGGGG + Intergenic
1094622335 12:32091867-32091889 CATGCCCATAGCATCAGCTGGGG + Intergenic
1095987326 12:48007861-48007883 CAAGGCCAGAGGATCACTTGAGG + Intergenic
1096188328 12:49598664-49598686 CATCCCCACGGGTTCATTTCAGG + Intronic
1096776884 12:53969781-53969803 CAAGCCCACTGGAGCATATGTGG + Intergenic
1098885341 12:75955138-75955160 CAGGGCCTGAGGATCATTTGAGG - Intergenic
1101523836 12:105509245-105509267 CATACCCACATTATCATTAGTGG - Intergenic
1101588337 12:106104296-106104318 CATGGCAAGAGGATCACTTGAGG - Intronic
1103118039 12:118354529-118354551 CAAGGCCAGAGGATCACTTGAGG + Intronic
1103592129 12:121999566-121999588 CGTGGCCAAAGGATCACTTGAGG - Intronic
1108614315 13:52116428-52116450 CATGGCGAGAGGATCACTTGAGG + Intronic
1109012148 13:56964559-56964581 CATGCCCACATAATTATATGTGG + Intergenic
1109965143 13:69683144-69683166 TATGAACACAGGATAATTTGAGG - Intergenic
1110133420 13:72035961-72035983 CATGGCCAGAGGATCACTTGAGG - Intergenic
1110210672 13:72968531-72968553 CAAGGCCAGCGGATCATTTGAGG - Intronic
1112626553 13:101111186-101111208 CATGCTGAGCGGATCATTTGAGG - Exonic
1115446311 14:33494410-33494432 CATGCCCAAGGGATCATTTGTGG - Intronic
1118388568 14:65277452-65277474 CGAGGCCAGAGGATCATTTGAGG + Intergenic
1121340404 14:93101614-93101636 CAAGCCAAGTGGATCATTTGAGG + Intronic
1121902597 14:97707492-97707514 CATGCCTACAGGCTCATTCTAGG - Intergenic
1123963499 15:25432665-25432687 CATCTCCTCAGGATCAATTGAGG - Intronic
1127373529 15:58361714-58361736 CGTGCCCACAGAGGCATTTGGGG + Intronic
1127859015 15:62977508-62977530 CAAGGCGAGAGGATCATTTGAGG + Intergenic
1129915941 15:79271705-79271727 CAAGGCCAGTGGATCATTTGAGG + Intergenic
1131086922 15:89583918-89583940 CAAGGCCAGAGGATCACTTGAGG - Intronic
1133269882 16:4605642-4605664 CAAGCCAAGAGGATCACTTGAGG + Intergenic
1133552929 16:6875770-6875792 CATGACAGCAGGATTATTTGAGG + Intronic
1133792017 16:9016429-9016451 CAAGGCAAGAGGATCATTTGAGG - Intergenic
1137069377 16:35887869-35887891 CAAGGCAACAGGATCACTTGAGG - Intergenic
1137259845 16:46817086-46817108 CATGCCTATAGGATCATGTTAGG - Intronic
1137925253 16:52534403-52534425 CATGGCGAGAGGATCACTTGAGG + Intronic
1140471466 16:75217753-75217775 CAAGGCCACAGGATCACCTGAGG + Intergenic
1141274078 16:82569275-82569297 AAAGGCCACAGGGTCATTTGGGG + Intergenic
1141819146 16:86432980-86433002 CATGCACACATGATCCTCTGGGG - Intergenic
1143551348 17:7632210-7632232 CAAGACCAGAGGATCACTTGAGG + Intronic
1143559823 17:7686916-7686938 CATTCCGAAATGATCATTTGGGG - Exonic
1143971526 17:10799428-10799450 CAAGGCCAGAGGATCACTTGAGG - Intergenic
1144647575 17:16985956-16985978 CATGACAGGAGGATCATTTGAGG + Intergenic
1144721733 17:17475884-17475906 CATGCCAACAAGACCTTTTGGGG + Intergenic
1145078242 17:19873132-19873154 CCTTCCCACATGATCACTTGAGG + Intergenic
1151711815 17:75811335-75811357 CAAGGCAAGAGGATCATTTGAGG - Intronic
1152158415 17:78650346-78650368 ATTTCCCAAAGGATCATTTGTGG - Intergenic
1153246064 18:3073724-3073746 CATGCCCACATGTGCATTGGGGG + Intronic
1155149942 18:23115206-23115228 CACTCCCACAGAAGCATTTGGGG - Intergenic
1155756803 18:29508512-29508534 CATGTACAAAGAATCATTTGAGG - Intergenic
1156896730 18:42255225-42255247 CAAGGCCAGTGGATCATTTGAGG - Intergenic
1157427665 18:47597933-47597955 CATTCCCAGAAGCTCATTTGAGG + Intergenic
1157479506 18:48044462-48044484 CATGCCAGCAGGCTCCTTTGGGG + Intronic
1158053165 18:53248329-53248351 TATGCCCACAGGACCATTCTGGG - Intronic
1158504250 18:58032060-58032082 CAAGGCCAGAGGATCATTTGAGG + Intergenic
1159645509 18:70913880-70913902 AATGCCCACAAGATAAATTGGGG - Intergenic
1159820590 18:73137523-73137545 CATGCCCACAGTATCAAATGCGG - Intergenic
1160241362 18:77125534-77125556 CATGACCACATGTTCTTTTGTGG + Intronic
1160956186 19:1693016-1693038 CAAGGCGAGAGGATCATTTGAGG - Intergenic
1161676501 19:5653339-5653361 CTTTCCCACAGGTTCATTTTTGG - Exonic
1164247868 19:23449339-23449361 CATGCACACAGGATCCTTCAAGG + Intergenic
1164282037 19:23777570-23777592 CCTGCCCACAGGATGCTTTGTGG + Intronic
1164312678 19:24059902-24059924 CCTGCCCACAGGAGGCTTTGTGG + Intronic
1164991773 19:32689682-32689704 TCTGCTCACAGGATAATTTGTGG - Intergenic
1165203146 19:34161357-34161379 CAAGGCCAGAGGATCACTTGAGG + Intergenic
1165381279 19:35482466-35482488 CAAGGCCAGAGGATCACTTGAGG + Intergenic
1165662458 19:37593813-37593835 CATCCCCGCAGCATCATTTATGG + Intronic
1167088757 19:47328865-47328887 CAAGGCCAGTGGATCATTTGAGG - Intergenic
925045120 2:767034-767056 CCTGCCCACTGGATCCTCTGTGG - Intergenic
926245477 2:11119902-11119924 CAAGGCGGCAGGATCATTTGAGG + Intergenic
931805610 2:65800820-65800842 CAGGGCCAGAGGATCACTTGAGG - Intergenic
932708314 2:74043925-74043947 TAAGGCCAGAGGATCATTTGAGG + Intronic
933935226 2:87198517-87198539 CATACCCTCAGGATTTTTTGAGG - Intergenic
936357923 2:111767382-111767404 CATACCCTCAGGATTTTTTGAGG + Intronic
940465050 2:154016737-154016759 CAAGCCAACAGGATGATTTGAGG + Intronic
940681054 2:156785717-156785739 CATGATCATAGGATCCTTTGTGG + Intergenic
941067371 2:160918785-160918807 CCTGGACATAGGATCATTTGAGG - Intergenic
942850340 2:180477048-180477070 CAAGGCCAGAGGATCACTTGAGG - Intergenic
943601427 2:189925572-189925594 CATGTCCATAGGTTCATTTGTGG + Intronic
944765449 2:202860041-202860063 CATGGCAAGAGGATCACTTGAGG + Intronic
945163988 2:206922782-206922804 CATGCCCACAAGATGCTCTGTGG + Intergenic
946595803 2:221304680-221304702 CATGACCACAAGACCATTTTTGG + Intergenic
1172362988 20:34327174-34327196 CACAGCCAGAGGATCATTTGAGG + Intergenic
1173534730 20:43800813-43800835 CAAGGCCAGAGGATCACTTGAGG - Intergenic
1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG + Intronic
1174115729 20:48225143-48225165 CATGCACACAGGCACATTGGTGG - Intergenic
1175867040 20:62184390-62184412 CATGCTCACAGGAGGATTTGAGG + Intronic
1176376744 21:6090510-6090532 CCTGCCCACAGCTTAATTTGGGG + Intergenic
1177607140 21:23395455-23395477 CAAGGCAAGAGGATCATTTGAGG + Intergenic
1178024524 21:28451218-28451240 CATGCCCATGGGACCATTTCTGG + Intergenic
1179746731 21:43447734-43447756 CCTGCCCACAGCTTAATTTGGGG - Intergenic
1181628827 22:24139801-24139823 GATGCCCACATGAATATTTGTGG + Intronic
1183157142 22:36084377-36084399 CAAGCCAAGAGGATCACTTGAGG - Intergenic
1185359862 22:50399542-50399564 CATGACCACAGGCTCAATTATGG + Intronic
949697664 3:6717859-6717881 CTTCCCCATAGAATCATTTGCGG - Intergenic
950728971 3:14939720-14939742 CACGCCCACAGTAATATTTGAGG + Intergenic
952233980 3:31460141-31460163 CATGCACACTGGCTCATTGGTGG + Intergenic
952278857 3:31903967-31903989 GCTGCCCACAGAATCCTTTGAGG - Intronic
960284783 3:115815793-115815815 CTTGGAAACAGGATCATTTGAGG - Intronic
960821562 3:121738536-121738558 AATGCCCACTGGCTCTTTTGAGG - Intronic
963040975 3:141069575-141069597 CTTCCCCACAGGATCATAGGAGG + Intronic
964733904 3:159896048-159896070 CATGCCCTTAGGATTAATTGGGG + Intronic
966040047 3:175472544-175472566 GATGCCCACAGGACTTTTTGGGG + Intronic
967066522 3:185922169-185922191 CATAGCCACAGGATAATTAGTGG - Intronic
971320315 4:25600229-25600251 CATGGCCACAGAACCCTTTGGGG - Intergenic
973734996 4:53863090-53863112 CAGACACACAGTATCATTTGGGG + Intronic
975433436 4:74321996-74322018 CACACCCACAGGATCATTTTAGG + Intergenic
980783712 4:137525286-137525308 CCTGCCAACAGGGTCATTTCTGG - Intronic
982652256 4:158100765-158100787 GATGCCAACATGACCATTTGTGG - Intergenic
982658225 4:158175098-158175120 CATGTCCACTGGATCACTTGTGG - Intergenic
983312410 4:166081444-166081466 CCTGCTCACAAGAACATTTGTGG - Intronic
984087681 4:175332560-175332582 AATGACCACAGGTTCTTTTGGGG - Intergenic
986433871 5:7709145-7709167 GATGCCAAAAGGATCATGTGTGG + Intronic
987337633 5:16911068-16911090 CAGGCCAAGAGGATCACTTGAGG + Intronic
987920071 5:24268260-24268282 CAAGGCGAGAGGATCATTTGAGG - Intergenic
989374733 5:40748900-40748922 CAAGGCCAGTGGATCATTTGAGG + Intronic
989626686 5:43436473-43436495 CAAGGCAAAAGGATCATTTGAGG + Intergenic
990763818 5:59160574-59160596 CAAGGCCAGAGGATCACTTGAGG - Intronic
994357127 5:98805607-98805629 CAAGGCCAGAGGATCACTTGTGG + Intergenic
994389081 5:99168292-99168314 CATGCACAGAGGATCATTCCAGG - Intergenic
994445440 5:99866876-99866898 CATATTCACATGATCATTTGAGG - Intergenic
994493283 5:100476047-100476069 CACTCCTACAGGATTATTTGAGG + Intergenic
995851567 5:116551671-116551693 CATGCACATAGTTTCATTTGCGG + Intronic
997156691 5:131568549-131568571 CAAGGCCAGAGGATCACTTGAGG - Intronic
998149934 5:139751037-139751059 CATGCCCCCAGGAACATTTGGGG - Intergenic
1000729398 5:164813458-164813480 TTTGCCCATAGGATCATGTGAGG + Intergenic
1003710380 6:8583013-8583035 CAGGCCCACACCATCATTTCCGG + Intergenic
1003980323 6:11383243-11383265 AAGCACCACAGGATCATTTGGGG - Intergenic
1004099140 6:12591209-12591231 CAAGGCCAGCGGATCATTTGAGG + Intergenic
1004806192 6:19205903-19205925 CATGCCAACAAGAGTATTTGTGG + Intergenic
1007490578 6:42218376-42218398 CAAGGCCAGAGGATCACTTGAGG - Intergenic
1007702670 6:43773747-43773769 CATGCCCACAGGTTGCTTAGAGG - Intronic
1010227352 6:73503343-73503365 CAAGGCAAGAGGATCATTTGAGG - Intronic
1010340254 6:74741978-74742000 CAGGTCAACAGAATCATTTGGGG - Intergenic
1010371924 6:75120284-75120306 AATGTCCAGAGGATTATTTGAGG + Intronic
1010650353 6:78447427-78447449 CATACCTACAGGATCATGAGAGG - Intergenic
1012058088 6:94441500-94441522 TATGCCCAAAGGAACATTTTGGG + Intergenic
1022371958 7:29780400-29780422 CAAGACAAGAGGATCATTTGAGG - Intergenic
1023319112 7:38974789-38974811 CATTCCCACAGTAGCATTTTAGG - Intergenic
1024949269 7:54841689-54841711 CATACCCAGAGGAGGATTTGTGG - Intergenic
1026144214 7:67731672-67731694 CAAGGCCAGAGGATCACTTGAGG - Intergenic
1026549510 7:71356208-71356230 CAAGGCAAGAGGATCATTTGAGG - Intronic
1027601320 7:80244907-80244929 CTTCCCCACAGGATCAACTGAGG - Intergenic
1029852321 7:103475983-103476005 CAAGGCAACAGGATCACTTGAGG - Intronic
1030562618 7:111109679-111109701 CATGCTGACAGGATTATTAGGGG + Intronic
1033258943 7:139825623-139825645 CATGTCCACAGGTTGATGTGAGG + Intronic
1033327226 7:140389861-140389883 CAAGGCAAGAGGATCATTTGAGG + Intronic
1034579090 7:152026881-152026903 CATGCTCTCAGGATCTCTTGAGG + Intronic
1035118596 7:156546078-156546100 AATGCACACAGGATCTCTTGGGG + Intergenic
1037437168 8:18875149-18875171 CAAGGCGAGAGGATCATTTGAGG - Intronic
1038114381 8:24536655-24536677 CAAGTTCACAGGTTCATTTGAGG + Intergenic
1038687143 8:29728973-29728995 GATGCCCTCCGGATCATTTAAGG - Intergenic
1041666583 8:60451092-60451114 CATGCCCACAGGAGAAAGTGGGG + Intergenic
1042043352 8:64619947-64619969 CAAGGCCAGAGGATCATTTGAGG + Intronic
1045282419 8:100760666-100760688 CAAGGCAAAAGGATCATTTGAGG - Intergenic
1046567341 8:115918205-115918227 CATGCCCAAAAGACAATTTGTGG - Intergenic
1051485662 9:17605209-17605231 CAAGACAAGAGGATCATTTGAGG - Intronic
1052453794 9:28667509-28667531 CATGGCAAGTGGATCATTTGAGG + Intronic
1053015121 9:34657447-34657469 CATGCCCACAGGATCCCCTAGGG + Exonic
1056071668 9:82993434-82993456 CATGACCACAGAATCATATTTGG + Intronic
1056681938 9:88726995-88727017 CATGCTCTCAGGATCTCTTGAGG - Intergenic
1057578928 9:96268155-96268177 CAAGGCCAGTGGATCATTTGAGG - Intronic
1061396892 9:130348390-130348412 CAGGTCCACAGGACCCTTTGTGG + Intronic
1186026160 X:5315562-5315584 CAAGGCCAGAGGATCACTTGAGG + Intergenic
1189340641 X:40202199-40202221 TCTGCCCATAGGATCACTTGAGG - Intergenic
1190242345 X:48667276-48667298 CAAGGCCAGAGGATCACTTGAGG + Intergenic
1193962541 X:87943920-87943942 CATGTCCTCAGGATCTCTTGAGG - Intergenic
1196589790 X:117472832-117472854 CAAGGCCACTGGATCACTTGAGG - Intergenic
1198009846 X:132540598-132540620 CATATTCACAGGATCATTGGAGG + Intergenic
1198475999 X:136998962-136998984 GATGCCCACAGGATCAGTGAGGG + Intergenic
1199550334 X:149055034-149055056 CATCTCCATAAGATCATTTGGGG + Intergenic
1201985083 Y:19957215-19957237 CATGGCCATAGGAACATTGGTGG + Intergenic