ID: 1173899290

View in Genome Browser
Species Human (GRCh38)
Location 20:46575526-46575548
Sequence CAGCAGGAACAGTGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 0, 2: 9, 3: 69, 4: 609}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173899290_1173899305 15 Left 1173899290 20:46575526-46575548 CCTGCCTCCCACTGTTCCTGCTG 0: 1
1: 0
2: 9
3: 69
4: 609
Right 1173899305 20:46575564-46575586 GGGTCTTACCTCACAGCCTTTGG 0: 1
1: 0
2: 3
3: 15
4: 149
1173899290_1173899299 -8 Left 1173899290 20:46575526-46575548 CCTGCCTCCCACTGTTCCTGCTG 0: 1
1: 0
2: 9
3: 69
4: 609
Right 1173899299 20:46575541-46575563 TCCTGCTGGTTGGGGGAGCCAGG 0: 1
1: 0
2: 3
3: 46
4: 277
1173899290_1173899306 21 Left 1173899290 20:46575526-46575548 CCTGCCTCCCACTGTTCCTGCTG 0: 1
1: 0
2: 9
3: 69
4: 609
Right 1173899306 20:46575570-46575592 TACCTCACAGCCTTTGGCCATGG 0: 1
1: 0
2: 0
3: 17
4: 177
1173899290_1173899303 -5 Left 1173899290 20:46575526-46575548 CCTGCCTCCCACTGTTCCTGCTG 0: 1
1: 0
2: 9
3: 69
4: 609
Right 1173899303 20:46575544-46575566 TGCTGGTTGGGGGAGCCAGGGGG 0: 1
1: 0
2: 0
3: 41
4: 539
1173899290_1173899301 -7 Left 1173899290 20:46575526-46575548 CCTGCCTCCCACTGTTCCTGCTG 0: 1
1: 0
2: 9
3: 69
4: 609
Right 1173899301 20:46575542-46575564 CCTGCTGGTTGGGGGAGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 319
1173899290_1173899302 -6 Left 1173899290 20:46575526-46575548 CCTGCCTCCCACTGTTCCTGCTG 0: 1
1: 0
2: 9
3: 69
4: 609
Right 1173899302 20:46575543-46575565 CTGCTGGTTGGGGGAGCCAGGGG 0: 1
1: 0
2: 1
3: 34
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173899290 Original CRISPR CAGCAGGAACAGTGGGAGGC AGG (reversed) Intronic
900122161 1:1053433-1053455 AAGCAGGAAGAGAGGGAGGCGGG - Intronic
900164551 1:1239536-1239558 CAGCAGGAGCCAGGGGAGGCAGG - Intergenic
900749162 1:4383365-4383387 CATCAGGGACAGTGGGAGGTGGG + Intergenic
900875664 1:5340819-5340841 CAGCAGGAACAAAGGGCAGCAGG + Intergenic
900912635 1:5612437-5612459 CAGCAGGAACAGTGTGATTAGGG + Intergenic
901070172 1:6513048-6513070 CACCAGGAACAGTGGGTGGGCGG - Intronic
901275321 1:7986709-7986731 CCGCAGGAGCATTGAGAGGCGGG + Intergenic
901439621 1:9269790-9269812 CAGCAGGAACCCTGGGCAGCGGG + Exonic
901445399 1:9305175-9305197 CAGCATGAAGAGTGTGAGACGGG - Intronic
901497880 1:9632484-9632506 CAGCAGAAACAGAGGGCAGCTGG - Intergenic
901702551 1:11053424-11053446 CAGCAGGAACAATGCCTGGCGGG + Intergenic
901712451 1:11126346-11126368 GAGAAGTAACAGTGGAAGGCAGG - Intronic
902263337 1:15243676-15243698 CAGCAGGTAATGTGGGTGGCAGG + Intergenic
902556285 1:17248848-17248870 CACCAGGAACTGTTGGGGGCAGG - Intergenic
902667815 1:17951876-17951898 GAGGAGGGACAGTGGGAAGCAGG + Intergenic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
902731589 1:18373488-18373510 CAGCAGTAAAAGAGGGAGTCAGG + Intronic
902888846 1:19426681-19426703 AAGCTGGAACAGTGGGAGCCTGG - Intronic
902933717 1:19749114-19749136 CATCTAGCACAGTGGGAGGCAGG + Intronic
902949271 1:19869058-19869080 CAGCAGTCACAGTGAGATGCAGG + Intergenic
903043901 1:20552232-20552254 CAGCAGGAATCGTGGGGCGCGGG + Intergenic
904690038 1:32286972-32286994 CAGAGGGAACAGGGTGAGGCAGG + Intergenic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
905008621 1:34731250-34731272 CAGAGGGAACAGTGGGAGAGAGG - Intronic
905414330 1:37794205-37794227 CACCAGGAACAGAGCGATGCAGG - Exonic
905864473 1:41369166-41369188 AAGCAGGAAAAGTGGGAGGAAGG - Intronic
906108839 1:43310108-43310130 CAGCAGGGTCAGGGGGTGGCAGG - Intronic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
906381268 1:45333377-45333399 GAGCAGGGACAGTGGGTGGGAGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907260374 1:53213630-53213652 CATCATGAAAACTGGGAGGCCGG + Exonic
907412782 1:54294350-54294372 CAGAAGGAACAGTTTGTGGCAGG - Intronic
908494044 1:64676982-64677004 CAGCAGGTGCAGTCAGAGGCTGG + Exonic
909563734 1:77032480-77032502 CAGCAGGGTCAGTGAGTGGCTGG + Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
911049187 1:93655098-93655120 CAGCAGGAACAGTAAGGGGCTGG + Intronic
911288537 1:96027929-96027951 CTGCAGGAACAGTGTGGGGCAGG - Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
913198123 1:116474937-116474959 CAGCTGTAACACGGGGAGGCTGG - Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913475652 1:119234801-119234823 CAGCAGGAACACTGAGTGGCTGG - Intergenic
914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG + Exonic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
916844518 1:168635699-168635721 CAGCACCAGCAGTGGGAAGCAGG + Intergenic
918161234 1:181902049-181902071 CAGCTGGCACACTGGGAGGATGG + Intergenic
918379669 1:183941356-183941378 CAGCTGGACGAGTGTGAGGCAGG - Intronic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
921117879 1:212111668-212111690 CAGCAAGCACAGGGGCAGGCAGG - Intergenic
921835322 1:219772422-219772444 TGGCAGGGACTGTGGGAGGCAGG - Intronic
922424568 1:225481032-225481054 CAGCAGGGGCTGTGGGAGGCAGG - Intergenic
922540438 1:226414861-226414883 CAGCAGGGACTGTGGGAGGCAGG - Intergenic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1063967672 10:11359488-11359510 CAGCAGGCAGAGTGGGAAGCGGG - Intergenic
1064002621 10:11676108-11676130 CAGGAGGAAGAGAGCGAGGCAGG - Intergenic
1064378279 10:14816705-14816727 AAGCAGGGAGAGTGGGAGGAAGG - Intergenic
1064642165 10:17426126-17426148 AAGCAGGGGCTGTGGGAGGCTGG - Intronic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1065738536 10:28775730-28775752 CAGGAGGAAGAGAGAGAGGCAGG + Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1066410617 10:35165219-35165241 CAGCAGGAGAAGGGGGAGCCAGG + Intronic
1066517964 10:36184943-36184965 CAGAAGGACCACTGGGGGGCTGG + Intergenic
1067219306 10:44332422-44332444 CAGCAGGCACATGGGGAAGCTGG + Intergenic
1067704369 10:48596148-48596170 CAGCAAGGGCAGTGGGAAGCCGG + Intronic
1068649100 10:59501669-59501691 CAGCAGGGACAATGGGACACTGG + Intergenic
1068859149 10:61829325-61829347 CAGCATTAACAGTGGGAACCCGG - Intergenic
1069752591 10:70753827-70753849 CAGCCGGAGCTGTGGGAAGCTGG + Exonic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070162182 10:73873469-73873491 CAGCAGGAACAGTTGAAGGTCGG + Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070289255 10:75104035-75104057 CAGCAGGATCAGTGCCAGGGTGG + Intronic
1070360126 10:75680254-75680276 CAGGAGTAACAGTAGGATGCTGG + Intronic
1070568302 10:77620386-77620408 AAGCAGGAGCTGTGGGAGGGAGG + Intronic
1070815201 10:79318486-79318508 CAGCAGGGACAGTGGGGAGCTGG - Intergenic
1072098240 10:92203998-92204020 CATCAGAAGCAGTGGGAGACAGG - Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072750887 10:97977914-97977936 CATCAGGAACAGCAGCAGGCTGG - Intronic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1072784646 10:98271310-98271332 CGTCAGGAACAGTGAGATGCAGG - Intergenic
1073315726 10:102579411-102579433 CAGCAGGGGAGGTGGGAGGCTGG - Intronic
1073489531 10:103843802-103843824 TGGCAGCAACAGTGGGAGCCAGG - Intronic
1074412461 10:113240137-113240159 CTGCAGGAGGAGTGGGAGGGAGG - Intergenic
1075349202 10:121708844-121708866 CAGAAGGCACAGTGAGAAGCGGG + Intergenic
1075392742 10:122104596-122104618 CAGGAGGATCAGTTGGAGTCAGG - Intronic
1075621223 10:123929645-123929667 CAGCAGGAATAGTGGGGGTGAGG - Intronic
1075662423 10:124207284-124207306 CAGCATGAACAGAGGTTGGCGGG + Intergenic
1075680581 10:124328412-124328434 CAGCATGAACAGTGAAAGCCTGG - Intergenic
1075777041 10:124995880-124995902 CTGCAGGAACGGGGGAAGGCAGG - Intronic
1076034800 10:127190671-127190693 CAGCAGGAACGGGGGGGGGGGGG - Intronic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076365109 10:129916633-129916655 CAGCAGGGCCAGCGAGAGGCTGG + Intronic
1076857738 10:133125861-133125883 CAGGAGGAAAGGTGGGAGGCAGG - Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077128334 11:955383-955405 CAGCAGGTACAGGAGGATGCTGG - Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077326566 11:1966606-1966628 CAGCAGGCACCGGGGGAGGAGGG - Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077382857 11:2253648-2253670 TAGCACAAACAGTGGGAGGAAGG + Intergenic
1077388676 11:2288826-2288848 CAAGAGCAACAGTTGGAGGCAGG - Intergenic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1079298033 11:19252116-19252138 CAGTAGGGGCAGTGGGAGGTCGG - Intergenic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1079500048 11:21093015-21093037 CAACAGGAACAGGGCTAGGCAGG + Intronic
1080417895 11:32086673-32086695 TAGAAGGAACAGTGGGTGCCAGG - Intronic
1080779485 11:35418236-35418258 CAGCTGGAATCTTGGGAGGCAGG + Intronic
1082004888 11:47414022-47414044 CAGGGGGAACAGTGTGAGGTGGG - Intronic
1082116761 11:48337447-48337469 CAGCTGGAACAGATGGTGGCTGG - Intergenic
1082162503 11:48900587-48900609 CAGCGGGACAGGTGGGAGGCCGG + Intergenic
1082257036 11:50042863-50042885 CAGCTGGAACAGATGGTGGCTGG + Intergenic
1082799813 11:57406281-57406303 AGGAAAGAACAGTGGGAGGCAGG - Intronic
1082930849 11:58603555-58603577 CAGCAGAAACACTGCCAGGCTGG + Intronic
1082972931 11:59042815-59042837 GTGAAGGAACAGTGGGAGGTTGG + Intronic
1082977335 11:59086385-59086407 GTGAAGGAACAGTGGGAGGTTGG + Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083406860 11:62463593-62463615 CAGCACGCACAGTGGGATGTAGG - Intronic
1083607185 11:63986183-63986205 CACCGGGAACTTTGGGAGGCTGG + Exonic
1084408832 11:68994373-68994395 CAGCAGGAACAGCGGGGACCCGG + Intergenic
1084768017 11:71325002-71325024 CAGCAGGAGCGATGGGAGGGTGG + Intergenic
1085080305 11:73628465-73628487 AAGCAGGAAGACTAGGAGGCAGG - Intergenic
1085775827 11:79365706-79365728 CAACAGGCACAGAGGGAAGCAGG + Intronic
1085984777 11:81772330-81772352 CTGCAGGGAGAGTGGGTGGCTGG + Intergenic
1086140436 11:83492861-83492883 CAGCAGGAATAGGTGGAAGCAGG - Intronic
1086429524 11:86721781-86721803 GAGAAAGAAGAGTGGGAGGCAGG + Intergenic
1086625853 11:88951437-88951459 CAGCAGGCTCAGTGGCAGACAGG - Intronic
1087643719 11:100783484-100783506 AAGAAGGCACAGTGGGAGGGTGG + Intronic
1089514212 11:119021471-119021493 CAGCAGAAACATTGCCAGGCAGG - Intronic
1089573703 11:119426354-119426376 TACCAGGAGCTGTGGGAGGCAGG + Intergenic
1089637918 11:119828153-119828175 CAGCTGGGAAAGAGGGAGGCTGG + Intergenic
1089865701 11:121629315-121629337 CAGGAGGGACAGTGGGAAGCTGG + Intronic
1090902189 11:131042922-131042944 AGGAAGGAACAGGGGGAGGCTGG + Intergenic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091284679 11:134402034-134402056 AAGCAGGAACAGAGGGAGCCAGG - Intronic
1202809547 11_KI270721v1_random:21785-21807 CAGCAGGCACCGGGGGAGGAGGG - Intergenic
1091753907 12:3039611-3039633 CAGCAGGAACCGGGGATGGCAGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1092459355 12:8672755-8672777 AAGCAGGAGCACGGGGAGGCGGG - Intergenic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1093880293 12:24396491-24396513 CAGCATGAACAATGGGAACCGGG - Intergenic
1094184869 12:27630758-27630780 AAGCAGGAAGAGTGAGAGGGAGG - Intronic
1094375981 12:29787669-29787691 CAGAAGCAACAGTGGCAGCCCGG + Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095238793 12:39832541-39832563 AAGCAGGAAAAGTGGGAAGTTGG - Intronic
1095399184 12:41795021-41795043 TGGCAGGAACAGAGGGTGGCAGG + Intergenic
1096195464 12:49646584-49646606 CAGCAGGAATCCTGGGAGACGGG + Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097071595 12:56359159-56359181 CAGCAGGAACAAGGGAAGGGAGG + Intronic
1098281574 12:68867774-68867796 CAGCATGAGCAGTGGCAGCCTGG - Intronic
1099230282 12:80015430-80015452 AAGCAGTAACAGGGGAAGGCTGG - Intergenic
1099430835 12:82583602-82583624 CAAAAGGAAGAGTGGGAGGTAGG + Intergenic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1101062116 12:100983230-100983252 CAGCCTTAACAGTGGGAGCCTGG + Intronic
1102108917 12:110349295-110349317 CAGCAGGCACATTGCGGGGCTGG - Intronic
1102375733 12:112419332-112419354 CAGCCGGAACTCGGGGAGGCAGG - Intronic
1102481874 12:113229455-113229477 CAGCAGGGACAGGGGGACGCTGG - Intronic
1102531729 12:113551657-113551679 CAGAAGGAAGAAGGGGAGGCAGG - Intergenic
1103949182 12:124542010-124542032 GAGTAGGAACAGTGTGGGGCAGG + Intronic
1104313723 12:127677774-127677796 CTGCAGGCCCAGTGGGTGGCTGG + Intergenic
1104459078 12:128939730-128939752 CAGGAGGAAAAGCGCGAGGCTGG + Intronic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1106304657 13:28498710-28498732 TAGCAGGAACAGGAGGAGCCAGG - Intergenic
1106498002 13:30299081-30299103 CAAGAGGAACAGTGGGAGCCTGG + Intronic
1106574409 13:30961379-30961401 TAACAGGTACAGTGGAAGGCAGG - Intronic
1106704317 13:32264663-32264685 AACCAGGATCAGTGAGAGGCAGG - Intronic
1107126999 13:36856765-36856787 CAGCAGGTCCAGGGTGAGGCCGG + Intronic
1107396992 13:40028170-40028192 CATGTGCAACAGTGGGAGGCTGG - Intergenic
1108521605 13:51251588-51251610 CACCCGGAACAGCGGGAGGTCGG - Exonic
1110442784 13:75543997-75544019 CAGCAGATACACTGGGAGTCAGG - Intronic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1111360449 13:87168457-87168479 CACCAGGAACAGGGAGAGGCTGG + Intergenic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1112080021 13:95959302-95959324 CAACAGGAGCAATTGGAGGCAGG - Intronic
1112327210 13:98449876-98449898 CATAGGGAACAGTGGGGGGCAGG - Intronic
1113823446 13:113231989-113232011 CAGTAGTAACAGTGGTAGGCGGG - Intronic
1113823511 13:113232263-113232285 CAGCAGTAATAGTGGTGGGCGGG - Intronic
1113823518 13:113232295-113232317 CAGCAGTAATAGTGGTGGGCGGG - Intronic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1114673975 14:24429206-24429228 CAGGAGTAAGAGTGGGAGGCAGG - Exonic
1114842059 14:26275840-26275862 CAACAGGAACAGAAGGAGGGAGG + Intergenic
1115160972 14:30393492-30393514 CACCAGGCACAGTGGAAGACAGG - Intergenic
1116111009 14:40581459-40581481 CAGCATGAAGAGTGTGAAGCTGG + Intergenic
1116674253 14:47885191-47885213 CAGGAGGAAGGGTGGGAGGCAGG - Intergenic
1116881865 14:50178573-50178595 CAGGAGGATCACTTGGAGGCAGG - Intronic
1116954550 14:50910774-50910796 CTGCAGGAAAAGTGGAAGGAAGG - Intronic
1116968273 14:51037931-51037953 CAGCAGCAACACTGAGAGTCAGG + Intronic
1117132701 14:52702057-52702079 AAGTAGGAAAAGTGGGAGTCTGG + Intergenic
1117518359 14:56525232-56525254 AAACAGAAACAGTGGGAGGCTGG + Intronic
1117518861 14:56530313-56530335 CAGCAGAGACTGTGGAAGGCTGG - Intronic
1117865393 14:60143075-60143097 CAGCAGGCACAATGCTAGGCAGG + Exonic
1118081077 14:62361622-62361644 CAGCTGGGACTGTGGGAAGCAGG - Intergenic
1118107245 14:62673861-62673883 CAGTAGGGGCAGTGGGAGTCAGG - Intergenic
1118132393 14:62981688-62981710 CATCACCAACAGTGGGATGCCGG - Intronic
1118601215 14:67472567-67472589 CAGCCGGAACAGTGGAGGGAAGG + Exonic
1118809699 14:69263960-69263982 CAGCAGCCAAACTGGGAGGCAGG + Intronic
1118900201 14:69980037-69980059 CAGCTGGACCAGTGAGAGCCTGG - Intronic
1119298623 14:73552989-73553011 AGCCAGGAACAGTGGGAGTCAGG - Intronic
1119302914 14:73585165-73585187 AGACAGGAACAGTGGGAGTCAGG - Intergenic
1121020253 14:90575573-90575595 CTGCAGCACCAGTGGGAGGGGGG + Intronic
1121339170 14:93094741-93094763 CTGCAGGCACAGGGAGAGGCAGG + Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122104012 14:99437392-99437414 CAGCAGAAAGAGTGGGAGTAGGG - Intronic
1123016145 14:105376667-105376689 CTGCAGGAGCAATAGGAGGCGGG - Intronic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123067952 14:105627717-105627739 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123071972 14:105646442-105646464 GAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123091633 14:105744718-105744740 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123509275 15:20979829-20979851 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123566499 15:21553576-21553598 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123602760 15:21990862-21990884 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1124193225 15:27598268-27598290 CACCAGGGGCTGTGGGAGGCAGG + Intergenic
1125453287 15:39831501-39831523 GAGCAGGAACATTTGGGGGCAGG - Intronic
1125462701 15:39921059-39921081 CGGCTGGAAGCGTGGGAGGCCGG + Intergenic
1125932343 15:43609454-43609476 CATCTGGGAGAGTGGGAGGCTGG - Intronic
1125945439 15:43708926-43708948 CATCTGGGAGAGTGGGAGGCTGG - Intergenic
1126156968 15:45574539-45574561 CAGCAGGAACAGGTGCTGGCAGG + Intergenic
1126238746 15:46416830-46416852 GAGCAGGAAGAGTGGGAGTGGGG - Intergenic
1126252686 15:46587824-46587846 CAGCAGTGACAGTGGTGGGCTGG + Intergenic
1126485559 15:49176207-49176229 AAGCAGGAACAGGGGAAGTCAGG - Intronic
1126637289 15:50791852-50791874 CCCCAGCAAGAGTGGGAGGCAGG + Intergenic
1126695937 15:51325387-51325409 GAGCAGAAAAAGTGGGTGGCAGG - Intronic
1128478368 15:68016550-68016572 CAGGAGGAAGAGAGAGAGGCAGG - Intergenic
1129115443 15:73363024-73363046 CAGCTGGCACAGTGGGCAGCAGG - Intronic
1129243269 15:74264345-74264367 CAAAGGGAACGGTGGGAGGCCGG + Intronic
1129355148 15:74985805-74985827 CGTCAGAAACAATGGGAGGCAGG + Intronic
1129651941 15:77497231-77497253 CAGCAGATGCTGTGGGAGGCTGG - Intergenic
1129712019 15:77825302-77825324 CAGCAGGAGCTGTGGGTGTCGGG + Intergenic
1129832611 15:78680655-78680677 CAGCAGGTGCAAGGGGAGGCTGG - Intronic
1129968009 15:79754021-79754043 CAGAAGGCACTGTGGGAGACAGG - Intergenic
1130329851 15:82913510-82913532 TAGCAGAAATAGGGGGAGGCAGG - Intronic
1130360345 15:83179160-83179182 CACCAGGGGCAGTGGGAGGCAGG - Intronic
1130977141 15:88785340-88785362 CAGCAGGGGCTGTGGGAGGCAGG + Intergenic
1131438276 15:92439932-92439954 CAGCAGTATCCGGGGGAGGCGGG + Intronic
1132062116 15:98700776-98700798 TGCCAGGAAGAGTGGGAGGCAGG - Intronic
1132113556 15:99119507-99119529 AAGCAGTCACAGTGGGAGGCGGG + Intronic
1132142953 15:99409842-99409864 CATCAGGAACAGAGGTGGGCTGG + Intergenic
1132156927 15:99502343-99502365 CCGCAGGAGCAGTGGCAGCCAGG - Intergenic
1132307753 15:100829594-100829616 CATCTGGACCAGTGGCAGGCTGG - Intergenic
1132349467 15:101130484-101130506 CAGAAGGAACAGTGGTTGCCAGG + Intergenic
1202974863 15_KI270727v1_random:280664-280686 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132838957 16:1968948-1968970 CCGCAGGCACAGAGGCAGGCAGG - Exonic
1132973536 16:2700563-2700585 CACCAGGAACAGTGGCAGCCAGG - Intronic
1133056762 16:3149310-3149332 CTGCAGGGCCAGTGGGAAGCTGG + Intronic
1133392701 16:5422596-5422618 CAGGAGGAAGAGTGAGAGGGTGG + Intergenic
1133435800 16:5778523-5778545 CAGCAGGCACTGTGGGGAGCAGG - Intergenic
1135478809 16:22803403-22803425 CATCAGGTACTGTGGGAAGCAGG + Intergenic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1137447121 16:48538668-48538690 CAGCAGGACCAGTAAGAGGCCGG - Intergenic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1137840557 16:51636980-51637002 TAGCAAGAACAGTTGAAGGCAGG - Intergenic
1137912362 16:52391130-52391152 CAACAGGGAGAGTGGGAGGGTGG - Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139307729 16:66001646-66001668 CAGGAGGAAAAGTGAGAGGAGGG + Intergenic
1139486932 16:67263127-67263149 CAGCAGGAACTGCTGGAGGCAGG + Intronic
1140020186 16:71230923-71230945 CCACAGCAACACTGGGAGGCAGG - Intergenic
1140094355 16:71862179-71862201 CTTAAGGAACAGTGGGAGCCAGG + Intronic
1140280521 16:73550410-73550432 CAGTAGGCCCAGTGTGAGGCTGG + Intergenic
1141002976 16:80325357-80325379 CAGCCGGAACAGTGCCTGGCAGG - Intergenic
1141627574 16:85269321-85269343 CAGCAGCATCAGAGGCAGGCTGG + Intergenic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1141915625 16:87094497-87094519 CAGCAGGAACAATGGGCGCTTGG + Intronic
1142174635 16:88639492-88639514 CACCTAGGACAGTGGGAGGCAGG - Intronic
1142197066 16:88743884-88743906 CAGCAGGGAGAGTGGGAAGGAGG + Intronic
1142214107 16:88822409-88822431 CAGCAGGCACCCTGGGAGGAGGG + Intronic
1142220941 16:88854636-88854658 CAGCAGACCCAGTGGGAGGTTGG - Intronic
1142262564 16:89049752-89049774 CGGGAGGCACAGTGGGCGGCCGG + Intergenic
1142478265 17:202502-202524 CAGCAGCAAGAGAGTGAGGCGGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142582302 17:949696-949718 CAGCAGGGAGAGGAGGAGGCAGG - Intronic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143536482 17:7543375-7543397 TGGAAGGAACAGAGGGAGGCAGG + Intergenic
1143574414 17:7782068-7782090 AAGCAGGAACCCTGGGAGGCAGG + Intronic
1143850090 17:9804420-9804442 CAGCAGGCCCATTGGAAGGCAGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144440677 17:15278444-15278466 CAGGAGGAACATTGGAAGGTAGG - Intergenic
1144745592 17:17612108-17612130 CAGCAGGCAAGGTGGGAGGGTGG - Intergenic
1144765225 17:17728897-17728919 CTGCAGGACCCCTGGGAGGCTGG + Intronic
1144922242 17:18773741-18773763 CAGTAGGAAAAGTGGGTGGGAGG + Intronic
1145174665 17:20688850-20688872 CACCAGTAACAGTGGGAGCAGGG - Intergenic
1145294186 17:21575028-21575050 TGCCAGGAACAGAGGGAGGCAGG - Intergenic
1145369648 17:22298158-22298180 TGCCAGGAACAGAGGGAGGCAGG + Intergenic
1145769391 17:27481809-27481831 GAGAAGGGACAGTGGGAGGGAGG - Intronic
1145935837 17:28714309-28714331 CATAAGGCACAGTGAGAGGCTGG + Exonic
1146279610 17:31536723-31536745 CAGCAGGAAGCGGGAGAGGCTGG + Exonic
1146405521 17:32533489-32533511 CAGCTTGAAGAGTGGGTGGCAGG - Intronic
1147168944 17:38607013-38607035 CATCAGGCAGAGTGGCAGGCAGG + Intergenic
1147481101 17:40763904-40763926 CAACAGCAACAATGGAAGGCAGG - Intergenic
1147670265 17:42172993-42173015 GAGCAGGGACTGAGGGAGGCTGG + Intronic
1148107143 17:45124753-45124775 CCACAGGAACAGTAGGAGGTGGG - Intronic
1148132513 17:45270643-45270665 CAGCGGGAACAGGGGCCGGCGGG - Intronic
1149895851 17:60427707-60427729 CAACATGAAGAGTGGTAGGCTGG - Intronic
1149910357 17:60560749-60560771 CAGAAAGAACACTGGGTGGCCGG + Intergenic
1150801477 17:68286458-68286480 CAGCAGGAGCCCTGGAAGGCAGG - Intronic
1150817175 17:68401472-68401494 CAGCTGTGACTGTGGGAGGCAGG - Intronic
1150836709 17:68570585-68570607 AAGAAGGAAGAATGGGAGGCAGG - Intronic
1151134951 17:71937600-71937622 CAGCAGGAACTGTGATAGCCTGG + Intergenic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151654366 17:75488924-75488946 CACCAGGGACAGGAGGAGGCGGG - Intronic
1152178816 17:78805158-78805180 CTGCAGGAACCCTGGGAGGTGGG - Intronic
1152239282 17:79153111-79153133 CAGCTGGACCAGGGTGAGGCAGG - Intronic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1153285047 18:3449558-3449580 CAGCAGCGACAGTGGGAGGTCGG - Intronic
1153334838 18:3912687-3912709 CATATGGAACTGTGGGAGGCTGG + Intronic
1153386287 18:4500685-4500707 CAGCTGGGACACTGGGATGCTGG + Intergenic
1153900704 18:9614739-9614761 CAGCGGGAAAGGCGGGAGGCGGG - Intronic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1156092732 18:33490857-33490879 CAGCAGGAACAATGGAAAGAGGG + Intergenic
1156245761 18:35296330-35296352 TATCAGGAACAGAGGGAGCCTGG + Intergenic
1156278344 18:35606965-35606987 GAGCAGGAACTGTGGGGGTCAGG - Intronic
1156382730 18:36578633-36578655 CAGCAGAATCCTTGGGAGGCAGG - Intronic
1156510024 18:37628481-37628503 GGGCATGAACACTGGGAGGCAGG - Intergenic
1156660119 18:39336714-39336736 CAGCAGGCAGGGTGGGAGGTGGG - Intergenic
1157105624 18:44771801-44771823 CAGCAAGAACAGAGGCTGGCTGG + Intronic
1157493541 18:48139711-48139733 CAGCTGGCACCGAGGGAGGCTGG - Intronic
1160007327 18:75076897-75076919 CTGCAGGCACTGTGGGATGCGGG + Intergenic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161701201 19:5796620-5796642 AAGCAGAAAGAGTTGGAGGCCGG + Intergenic
1161797377 19:6394914-6394936 CAGAAGGAACTGGGGCAGGCAGG + Intergenic
1161953541 19:7480563-7480585 AAGCTTGAACAGTGGGAGTCTGG + Intronic
1162040089 19:7965640-7965662 GAGCAGGAAAAGTGAGTGGCAGG - Intronic
1162577024 19:11505290-11505312 CAGTCGGAACGATGGGAGGCGGG + Intronic
1163355541 19:16808145-16808167 TAGCATGAACATGGGGAGGCGGG - Intronic
1163572527 19:18090846-18090868 GATCAGGAACAGATGGAGGCCGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164570704 19:29372385-29372407 CAGCAGCTACAGGGGGATGCAGG - Intergenic
1165419486 19:35715915-35715937 TGGAAGGAACAGTGGGAGGTAGG - Intronic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1165551001 19:36585740-36585762 CAGTGGCAACATTGGGAGGCTGG + Intronic
1165685179 19:37813567-37813589 CAGCAGGGGCTGTGAGAGGCAGG - Intronic
1165904892 19:39187696-39187718 CAGCAGGTGCAGTGGGAGCTAGG + Intergenic
1166109500 19:40613641-40613663 CAGCAGGATCAGGGGGCAGCTGG + Intronic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1166353758 19:42215132-42215154 CAGCAGGGTCAGTGGGAGACAGG - Exonic
1166497684 19:43316066-43316088 CCGGAGGAGGAGTGGGAGGCGGG + Intergenic
1167272029 19:48511322-48511344 CAGCAGGGCCTGTGGGAGGGAGG - Intronic
1168724333 19:58572552-58572574 CAGAAGGAACAGCGCGAGGAGGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925462550 2:4075838-4075860 GAGAAGGAAAAGAGGGAGGCAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925914528 2:8595430-8595452 GAGCAGGAAGAGTGGGAAGCGGG - Intergenic
925985498 2:9211749-9211771 TAGCAGCAACAGTGGGAACCAGG + Intronic
926118126 2:10225993-10226015 CAGCAGGGGCATTGGGAGGTAGG - Intergenic
926157865 2:10467628-10467650 CAGAAGGAACACTGGGCGGGAGG + Intergenic
926761413 2:16282053-16282075 CAGGAGCTAGAGTGGGAGGCGGG - Intergenic
926913067 2:17869377-17869399 CAACAGGGACTGTGGGAGGCAGG + Intergenic
927994292 2:27472165-27472187 CACCAGGGACTGAGGGAGGCAGG - Intronic
928067120 2:28175724-28175746 CAGCAGTGGCAGTGGTAGGCTGG - Intronic
928306736 2:30176513-30176535 CAGTAGGACCAATGGGAGCCGGG - Intergenic
928388370 2:30888920-30888942 CAGTAGGAAAATTGGGAGGTGGG - Intergenic
928401764 2:30984156-30984178 AGGCAGGAACAGTGAGAAGCAGG - Intronic
929577138 2:43059002-43059024 CAGCAGGAAGAGTGATAGTCCGG + Intergenic
930699429 2:54444647-54444669 CAGCAGGAACAATGTCAGCCTGG + Intergenic
931579083 2:63753610-63753632 CAGGAGGAAGAGTGAGAGGTGGG + Intronic
931872939 2:66481168-66481190 GAGCAGGGAAAGTGGAAGGCAGG + Intronic
932800619 2:74739491-74739513 CAGCAGGAAGAGGGGAAGGGAGG - Intergenic
934761014 2:96857307-96857329 CAATAGGAACAGAGGAAGGCGGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
935383854 2:102480915-102480937 AACCAGGAGCTGTGGGAGGCAGG + Intronic
935498549 2:103810274-103810296 GAGCAGGAAAGGTGGGGGGCAGG + Intergenic
936091753 2:109506090-109506112 CAGAGAGAACAGTGGGAGTCAGG + Intergenic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
937027358 2:118710753-118710775 CAGCAGCAGCAGGGGGTGGCAGG - Intergenic
937341712 2:121095579-121095601 CAGCAGGGACAGTGGGATGTGGG + Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938259129 2:129882772-129882794 GGGCAGGAACAGAGGGAGGGAGG - Intergenic
938743951 2:134259600-134259622 CAGCAGGCAAAGTGGGATGGGGG - Intronic
938794347 2:134705600-134705622 CAGAAGGAACAGAGGAAGCCGGG - Intronic
938982952 2:136543977-136543999 CAGCAGTAACAGTGGCAGGCAGG + Intergenic
939419006 2:141941654-141941676 CACGTGGAACAGTGGGAAGCTGG + Intronic
939516205 2:143171412-143171434 CGGCAGGAAGAGTGGGGGACTGG + Intronic
939737858 2:145871929-145871951 TAGCAGGAAAACTGGGAGACTGG + Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
945400625 2:209378015-209378037 CAGCAGCAGAAGTGGTAGGCAGG + Intergenic
946495731 2:220193395-220193417 CACCAGGAGCAGGGAGAGGCCGG + Intergenic
947255863 2:228163170-228163192 CAGCAGCAACAATGACAGGCTGG + Intronic
948173453 2:235925016-235925038 CAGCAGGGAGAGTGGAAGTCAGG + Intronic
948269352 2:236662406-236662428 CAGCAGGAAGAGCGGCAGCCCGG - Intergenic
948650663 2:239441388-239441410 CAGCAGGGAGGGAGGGAGGCCGG + Intergenic
948946670 2:241224016-241224038 CACGAGGCACAGTGGGCGGCTGG - Intronic
1168959065 20:1856014-1856036 AAGCAGGACCACTGGGAGGTTGG - Intergenic
1169476341 20:5934337-5934359 GAGCAGCCACAGTGGGAAGCAGG - Intergenic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1171344895 20:24458707-24458729 CAGGAGGAAAACTGGGAGTCAGG + Intergenic
1171389673 20:24793269-24793291 CAGCAGGAAGAGAGGAAGGCAGG + Intergenic
1171446018 20:25205510-25205532 CAGCAGGGACAGGGGCCGGCAGG + Intronic
1172604547 20:36205927-36205949 CAGCAGGAAGAAAGGCAGGCAGG + Intronic
1172775047 20:37402409-37402431 CAGGCGGAACCGTGGGAGCCTGG - Intronic
1173081272 20:39870285-39870307 CAGCAGGCACAGTGAGGGGGTGG + Intergenic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174097195 20:48098669-48098691 GAGCAGGAACAGTGGCAGACAGG - Intergenic
1174182340 20:48682767-48682789 CAGCAGGAAAAGGGAGAGCCTGG + Intronic
1174337096 20:49870456-49870478 CAGCAGGAACTGCAGGAGCCAGG + Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1175226134 20:57444996-57445018 CAGCAGGAGGTGTGGGAAGCAGG + Intergenic
1175376741 20:58532440-58532462 CACCAGGAATAGTGTGAGGGTGG + Intergenic
1175599506 20:60261507-60261529 CAGAAGCAACAGTTGCAGGCCGG - Intergenic
1175615714 20:60396502-60396524 TAGCGGGAAGAGTGGGAGGGGGG + Intergenic
1175974054 20:62701594-62701616 GAGCAGGAAGGGTGGCAGGCAGG - Intergenic
1176139394 20:63538353-63538375 CAGTAGGGTCAGTGGGAGGGTGG - Intergenic
1176379313 21:6103916-6103938 CAGCAGGGACAGTCGGAGCAGGG + Intergenic
1177132724 21:17277667-17277689 CAGGAAGGACAGTGGGAGTCTGG + Intergenic
1178078549 21:29036648-29036670 CAGTAAGAACAGTGTAAGGCAGG - Intronic
1178297891 21:31426168-31426190 CAGGAGGAAGGGTGGGAGGTGGG - Intronic
1178413376 21:32384080-32384102 CAGCAAGGACAGTAGCAGGCAGG + Intronic
1178639955 21:34337712-34337734 CAGCAGGAGACGTGGCAGGCAGG - Intergenic
1179339168 21:40488192-40488214 CACCTGGAACAGTGGCTGGCTGG + Intronic
1179744160 21:43434321-43434343 CAGCAGGGACAGTCGGAGCAGGG - Intergenic
1179838752 21:44056329-44056351 CAGCAAGAACTGTTGGAGGCAGG + Intronic
1180144792 21:45913047-45913069 CAGCAGGAAGAGGTGGGGGCTGG - Intronic
1180224835 21:46386202-46386224 CAGCAGGCAGGGTGGGAGGAGGG - Intronic
1181053039 22:20246647-20246669 CCCCAGGAACAGTGGGGGCCAGG - Intronic
1181453464 22:23039008-23039030 CAGCAGGCACTGAGGGAGCCTGG - Intergenic
1181622385 22:24099902-24099924 AAGCAGGAAAGGAGGGAGGCAGG + Intronic
1181977049 22:26737592-26737614 CTGCAGGAAAAGTGGGATGGAGG - Intergenic
1182332577 22:29561459-29561481 CAGCAGGGAAATTGGGGGGCAGG + Intronic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182462868 22:30494849-30494871 CAGCAGGTAAGGTGGGTGGCTGG - Exonic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183317625 22:37145644-37145666 GAGCAGGCAAAGGGGGAGGCAGG + Intronic
1183572181 22:38661884-38661906 CAGGAGGAGCAGTGAGAGGTCGG + Intronic
1183828427 22:40405656-40405678 CTCCAGGAACAGCAGGAGGCAGG - Exonic
1183901030 22:41006139-41006161 GAGCAGGAACCTTAGGAGGCAGG + Intergenic
1183921863 22:41176291-41176313 CAGGATCAACAATGGGAGGCAGG - Exonic
1184498878 22:44860051-44860073 CAGCAGGTACAGGAGCAGGCAGG - Intronic
1184556132 22:45234053-45234075 CAGCAGTGACAGGGAGAGGCTGG + Intronic
1185062544 22:48614593-48614615 CACCAGGCACAGTGTGAGTCTGG - Intronic
1185244631 22:49766332-49766354 CAGGAGCCAGAGTGGGAGGCTGG + Intergenic
949610333 3:5697714-5697736 CAGAGGGAACAGAGGGAGTCAGG - Intergenic
950234891 3:11310382-11310404 TAGGAGGAACGGTGGGAGGTCGG - Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
951838672 3:27009725-27009747 CAGCAGGGACTCTGTGAGGCAGG - Intergenic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952924859 3:38313356-38313378 AAGCAGGACCAGTCAGAGGCAGG - Intronic
953480986 3:43251927-43251949 CAGCAGGAGCAGAGAGAGACTGG - Intergenic
953548217 3:43880271-43880293 CACCTGGAACAGCGGGAAGCAGG + Intergenic
953759111 3:45672964-45672986 CAGCAGGGACCTTGGGAGGTTGG + Intronic
953847390 3:46438575-46438597 GAGCAGGAACTGTGTGAGGGAGG - Intronic
954532762 3:51335019-51335041 AAGAAGCAACACTGGGAGGCTGG - Intronic
954692843 3:52404920-52404942 CAGCAGGAGCTTAGGGAGGCAGG - Intronic
956296037 3:67714610-67714632 AAGCAAAAAAAGTGGGAGGCAGG + Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956747576 3:72321831-72321853 CAGAAGGAAGACTGGGAGGAGGG + Intergenic
958022167 3:88011117-88011139 AAGCAGAAACTGTGGGAGGCAGG + Intergenic
960990166 3:123304983-123305005 CAGCAGGAAGTGTTGGGGGCAGG - Intronic
961492781 3:127266771-127266793 AAGCAGGAACAGGGAGGGGCAGG - Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
962366726 3:134791679-134791701 CAGCAGGAAAAGAAGGAGGGAGG - Intronic
962799237 3:138875889-138875911 CAGGAGGAAAAGTGGGAGACAGG - Intergenic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963688120 3:148463567-148463589 CAGGAGAAAGGGTGGGAGGCGGG + Intergenic
963960637 3:151305239-151305261 CTGAAGGAACAGTAGGTGGCAGG - Intronic
964225016 3:154388636-154388658 AGGCAGGAACAGAGGCAGGCAGG + Intronic
964902030 3:161671210-161671232 CAGCAGGAGCAGTTGTAGGTAGG + Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
967035530 3:185646092-185646114 CTGCAGGGACAGTGCTAGGCTGG - Intronic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
968685973 4:1959001-1959023 CAGGAGGAGCAGTGCTAGGCAGG - Intronic
968737121 4:2303403-2303425 CACCAGGAGCCGTGGGAGCCGGG - Intronic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
969721869 4:8896467-8896489 CAGCAGGCACAGTGGCTGGGGGG - Intergenic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
973210062 4:47605580-47605602 AAGCAGGAACAGTGGTAGTGTGG - Intronic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
975033022 4:69647059-69647081 CAGCAGGAACATAGGAAGGAGGG + Exonic
975109575 4:70608594-70608616 CAGCAGCAACAGTGGAAGAATGG + Intergenic
975670465 4:76775102-76775124 CAGCGGGAAGGGTGGGAGGTGGG - Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976540455 4:86268449-86268471 CAGCAGGAAACCAGGGAGGCAGG - Intronic
978416868 4:108486113-108486135 CAGAAGGGGCTGTGGGAGGCAGG - Intergenic
978466622 4:109015974-109015996 CAGCAGGGACAGGAAGAGGCAGG + Intronic
978784772 4:112597296-112597318 CAGCAGGAACACTTGAGGGCAGG + Intronic
979281725 4:118876274-118876296 AAGCAGGAAGAGTGGGAGGCAGG - Intronic
979524935 4:121706695-121706717 CAGGAGAAAGAGTGGTAGGCTGG - Intergenic
979576517 4:122297905-122297927 CAGCAGGGACAGCAGGAGGGAGG + Intronic
981513292 4:145580919-145580941 CAGCAGCAACCGTGGGATGTGGG - Intergenic
981678448 4:147366234-147366256 AGGCAGGAATAGTGGGAGCCAGG + Intergenic
984355763 4:178655203-178655225 CAGGAGGAAGAGGGAGAGGCGGG - Intergenic
985276852 4:188245698-188245720 GAGAAAGAGCAGTGGGAGGCAGG + Intergenic
985667091 5:1186917-1186939 CAGCAAGATGAGTGTGAGGCCGG - Intergenic
985907700 5:2853794-2853816 CAGCAGGAACAGAGGAGAGCAGG + Intergenic
986123878 5:4867570-4867592 AAGCTGGAACACTGGGAGCCTGG + Intergenic
986139972 5:5020278-5020300 CAGAAGGAAAACCGGGAGGCTGG + Intergenic
986251773 5:6066166-6066188 CAGGAGGAACAGTGACAGGCAGG + Intergenic
988029040 5:25739077-25739099 CAGCAGTGGCAGTGGCAGGCAGG - Intergenic
988272118 5:29031048-29031070 AAGCAGGAACTGTGGGAGGCAGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
990526315 5:56631347-56631369 CCCCAGGAACAGGGAGAGGCAGG + Intergenic
990681050 5:58244891-58244913 TAGCAGCAACAGTGGGAGGCAGG + Intergenic
991291135 5:65035004-65035026 CAGCAGGAAAACTGGGCGTCCGG - Intergenic
992385636 5:76281810-76281832 TAGAAGGAAAAGAGGGAGGCAGG - Intronic
992503346 5:77362985-77363007 CAGCAGCATCAGTGGGAGATGGG - Intronic
995200624 5:109421901-109421923 TTACAGGAACAGAGGGAGGCTGG + Intergenic
997183499 5:131857956-131857978 CAGCAGCAGCAGTGGTGGGCTGG - Intronic
997438043 5:133889267-133889289 CAGCAGGGCCTGTAGGAGGCAGG + Intergenic
997732454 5:136191550-136191572 GAGCACGGGCAGTGGGAGGCCGG - Intergenic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998250830 5:140551108-140551130 CTGCAGGAACAGTGGGCTGGAGG - Exonic
998681891 5:144477155-144477177 CAGCAGGAAAAGGGGAAGACAGG + Exonic
998714467 5:144867326-144867348 AAGAAGGAACAGTGGGAGGTAGG - Intergenic
999323407 5:150628317-150628339 CCGCAGCAACCCTGGGAGGCTGG - Intronic
999832767 5:155336641-155336663 CAGCTGGAAAGGTGGGAGACTGG - Intergenic
1000235930 5:159360561-159360583 CAGAGGGAAGAGTGGGAGGGAGG + Intergenic
1001396754 5:171423422-171423444 CGGCAGGAACAATGTCAGGCAGG - Intronic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001644359 5:173269223-173269245 CAGCAGCAACAGGCGAAGGCTGG + Intergenic
1001929861 5:175665230-175665252 TAGCAGGAACCCCGGGAGGCTGG - Intronic
1001995710 5:176156013-176156035 CAGCAGGGACAGAGGAAGGGCGG - Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002956857 6:1874014-1874036 CAGACGGACCAGTGGGAGGAAGG + Intronic
1003515370 6:6813535-6813557 GGGAAGGAACAGTGGGAGGTGGG + Intergenic
1003561535 6:7184720-7184742 CAGCAGGCACACTGTGCGGCTGG - Intronic
1004147054 6:13077694-13077716 CAACAGGAACAGGGGGAGCCTGG + Intronic
1004550931 6:16646526-16646548 GAGGTGGAACAGTGGGAGACTGG - Intronic
1006007443 6:31013623-31013645 CAACAGGAACCCTGGGAAGCAGG - Intronic
1006433155 6:34010583-34010605 CAGCAGGAGGAGTTGGAGGTGGG - Intergenic
1006932228 6:37695362-37695384 CAGCAGGGACTGGGAGAGGCTGG - Intronic
1007099968 6:39239433-39239455 GAGCAGTAGCAGTGGGAAGCAGG + Intergenic
1007222945 6:40293469-40293491 CAGCAGGAACAGCATCAGGCTGG - Intergenic
1007524593 6:42480730-42480752 CAGGAAGCACAGTGAGAGGCTGG - Intergenic
1007528404 6:42517885-42517907 CAGCATGAAGAATGGGAGGAAGG - Intergenic
1007654691 6:43445121-43445143 CAGTGGGAACACTGGGATGCTGG - Exonic
1007928204 6:45667314-45667336 CTGGAGGAACAGTGGCAGTCAGG + Intergenic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1010620306 6:78065208-78065230 CAGCACGGAAAGTTGGAGGCAGG - Intergenic
1010855094 6:80828235-80828257 CAGCAGGAACCATCGGAGGAGGG - Intergenic
1011296033 6:85827210-85827232 CAGCAGTGACAGTGGCAAGCTGG - Intergenic
1011398539 6:86936348-86936370 CAGAAAGAAAAGTGTGAGGCAGG + Intergenic
1013166942 6:107603252-107603274 CAGAAGGCACACTGGGAGGCAGG - Intronic
1013661293 6:112299495-112299517 CAGCAGGAAATGTGTGGGGCTGG - Intergenic
1014104946 6:117551066-117551088 GAGCAAGATCAGTGGGAGACAGG - Intronic
1014688227 6:124530459-124530481 GAGCAGGTAGAATGGGAGGCAGG + Intronic
1015185601 6:130412353-130412375 CAGCACTGACAGTGAGAGGCAGG - Intronic
1016381520 6:143487663-143487685 CAGCATGAACAGTAGCAGACAGG - Intronic
1016628407 6:146199371-146199393 CAGCAAGAACACTGGGGGACAGG - Intronic
1016882760 6:148927209-148927231 GAGGAGGACCAGTGGGAGGGAGG + Intronic
1017456523 6:154606044-154606066 AGGCAGGAAAAGTTGGAGGCGGG + Intergenic
1017523327 6:155221056-155221078 AAGCAGGGACAGAGGAAGGCAGG - Intronic
1017764075 6:157592876-157592898 CAGCAGGCACAGCGGCTGGCAGG - Intronic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019404758 7:877502-877524 CAGCAGGAAGAGAGAGAGACGGG - Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019624872 7:2011043-2011065 TAGCAGGGAGAGAGGGAGGCAGG + Intronic
1019706047 7:2497838-2497860 CAGGAGGAACAGGGGGTGACGGG + Intergenic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1020078860 7:5275772-5275794 CTGCAGGAACAGGGAGGGGCTGG - Intronic
1020175586 7:5879509-5879531 TAGCAGGTACCGTTGGAGGCAGG - Intergenic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1020319074 7:6927024-6927046 CAGCGGGAACAGAGGTGGGCGGG + Intergenic
1020354040 7:7257540-7257562 CAGCAGGAATTTTGGGAGGAGGG - Intergenic
1020630889 7:10637957-10637979 CAAGAGGAACAGAGGCAGGCAGG + Intergenic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1022010829 7:26306805-26306827 CAGCTGGCACAGTCGGAGCCAGG + Intronic
1022048517 7:26643200-26643222 CAGCAGGAACAGACGGAGTGGGG - Intronic
1022554158 7:31275256-31275278 CAGAAGGAAGAGTGGAATGCTGG + Intergenic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1024256570 7:47544189-47544211 GAGCAGGAAGAGTCAGAGGCTGG + Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024512208 7:50213037-50213059 CTACAGAAAGAGTGGGAGGCAGG + Intergenic
1025200029 7:56956394-56956416 CTGCAGGAACAGGGAGGGGCTGG + Intergenic
1025211524 7:57021582-57021604 CAGAAGGAAGAATGGGGGGCTGG + Intergenic
1025660431 7:63555265-63555287 CAGAAGGAAGAATGGGGGGCTGG - Intergenic
1025671915 7:63620538-63620560 CTGCAGGAACAGGGAGGGGCTGG - Intergenic
1025964708 7:66257599-66257621 CAGCAGCAACACTGCCAGGCTGG - Intronic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1029083243 7:97991455-97991477 TAGCAGGTACCGTTGGAGGCAGG + Intergenic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029708167 7:102286352-102286374 CAGCAGGGACAATGGGAGCCTGG - Intronic
1030285551 7:107823337-107823359 CAGCAGGAAAAGTGAAAGGAAGG - Intergenic
1030303130 7:107993864-107993886 CAGCAGGAACAGCAGGCTGCTGG + Intronic
1030710866 7:112747540-112747562 CAGGAGGAAGAGTGAGAGGAGGG - Intergenic
1030914092 7:115291014-115291036 CTGCAGGCACTCTGGGAGGCTGG + Intergenic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032084597 7:128877312-128877334 CTGCAGGGGGAGTGGGAGGCGGG + Intronic
1032832700 7:135644211-135644233 TGGCAGGAACAGGGTGAGGCAGG + Intronic
1033096287 7:138434175-138434197 TAGCACGATCAGTGTGAGGCAGG + Intergenic
1033131782 7:138751252-138751274 CAGCAGGGCCGGTGGGAGGCAGG - Intronic
1033360583 7:140636362-140636384 CAGAAGGAACAGAGGAGGGCTGG + Intronic
1033412584 7:141132593-141132615 CAGCAGTGGCAGTGGCAGGCTGG - Intronic
1034010581 7:147525040-147525062 CAGCAGGGAAAGTCGGGGGCTGG + Intronic
1034123321 7:148647107-148647129 CATCAGGAAATGTGGCAGGCAGG - Intergenic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1034885060 7:154792908-154792930 CAGAAGGAACAGCGGCAAGCAGG - Intronic
1035171877 7:157021592-157021614 CAGCAGGAACGGGCGGCGGCCGG - Intergenic
1035239966 7:157523177-157523199 CAGCAGGGATGGTGGGGGGCTGG + Intergenic
1035289707 7:157830060-157830082 CAGAAAGGACAGTGGGAGGGAGG - Intronic
1035319234 7:158017757-158017779 CAGCAGGGACAGAAGGACGCAGG + Intronic
1035375023 7:158402048-158402070 CAGCAGGGTCAGGGAGAGGCGGG + Intronic
1035392315 7:158513074-158513096 CAGCAGGGAAAGAGGGAAGCGGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036689982 8:10939274-10939296 AAGCAGGAACTGTGGTGGGCGGG - Intronic
1037472395 8:19223615-19223637 CAGTAGAGACTGTGGGAGGCAGG + Intergenic
1038779477 8:30557762-30557784 AAGGAAGAGCAGTGGGAGGCGGG + Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039566143 8:38553875-38553897 AAGCAGGAACAGAGGGAGGGGGG + Intergenic
1039989190 8:42473588-42473610 AAGCAGGAACAGTGGCATGGGGG - Intronic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1043273009 8:78357268-78357290 CAGCAGGTGCTGTGGGAGGTGGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044839895 8:96328606-96328628 AAGCAGGAACAGTGGCAGCGTGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045866076 8:106866976-106866998 GAGAAGGAACAGAGGGAGTCAGG + Intergenic
1046173473 8:110544095-110544117 AACCAGGTACTGTGGGAGGCAGG - Intergenic
1047008235 8:120643417-120643439 CAGGAGGAAGGGTGGGAGGGTGG - Intronic
1047338562 8:123958370-123958392 CAGCAGGAGGCGTGGGAGGGAGG + Intronic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048199911 8:132363768-132363790 AAGCAGGAGCTGTGGGATGCAGG - Intronic
1048395782 8:134012645-134012667 CAGCAGGAACAGTGTGTGCAGGG + Intergenic
1048591126 8:135821703-135821725 CAACAGGGACTGTGGGAGGCAGG + Intergenic
1048609254 8:136004129-136004151 CAGCAGTGACAGTGGGAGTCTGG + Intergenic
1049159675 8:141089227-141089249 CAGCAAGAACATGGGGACGCTGG - Intergenic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049381587 8:142319097-142319119 CAGCCAGAACAGTGGCAGCCGGG + Intronic
1049487218 8:142872530-142872552 CAGCAAGAACAGTTGGACTCAGG + Intronic
1049540946 8:143208537-143208559 CTGCAGGAACAGGAGAAGGCAGG - Intergenic
1049552223 8:143265703-143265725 CAGAAGGCAAAGTGGGAGCCAGG + Intronic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1050687946 9:8192460-8192482 CAGCAGAAACCTTGTGAGGCAGG + Intergenic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1052081376 9:24210011-24210033 CAGGGGGAAGTGTGGGAGGCAGG + Intergenic
1053009425 9:34624813-34624835 CAGCTGGAGCGGTGGGAGGCAGG + Intronic
1054764424 9:69031646-69031668 CAGCTGGAAGACTGGGAGGCTGG + Intergenic
1054960276 9:70960575-70960597 TAGCAGGAATACTGGGAGGCAGG + Intronic
1055453560 9:76452990-76453012 CAGCAGGGGCTGTGTGAGGCAGG - Intronic
1056292734 9:85160339-85160361 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1056292874 9:85161310-85161332 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1057035525 9:91809367-91809389 CACCAGGAACAGTGGGCACCAGG + Intronic
1058366044 9:104209590-104209612 TAGCAGGACCCGTGGGAGGAAGG + Intergenic
1058656787 9:107229631-107229653 TGGCAGGAACAGTGAGATGCTGG - Intergenic
1059616618 9:115958483-115958505 CAGCAGGAACAATGGGACAATGG - Intergenic
1059795351 9:117688793-117688815 CATCAGAAACAATGGGAGGCCGG + Intergenic
1060044050 9:120326059-120326081 CAGAAGGCTCAGGGGGAGGCGGG - Intergenic
1060215624 9:121736710-121736732 CAGCCAGAGCAGTGGAAGGCAGG - Intronic
1060297736 9:122354787-122354809 CAGCAGGGCCAGCAGGAGGCTGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061252494 9:129434755-129434777 AAGCAGGAATAGGGGGAGCCTGG + Intergenic
1061377976 9:130237230-130237252 CAGCAGGAGCTTGGGGAGGCTGG - Exonic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061895109 9:133643108-133643130 CTGCAGCCCCAGTGGGAGGCAGG - Intronic
1062149247 9:135009066-135009088 CACCAGGAACTGGGAGAGGCAGG + Intergenic
1062307962 9:135920281-135920303 GAGCAGGGACAATGGGGGGCTGG + Intergenic
1062331269 9:136045950-136045972 CAGCAGGGACACCGGGAGCCGGG - Intronic
1062478851 9:136742360-136742382 CAGCAGGCAGAGTTGGGGGCCGG - Intronic
1062630127 9:137459608-137459630 CTGCAGGATCACAGGGAGGCCGG + Intergenic
1185691072 X:2155647-2155669 CCCCAGGAGCAGTGAGAGGCAGG - Intergenic
1185700949 X:2229396-2229418 CAGCAGGATCCCTGGGTGGCTGG - Intronic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1186786555 X:12961624-12961646 AGGCAGGAACACTGGGAGGAAGG + Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187621605 X:21062425-21062447 AAGCAGGAAAAGAGGGAGGTAGG + Intergenic
1187912303 X:24122183-24122205 GAGCATGAACAGCAGGAGGCAGG + Intergenic
1188722916 X:33544577-33544599 CAGCAGTGGCAGTGGTAGGCTGG - Intergenic
1189592866 X:42534140-42534162 CAGTAGGATCAGGGTGAGGCAGG + Intergenic
1190556161 X:51637626-51637648 CAGCAGTAACAGGGGGACCCAGG - Intergenic
1191678816 X:63819845-63819867 CAGCATGAACGGTGGGAGGAGGG - Intergenic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193636846 X:83961449-83961471 CAGCAGGAAGGGTGGGAGGGGGG + Intergenic
1195802286 X:108726387-108726409 CAGTTGGAAGAGTCGGAGGCAGG + Intronic
1196016367 X:110944512-110944534 GAGCAGGAACTGGGGGAGGAAGG - Intronic
1197996218 X:132377594-132377616 AAGGAGGAACAATGGGAAGCAGG + Intronic
1198609027 X:138376483-138376505 GAGAAGGACCAGTGGGAAGCTGG - Intergenic
1198675237 X:139124075-139124097 CAGCAGGGTCTGTGGGAGGCAGG - Intronic
1199270025 X:145872577-145872599 CAGCAGTAGCAGGGGGAGCCTGG + Intergenic
1199439482 X:147852379-147852401 CAGCAAGTACAGTGGAAGGCTGG - Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1200071299 X:153530773-153530795 TACCAGGAACAGGGGGAGGAAGG + Intronic
1200117129 X:153774325-153774347 CACCACGAACTGTGGCAGGCCGG - Exonic
1200167548 X:154047674-154047696 GAGCAAGAGCAGTGGGAGCCAGG + Intronic