ID: 1173899973 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:46580616-46580638 |
| Sequence | CTTTCTCACTTAGAAAATGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1173899973_1173899977 | 10 | Left | 1173899973 | 20:46580616-46580638 | CCCTCATTTTCTAAGTGAGAAAG | No data | ||
| Right | 1173899977 | 20:46580649-46580671 | ACAATATAGGACCTTCCCTGAGG | No data | ||||
| 1173899973_1173899976 | -3 | Left | 1173899973 | 20:46580616-46580638 | CCCTCATTTTCTAAGTGAGAAAG | No data | ||
| Right | 1173899976 | 20:46580636-46580658 | AAGTAAGGCTCAGACAATATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1173899973 | Original CRISPR | CTTTCTCACTTAGAAAATGA GGG (reversed) | Intronic | ||