ID: 1173899977

View in Genome Browser
Species Human (GRCh38)
Location 20:46580649-46580671
Sequence ACAATATAGGACCTTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173899974_1173899977 9 Left 1173899974 20:46580617-46580639 CCTCATTTTCTAAGTGAGAAAGT No data
Right 1173899977 20:46580649-46580671 ACAATATAGGACCTTCCCTGAGG No data
1173899973_1173899977 10 Left 1173899973 20:46580616-46580638 CCCTCATTTTCTAAGTGAGAAAG No data
Right 1173899977 20:46580649-46580671 ACAATATAGGACCTTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173899977 Original CRISPR ACAATATAGGACCTTCCCTG AGG Intronic