ID: 1173899977 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:46580649-46580671 |
Sequence | ACAATATAGGACCTTCCCTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173899973_1173899977 | 10 | Left | 1173899973 | 20:46580616-46580638 | CCCTCATTTTCTAAGTGAGAAAG | No data | ||
Right | 1173899977 | 20:46580649-46580671 | ACAATATAGGACCTTCCCTGAGG | No data | ||||
1173899974_1173899977 | 9 | Left | 1173899974 | 20:46580617-46580639 | CCTCATTTTCTAAGTGAGAAAGT | No data | ||
Right | 1173899977 | 20:46580649-46580671 | ACAATATAGGACCTTCCCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173899977 | Original CRISPR | ACAATATAGGACCTTCCCTG AGG | Intronic | ||