ID: 1173899977

View in Genome Browser
Species Human (GRCh38)
Location 20:46580649-46580671
Sequence ACAATATAGGACCTTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173899973_1173899977 10 Left 1173899973 20:46580616-46580638 CCCTCATTTTCTAAGTGAGAAAG No data
Right 1173899977 20:46580649-46580671 ACAATATAGGACCTTCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1173899974_1173899977 9 Left 1173899974 20:46580617-46580639 CCTCATTTTCTAAGTGAGAAAGT 0: 1
1: 0
2: 6
3: 145
4: 966
Right 1173899977 20:46580649-46580671 ACAATATAGGACCTTCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173899977 Original CRISPR ACAATATAGGACCTTCCCTG AGG Intronic
901447711 1:9318346-9318368 ACAGTGTAGGACCCTGCCTGAGG + Intronic
905946087 1:41902411-41902433 ACATTCCAGGACCCTCCCTGGGG - Intronic
910858857 1:91723700-91723722 AAAATATGGTACCTTCCCTTTGG - Intronic
911269790 1:95787228-95787250 AAAATAGAGCACCTTCCCAGTGG - Intergenic
912649826 1:111427759-111427781 CCTTTATAGGAGCTTCCCTGTGG + Exonic
913137029 1:115901383-115901405 ACAGTTTAGAACCTTCCCAGTGG - Intergenic
918471770 1:184882675-184882697 ACATAATAGGACTTTCTCTGAGG - Intronic
918774636 1:188611736-188611758 TCAATATGGCACCTTTCCTGTGG + Intergenic
919934259 1:202241307-202241329 ACAAGACTGAACCTTCCCTGAGG - Intronic
921488483 1:215744791-215744813 GCAATCTAGCACCTTTCCTGAGG - Intronic
1063952750 10:11239480-11239502 AAAGTATAGGAGCTTCCCTGAGG - Intronic
1065925871 10:30433741-30433763 AAGATATACGACCTTCCCTGGGG + Intergenic
1068165655 10:53328967-53328989 ACAATATACTTCCTTCACTGTGG - Intergenic
1070272596 10:74971115-74971137 ACAATCTAGGTCCTTCCTGGAGG + Intronic
1074307269 10:112290635-112290657 CAAATATAGGAACTTACCTGGGG - Intronic
1075658804 10:124179376-124179398 ACAACATGGGGGCTTCCCTGGGG + Intergenic
1079014751 11:16859082-16859104 ACAACACAGTCCCTTCCCTGGGG - Intronic
1080166074 11:29239087-29239109 AGAACATGGGACCTGCCCTGTGG + Intergenic
1080348075 11:31347882-31347904 CCAATATAGGACCTTACTGGAGG + Intronic
1081135433 11:39434448-39434470 ACCATATAGGACTTTCCATAGGG - Intergenic
1084727892 11:70953769-70953791 ACAATACTTGACCATCCCTGCGG + Intronic
1090180449 11:124694161-124694183 ACAATATATGAAATTCCCTCAGG + Intronic
1094558101 12:31522982-31523004 CCAATATGGGAGATTCCCTGAGG + Intronic
1101728755 12:107409285-107409307 AAAATATAGGGCCTCTCCTGTGG + Intronic
1108595215 13:51943586-51943608 ACAAAATAGAACCTTTCCTGTGG + Intronic
1108761117 13:53566248-53566270 ACAATATATGGCCTTCTGTGTGG + Intergenic
1112582410 13:100687869-100687891 TTAATATAGAATCTTCCCTGTGG - Intergenic
1114574149 14:23697212-23697234 ACAAAAGAGGTCCTTACCTGGGG - Intergenic
1119425952 14:74534854-74534876 ACACCAAAGGACCTTCCCTCAGG - Intronic
1119846561 14:77834826-77834848 ACAATGCAGGACCTTCTCTGTGG - Intronic
1122489667 14:102105675-102105697 AGAATGAATGACCTTCCCTGTGG - Intronic
1124481764 15:30085797-30085819 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124488220 15:30137895-30137917 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124536837 15:30554815-30554837 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124543311 15:30606869-30606891 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124761815 15:32452776-32452798 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124776814 15:32596292-32596314 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1128565226 15:68696682-68696704 ACATTATGGGACCCTCCCTCTGG - Intronic
1131152138 15:90053861-90053883 TCAATAGAGAAGCTTCCCTGTGG + Intronic
1143868449 17:9940832-9940854 ATAATACAGGACACTCCCTGGGG - Intronic
1148038259 17:44685276-44685298 ACAATTCAGAACCTTCCCTAAGG + Intronic
1149244574 17:54690446-54690468 ACAATTTAGGACCCTCCTTTTGG + Intergenic
1149249210 17:54749137-54749159 GCATTACTGGACCTTCCCTGGGG - Intergenic
1153527425 18:6010789-6010811 AAAACATAGGATCTTCCCTGTGG + Intronic
1155761263 18:29570336-29570358 GAAATAAAGGAGCTTCCCTGAGG + Intergenic
1156560824 18:38123424-38123446 AAGAAATAGGACCTACCCTGGGG - Intergenic
1160278793 18:77466730-77466752 AAAATATAGGACATAACCTGTGG - Intergenic
1164964659 19:32471801-32471823 AAAATAAAGGGCCTTACCTGAGG + Intronic
1165986738 19:39776271-39776293 AAAATATTGGACTCTCCCTGGGG - Intergenic
927178013 2:20423950-20423972 ACAATTCAGGGCCCTCCCTGTGG + Intergenic
935457587 2:103288232-103288254 ACTTTATAGGTCTTTCCCTGAGG + Intergenic
937097501 2:119245305-119245327 ACAACACAGCCCCTTCCCTGGGG - Intronic
937462478 2:122101434-122101456 ACAATATGGGGCCGTTCCTGGGG + Intergenic
941730780 2:168914856-168914878 TCAATATAGGCTCTTCCCTGGGG + Intergenic
947591267 2:231387467-231387489 TCAATCAAGGCCCTTCCCTGGGG - Intergenic
1169739155 20:8871323-8871345 ACAATAGATGACATTCACTGGGG - Intronic
1173519326 20:43687241-43687263 AGAAGACAGGGCCTTCCCTGGGG - Intronic
1173899977 20:46580649-46580671 ACAATATAGGACCTTCCCTGAGG + Intronic
1181775805 22:25159363-25159385 GCGATGTAGGACCTTCCCCGGGG + Intronic
1181846179 22:25710865-25710887 AAAATATAGGGCCTTCCTTTGGG + Intronic
951937592 3:28038786-28038808 ACCACATAGGACTTTCCTTGAGG - Intergenic
953787811 3:45923823-45923845 AAAATAAAGGGTCTTCCCTGAGG - Intronic
957937791 3:86966829-86966851 ACAATATAAGGCATTACCTGGGG - Intronic
961943879 3:130665447-130665469 CTAATATTGTACCTTCCCTGGGG - Intronic
963718845 3:148836631-148836653 AGAACATAGGACATCCCCTGAGG + Intronic
970309048 4:14762428-14762450 ATCATATAGGATCTTACCTGGGG - Intergenic
982136505 4:152278530-152278552 GAAAGATAGGACCTTGCCTGGGG + Intergenic
985966062 5:3339521-3339543 ACAATTTAGAACGTTCCGTGTGG - Intergenic
986592541 5:9386443-9386465 ACACTGCAAGACCTTCCCTGTGG + Intronic
991407863 5:66319517-66319539 ACAACATAGGACTTCCCCCGGGG + Intergenic
991533216 5:67637972-67637994 ACAATATGGGACTTGCCCTCGGG + Intergenic
992211318 5:74482629-74482651 ACATTATAGTAACTACCCTGTGG + Intergenic
993820341 5:92607249-92607271 ACATTATATGTCCTTCCATGAGG - Intergenic
994748184 5:103705089-103705111 ACTATATTGAAACTTCCCTGGGG + Intergenic
996836532 5:127799672-127799694 ACACTATAGGAATTTCCCTAAGG - Intergenic
997216122 5:132112385-132112407 CCAATATAGCACCTTTCCTTGGG - Intergenic
1002998109 6:2305722-2305744 TCAATATAGCACCATTCCTGGGG + Intergenic
1003120073 6:3312240-3312262 ACAATCTATAACCTTCCATGTGG + Intronic
1005607742 6:27492262-27492284 AAAATAGAGGGCCTTCCCAGAGG - Intergenic
1011051991 6:83161920-83161942 ACAATCTAGGACATTGGCTGTGG + Intronic
1011151170 6:84275100-84275122 ATAAAATAGGACCTTTTCTGAGG - Intergenic
1011712188 6:90066086-90066108 AGAAAATAAGACCTTCCCTCAGG - Intronic
1013878834 6:114868376-114868398 GCAATATAGTACCTCTCCTGTGG + Intergenic
1013934065 6:115571941-115571963 ACTATATGTGCCCTTCCCTGGGG + Intergenic
1016238657 6:141901058-141901080 ACAATGTAGGATTTTCACTGGGG + Intergenic
1022996232 7:35758257-35758279 CAAATATAGGGCCATCCCTGTGG + Intergenic
1025716082 7:63956876-63956898 AAAATTTAGAACTTTCCCTGGGG - Intergenic
1027803173 7:82781762-82781784 ACAGGGTGGGACCTTCCCTGGGG - Intronic
1031539320 7:122974564-122974586 AGAAAATAGGAACTTCCATGAGG + Intergenic
1034925681 7:155119580-155119602 ACAATCTAGGGCTTTCCATGTGG + Intergenic
1039766127 8:40630070-40630092 GTAATATAGAACCTGCCCTGTGG - Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1047018893 8:120753559-120753581 ACAAAATGGGAAGTTCCCTGAGG + Intronic
1048580596 8:135727375-135727397 ACAATATATCATCTACCCTGAGG + Intergenic
1055121578 9:72666328-72666350 GTAATATAGGACCTTCTCTAAGG + Intronic
1057338381 9:94176413-94176435 ACAATCTATTGCCTTCCCTGAGG + Intergenic
1059466658 9:114473041-114473063 ACAAGATGGGACCTGCCCTTCGG - Intronic
1189544261 X:42025241-42025263 AAAATCTAGGACATTTCCTGAGG + Intergenic
1189848865 X:45159605-45159627 ACAAAACAGGACCTGCCCTCCGG + Intronic
1192694093 X:73396256-73396278 AGAATAGAAGACATTCCCTGAGG + Intergenic