ID: 1173900849

View in Genome Browser
Species Human (GRCh38)
Location 20:46587996-46588018
Sequence GGATTCTGGGCTGGGCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173900849_1173900857 1 Left 1173900849 20:46587996-46588018 CCAGGTGGCCCAGCCCAGAATCC 0: 1
1: 0
2: 1
3: 26
4: 314
Right 1173900857 20:46588020-46588042 CCCTGTTGGACTCCTCCCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 190
1173900849_1173900859 2 Left 1173900849 20:46587996-46588018 CCAGGTGGCCCAGCCCAGAATCC 0: 1
1: 0
2: 1
3: 26
4: 314
Right 1173900859 20:46588021-46588043 CCTGTTGGACTCCTCCCTGTGGG 0: 1
1: 0
2: 2
3: 12
4: 148
1173900849_1173900863 22 Left 1173900849 20:46587996-46588018 CCAGGTGGCCCAGCCCAGAATCC 0: 1
1: 0
2: 1
3: 26
4: 314
Right 1173900863 20:46588041-46588063 GGGTCCCCAGAGTCTCACCCAGG 0: 1
1: 0
2: 1
3: 22
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173900849 Original CRISPR GGATTCTGGGCTGGGCCACC TGG (reversed) Intronic
900152285 1:1183879-1183901 GGCTGCTGGGCTGAGCCACGGGG - Intronic
900315259 1:2053018-2053040 GGAGTCTGGCCCAGGCCACCTGG - Intronic
900432972 1:2611612-2611634 GGCCTCAGGCCTGGGCCACCTGG - Intronic
900804907 1:4761182-4761204 GGATTCTCAGCAGGGGCACCGGG - Intronic
901092836 1:6653693-6653715 GGAGTGTGGGCTGGGGCACTTGG - Intronic
901235379 1:7664782-7664804 CGAGGCTGGGCTGGGCCACGGGG - Exonic
901738510 1:11327459-11327481 GAATTCTGAGCAGGGTCACCTGG - Intergenic
902471497 1:16649745-16649767 AGATCCAGGGCTGGGCCTCCTGG - Intergenic
902487312 1:16757700-16757722 AGATCCAGGGCTGGGCCTCCTGG + Intronic
902822452 1:18951515-18951537 GGCTTCTGGACAGGGACACCAGG + Intronic
903029885 1:20456307-20456329 GTATTCCAGGCTGGGACACCTGG - Intergenic
903624351 1:24720393-24720415 GGATTCTGGCCTGTGGCTCCAGG - Intergenic
904388254 1:30161733-30161755 GGATACTGTGATGTGCCACCCGG + Intergenic
904398912 1:30242966-30242988 GGGTGCTGGGCTGGGACTCCTGG + Intergenic
905351194 1:37347690-37347712 GGATTCTGGGCTGGGCGTGGTGG - Intergenic
905488928 1:38328505-38328527 GGATGCTGGGCTGATCCTCCTGG - Intergenic
906735371 1:48120993-48121015 GGATTCCAGGCAGGGCCAGCAGG + Intergenic
907239782 1:53074992-53075014 GGATTCTAGGCAGGGGCCCCAGG + Intronic
907276208 1:53317904-53317926 GGATTCTGGGCAGGGAAACAGGG - Intronic
907524028 1:55043514-55043536 GGCCTTTGGGCAGGGCCACCAGG + Intronic
907799199 1:57747844-57747866 GTATTCTGAGCTAGGCCAACTGG + Intronic
907836433 1:58113325-58113347 GGATTCTGGTTTGGGCAACCTGG + Intronic
912619412 1:111140090-111140112 GGAGACAGGGCTGGGCCACGGGG + Intronic
915594077 1:156886506-156886528 GGAGTCAGGGCTTGGCAACCTGG + Intergenic
915943073 1:160130983-160131005 GGGTTATGGGCTGAGCCACTGGG - Intronic
917977834 1:180251446-180251468 GCATTCTGTGCTGGGTCACCCGG - Intronic
919311646 1:195917329-195917351 GGATTCAGGGCTGGGAGACAGGG - Intergenic
920539749 1:206769411-206769433 GGAGTCTGGGCTGAACCCCCAGG + Intronic
922762487 1:228141469-228141491 GGGCTCTGGGCTGGGCCAGGTGG - Intronic
922806489 1:228392793-228392815 GGATTTCAGGCTGAGCCACCAGG - Intergenic
922880963 1:228980314-228980336 GGAGGCTGGGAGGGGCCACCTGG + Intergenic
924800791 1:247328740-247328762 GGGTTATGGGCTGGGCATCCTGG + Exonic
1065761555 10:28987669-28987691 GGCTGCTGTCCTGGGCCACCAGG + Intergenic
1065773487 10:29099183-29099205 TAATCCTGGGCTGGGCCTCCTGG - Intergenic
1069121436 10:64574324-64574346 GGCTTCTGGGCTGGGTGACTTGG + Intergenic
1070957619 10:80474544-80474566 GGATTCTGGGTGGGGCCCCTTGG + Intronic
1071328629 10:84540437-84540459 GGATGCAGGGCTGTGCTACCTGG + Intergenic
1072195995 10:93117838-93117860 GCCTTCTGGGCTTGGCCTCCAGG + Intergenic
1072622913 10:97092148-97092170 GGGTTCTGAGCTGGGGCCCCTGG + Intronic
1072710828 10:97714592-97714614 GGATTCTGGGCTGGGATTCTGGG - Exonic
1072915182 10:99533380-99533402 GGATTCAGGGCTGTGTCCCCAGG + Exonic
1075525749 10:123185084-123185106 GGACTCCGGCCTGGGCAACCGGG - Intergenic
1076727500 10:132420437-132420459 GGGTTGTGGGCAGGGCCTCCGGG - Intergenic
1077253620 11:1571418-1571440 GGCCTCTGGCCTGGGACACCCGG - Intronic
1077327250 11:1969179-1969201 GAGTGCTGGGCTGGGCCACCAGG + Intronic
1078196005 11:9137780-9137802 GGATTCTTGGCTGGGCAAGAAGG - Intronic
1078530157 11:12130897-12130919 GGTTTCTGGGCTTTGGCACCTGG + Intronic
1080837921 11:35957588-35957610 GGAGTTTGGGCTGGGCAGCCTGG + Intronic
1081870934 11:46382185-46382207 CACTTCTGGGCTGGGCCGCCTGG + Intronic
1083750533 11:64758455-64758477 GGATGCGGGGCTGGGCAACGGGG - Exonic
1084209693 11:67615262-67615284 AGGATCTGGCCTGGGCCACCTGG - Intergenic
1084469961 11:69353740-69353762 GGGGTCAGGGCAGGGCCACCAGG + Intronic
1085267489 11:75245883-75245905 GGAGTCTGGGCAGGGCCAGTCGG - Intergenic
1085626649 11:78079011-78079033 GGATTCTGGGCTGCGCGAGGTGG - Intronic
1085773247 11:79343015-79343037 CGCTTCAGGGCAGGGCCACCAGG - Intronic
1088558819 11:111091510-111091532 GGATTCTGGGCTGGCCTTGCTGG - Intergenic
1089129906 11:116203354-116203376 GTATGCTGGGCTGGGGCCCCTGG + Intergenic
1089146334 11:116331944-116331966 AGGTGCTGGGCAGGGCCACCAGG - Intergenic
1090249777 11:125243290-125243312 GGCCTCTGGGCTGAGCCTCCAGG - Intronic
1090716975 11:129439567-129439589 GGTTTCTGGACTGGGCCAGCAGG + Intronic
1090857811 11:130625655-130625677 GGATTGTGGGATGGGACAACGGG + Intergenic
1202810232 11_KI270721v1_random:24359-24381 GAGTGCTGGGCTGGGCCACCAGG + Intergenic
1091399462 12:173490-173512 TAGTTCTGGGCTGGGCCAGCTGG + Intronic
1091658089 12:2360362-2360384 GGATGCTGGACGGAGCCACCAGG - Intronic
1092228448 12:6764160-6764182 GGACTGTGGGCTGGGCCTCAGGG - Intronic
1092771880 12:11904222-11904244 GACTTCTGGGCCAGGCCACCTGG + Intergenic
1093025957 12:14245731-14245753 GGAGACTGGCCTGGGCCACATGG + Intergenic
1094657018 12:32430018-32430040 AGATTCTGGGCTGGGCGCGCTGG + Intronic
1095667554 12:44820009-44820031 GGCTTCTGGGCTGGGGCACCAGG - Intronic
1096558683 12:52420157-52420179 GGACTGTGAGCTGGGCCACATGG - Intergenic
1097358290 12:58627441-58627463 GGAATGTTGGCTGGGACACCTGG + Intronic
1099186824 12:79523968-79523990 GGAATCTGCGCTGGGCTTCCAGG + Intergenic
1100283943 12:93146320-93146342 TGATTTTGGGCTGGGCCATGTGG + Intergenic
1101814426 12:108134870-108134892 GGCTTCTGAGCTGTGTCACCTGG - Intronic
1103009318 12:117445939-117445961 GGATTCTGGACTTGGATACCAGG - Intronic
1103567755 12:121825396-121825418 GCCTGCTGGGCTGGGCCACGGGG + Intronic
1104238752 12:126965910-126965932 AGACTATGGGCTGGGCCACATGG - Intergenic
1104751463 12:131242741-131242763 GGAATCTGGGCTGAGCAACAGGG + Intergenic
1105653149 13:22402759-22402781 GTGTTCTTGGCTGGGCCATCGGG - Intergenic
1106341827 13:28837059-28837081 GGAGTCTGAGCTGGACCATCAGG - Intronic
1106846558 13:33743606-33743628 AGTTACTGGGCTGAGCCACCTGG - Intergenic
1112486187 13:99821920-99821942 TGATTCTGGACTAGGCCACATGG + Intronic
1113672037 13:112182194-112182216 GGGCTCTGGGCTGAGCCAGCAGG + Intergenic
1113744069 13:112730616-112730638 GGAGTCTGCGCAGGGCCTCCTGG + Intronic
1113811665 13:113146413-113146435 GGTTCCTGGGCTGGGGGACCAGG + Intronic
1114243943 14:20895057-20895079 GGATTCTGTGCTTGACCATCAGG + Intergenic
1114247005 14:20923632-20923654 GGATTCTGTGCTTGACCATCAGG + Intergenic
1119408591 14:74413957-74413979 GGAATCTGTGCTGGGTCTCCAGG - Intronic
1119457787 14:74771051-74771073 GGTTTCTGGGCTGGGCCGTAGGG + Intronic
1121338478 14:93091377-93091399 TGGTTCTGGGCTGGGCTTCCTGG - Intronic
1121554510 14:94826107-94826129 GGGGCCTGTGCTGGGCCACCAGG + Intergenic
1121677130 14:95762647-95762669 GGATGCTGATCTTGGCCACCTGG - Intergenic
1122291214 14:100681403-100681425 TGATTCTGGGGTGGGCCTCTGGG + Intergenic
1122439461 14:101720010-101720032 TGATTCTGGCCTTGACCACCTGG - Intergenic
1122992055 14:105241111-105241133 TGACTCTGGCCTGGCCCACCGGG - Intronic
1123857305 15:24426759-24426781 GGCTCCTGGGCTGGGCCAGGGGG + Intergenic
1125031225 15:35078228-35078250 GGCCTCTGGGCTGAGCAACCTGG + Intergenic
1125529300 15:40401462-40401484 GGATTACAGGCTGAGCCACCGGG + Intergenic
1125761495 15:42098916-42098938 GGAGCCTGGGCTGGGCCAGTTGG - Intergenic
1128566436 15:68703436-68703458 GGTTTCTGGGCTGGGCGAGGTGG - Intronic
1129898061 15:79123095-79123117 GCAGTCTGGGCTGGGCCTCGAGG + Intergenic
1130059230 15:80557679-80557701 GGTTTCTGGCCTGGGCAAACAGG - Intronic
1130085368 15:80774216-80774238 GGATTACAGGCTGAGCCACCAGG - Intergenic
1130194557 15:81767248-81767270 GGAGTCTGAGCTATGCCACCTGG + Intergenic
1131249427 15:90820660-90820682 ACACTCTAGGCTGGGCCACCTGG + Intergenic
1132415583 15:101616331-101616353 GGAATCTGGGCTGGGACCGCTGG + Intergenic
1132543919 16:524443-524465 GGCTTCTGGGCACGTCCACCAGG - Intergenic
1132608295 16:802570-802592 GGAGTGTGGTGTGGGCCACCAGG + Intergenic
1132705050 16:1239913-1239935 GGGAGCTGGGCTGGGCCTCCTGG + Intergenic
1132825814 16:1904687-1904709 GCATGCTGGGCTGGGCTGCCCGG - Intergenic
1132858900 16:2060383-2060405 TGCTGCTGGGCTGGCCCACCGGG + Intronic
1132860746 16:2070608-2070630 GGATACCTGGCTGGGCCCCCAGG - Intronic
1134097133 16:11425233-11425255 GGATGCTGGCCTGGGCCCTCAGG + Exonic
1135544134 16:23354445-23354467 GGACTCTGGCCTTGGCCACGAGG - Intronic
1135634239 16:24060508-24060530 GGATACTGTGGTGTGCCACCAGG + Intronic
1136048529 16:27634393-27634415 GGACTCTGGGCTGGGCCTCTAGG + Intronic
1136778491 16:32883759-32883781 GGAGTCTGGGCTGGCCCGCTGGG - Intergenic
1136892129 16:33977755-33977777 GGAGTCTGGGCTGGCCCGCTGGG + Intergenic
1137569795 16:49557890-49557912 GGAGTCTGGGCCTGGGCACCTGG + Intronic
1137582613 16:49642853-49642875 GCACTCTGGCCTGGGCCACAGGG - Intronic
1139905173 16:70360353-70360375 GCACTCTGGGCTGGGCAACAAGG - Intronic
1140198484 16:72875405-72875427 GGCATCTGGGCTGTGCCTCCTGG - Intronic
1140976001 16:80061055-80061077 GGATTCTGGCTTGGACCACAAGG - Intergenic
1141080203 16:81044371-81044393 GGGTTCTGGGCTGGGCCAGATGG - Exonic
1141523391 16:84596330-84596352 GGACTCTGGGCTGGGTCACAAGG - Intronic
1141678921 16:85532662-85532684 GGATTCTGAGCAGAGCCCCCAGG + Intergenic
1142082753 16:88158580-88158602 GGACTCAGGGCTGGACAACCTGG + Intergenic
1142267856 16:89072758-89072780 GGAGCCTGGGCCGGGCAACCTGG + Intergenic
1142280498 16:89145376-89145398 TGATGCTGGGGTGGGCCAGCAGG - Exonic
1203080913 16_KI270728v1_random:1145868-1145890 GGAGTCTGGGCTGGCCCGCTGGG - Intergenic
1142832995 17:2563154-2563176 TGAATCTGGGCTTGGCCACCGGG + Intergenic
1143109590 17:4545690-4545712 GGTGGCTGGGCTGGGCCAACAGG + Exonic
1144090888 17:11855187-11855209 GGATTCTGGGCTGGGCTCAGTGG - Intronic
1144269248 17:13601308-13601330 GGATCCTGCGCGGGGCCCCCGGG - Exonic
1144653239 17:17019875-17019897 GGATAGGGGGCTGGGCCGCCTGG - Intergenic
1146669621 17:34727834-34727856 GGGTTCAGGGCTGTGCCACGTGG - Intergenic
1146884582 17:36462587-36462609 TGATTCTGGGCTGGGCGAGGTGG + Intergenic
1147021979 17:37542147-37542169 GGACGCTGGGCTGGGACACGTGG + Exonic
1147610039 17:41796442-41796464 AGAGTCTGGGTTGGGCCCCCAGG - Intergenic
1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG + Intronic
1148913296 17:50954815-50954837 GCAGTCTGGGCTGGGGCTCCTGG + Intergenic
1149167562 17:53771239-53771261 AGATTCTGGGCTGGCAAACCTGG - Intergenic
1149560495 17:57604829-57604851 GGCTTCTGGGCCCTGCCACCTGG + Intronic
1151305219 17:73258775-73258797 GGATTCTGGGCTGGAAAGCCTGG - Intronic
1151354203 17:73548859-73548881 GGAGGCTGGGCTGGGCCCCAGGG - Intronic
1151745588 17:76010093-76010115 GGATCCTGAGCTGGGCCGCCTGG + Exonic
1152076759 17:78164635-78164657 GGATGCTGGGCTGGACCACGTGG + Intronic
1152304621 17:79513356-79513378 GCATCCTGGTGTGGGCCACCTGG - Intronic
1152457654 17:80425446-80425468 GTCCTGTGGGCTGGGCCACCGGG - Intronic
1152565005 17:81096453-81096475 GGATGCTGGGGTGCGCCTCCAGG - Intronic
1152588636 17:81200272-81200294 GGATTCTGGGCCAGACCCCCCGG + Intronic
1152903120 17:82956637-82956659 GGATCCCGGGCTCTGCCACCTGG - Intronic
1154329208 18:13415782-13415804 GCCTGCTGGGCTGGGACACCGGG - Intronic
1154411925 18:14146259-14146281 GGCATCTGTCCTGGGCCACCAGG - Intergenic
1155963906 18:32018721-32018743 GGCTTCTGGGCTGCGCGAGCTGG + Exonic
1158471778 18:57743539-57743561 GGTTTTTGAGCTGGGCAACCTGG + Intronic
1158515778 18:58129114-58129136 GCAATCTGGGCTGGACCAGCAGG - Intronic
1158817926 18:61125283-61125305 GTAGCCTGGGCTGGGCTACCTGG - Intergenic
1158951624 18:62500318-62500340 GGTTTGTGGGCTTGGCCAGCTGG + Intergenic
1160070123 18:75621217-75621239 GCTTTCTGGGCTAGGCGACCTGG - Intergenic
1160173349 18:76572608-76572630 GGAGTCAGGGCGTGGCCACCGGG + Intergenic
1160948559 19:1654765-1654787 GGGGTCAGGGCTGGGCCACAAGG - Intergenic
1160957606 19:1700583-1700605 GGTCTCTGGGCTGGGTCTCCCGG + Intergenic
1161018713 19:1997516-1997538 GGATACCGGGCTGGCCCTCCCGG - Intronic
1161027944 19:2045306-2045328 GGAAGCAAGGCTGGGCCACCAGG + Intronic
1162349038 19:10137781-10137803 GGCTGCTGGGCTGGGCCTCGAGG + Intronic
1162418587 19:10552977-10552999 GGAGTGTGGGCTGGGCGAGCTGG - Exonic
1162832174 19:13292162-13292184 GGCCACTGGGCTCGGCCACCTGG + Intronic
1163438702 19:17310613-17310635 GGATTGTGGGCTGGGACTCTGGG - Intronic
1164560889 19:29291416-29291438 GGCTTCTGGGCTGGGGCCCCGGG - Intergenic
1165902580 19:39175577-39175599 TGACTCTGGGCTGCTCCACCAGG - Intronic
1165951370 19:39475573-39475595 GGAGACTGGGCTGGGACCCCAGG + Intronic
1166387222 19:42389125-42389147 GCAGTCTGGGCGGGGCCGCCAGG + Intronic
1166761695 19:45228185-45228207 GGCTGCTGGGCTGGTCCTCCAGG + Exonic
1167409311 19:49335674-49335696 GGATACGGGGGTGGGCCACAGGG - Intronic
1167695732 19:51014864-51014886 GGATGCTGGGCAGAGCCACAGGG + Exonic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168163987 19:54534049-54534071 GGACTCTGGGCAGGTCCATCTGG - Intronic
1168642782 19:58040904-58040926 GGATTCTGGGCGGGCCCAGAAGG + Intronic
1202703896 1_KI270713v1_random:6540-6562 AGATCCAGGGCTGGGCCTCCTGG - Intergenic
927971269 2:27307444-27307466 GGATGCGGGGCAGAGCCACCAGG - Exonic
929409814 2:41685369-41685391 CGATACTGGGCTGGCCAACCTGG + Intergenic
929698397 2:44140178-44140200 AGATTCTAGGCTGTGCCTCCAGG - Intergenic
931843749 2:66181290-66181312 GGATTTTGGGCTGGGACAATGGG - Intergenic
931912943 2:66922071-66922093 GGATTTTGGGCTGGTCCAGCAGG + Intergenic
931992161 2:67801645-67801667 GGTTTCTGGGCTTCACCACCAGG + Intergenic
932288228 2:70554114-70554136 GGCTGCTGGGCGGGGCGACCTGG + Intronic
933697076 2:85227706-85227728 GGATTCTGGGCTGGGCACAGTGG + Intronic
933832009 2:86218685-86218707 GGAGTCTGGCCTGGGCAATCTGG - Intronic
933987294 2:87602637-87602659 GGATTCTGAGCTGGAGAACCAGG - Intergenic
934514868 2:94980477-94980499 GGATGCGGGACTGGGCCAGCTGG - Intergenic
934766694 2:96883782-96883804 GGATTCTGGCCTGGGGTACCAGG + Intronic
934924969 2:98375841-98375863 GGAATCTCGGCTGTACCACCTGG + Intronic
935763636 2:106343595-106343617 GGAGGCTGGGCAGGGCTACCAGG - Intergenic
936306545 2:111348171-111348193 GGATTCTGAGCTGGAGAACCAGG + Intergenic
937185384 2:120035642-120035664 GAATTCTGGCCTGGGCAACATGG + Intronic
937859784 2:126698528-126698550 GGCATCTGAGCTAGGCCACCTGG - Intergenic
939154555 2:138508600-138508622 GGATTATAGGCTGAGCCACTGGG + Intronic
940535985 2:154944732-154944754 GAATTCTGGGCTGGGCAAAGGGG + Intergenic
943700796 2:190986432-190986454 GGGCTGTGGGCAGGGCCACCAGG + Intronic
947752677 2:232540931-232540953 CTCCTCTGGGCTGGGCCACCTGG + Intronic
948798767 2:240420638-240420660 GGAATCTGGTCTGGGCCCTCAGG + Intergenic
949009843 2:241672141-241672163 GGCATCTTGGGTGGGCCACCTGG - Intronic
1168837054 20:884537-884559 CAATTCTGGGCTGGGCTCCCAGG - Intronic
1169245707 20:4022809-4022831 GATCTCTGGGCTGGGGCACCAGG + Intergenic
1170893791 20:20396544-20396566 GGAGTGTGGGCAGGGCCCCCGGG + Intronic
1171294051 20:24001877-24001899 GCAGTCTGGGCTGGGTCAGCTGG + Intergenic
1171976025 20:31595239-31595261 GGATTCTGTGCTGTGCCCCTGGG - Intergenic
1173826719 20:46052491-46052513 GGAGTTTGAGCTGGGCAACCTGG + Intronic
1173900849 20:46587996-46588018 GGATTCTGGGCTGGGCCACCTGG - Intronic
1174583418 20:51589439-51589461 GGATTCTGGGCTGGGCGCGGTGG - Intergenic
1175122952 20:56730482-56730504 GGATTATAGGATGGGCCACCTGG - Intergenic
1175345254 20:58268449-58268471 GGAGTCTGGGCTGTGCCTCAGGG + Intergenic
1176861108 21:14012073-14012095 GGCATCTGTCCTGGGCCACCAGG + Intergenic
1178796808 21:35752498-35752520 GGGTTATGGGATGGGCCAGCTGG - Intronic
1179725335 21:43338663-43338685 GGCTTCTGAGCTGGGAAACCAGG - Intergenic
1180197328 21:46205733-46205755 CGCTTCTGAGATGGGCCACCAGG + Intronic
1180864691 22:19110384-19110406 GGAGTCAGGGCTGCGGCACCTGG + Intronic
1180908298 22:19431309-19431331 GGCTTCTTGGCTTGGGCACCGGG + Intronic
1181008376 22:20025579-20025601 GGAGGCAGGGCAGGGCCACCTGG - Intronic
1181545341 22:23599262-23599284 GCACACTGGGCTGGGCCAGCAGG - Intergenic
1181814968 22:25430638-25430660 GCACGCTGGGCTGGGCCAGCAGG + Intergenic
1181885630 22:26020044-26020066 GGATTCAGATCTGGCCCACCAGG + Intronic
1183023246 22:35044138-35044160 GGACTCTGGGCCTGGCCACTGGG - Intergenic
1183061842 22:35340903-35340925 GGACGCTGGGGTGGGCCATCTGG + Intronic
1183293879 22:37018957-37018979 CGCTTCTGCGCTGGGCCCCCGGG - Exonic
1184416187 22:44353046-44353068 GGTTTCTAGACTGGGCCTCCTGG + Intergenic
1184438475 22:44494838-44494860 CCATGCTGGGCTGGGCCACATGG + Exonic
1184647308 22:45903334-45903356 AGATGCTGGGATGGGGCACCAGG - Intergenic
1185145886 22:49136520-49136542 GGATTCTGGGACGGTCTACCAGG - Intergenic
1185334879 22:50267021-50267043 GGATTTTGGGCTGGCGCGCCAGG - Exonic
950734911 3:14998969-14998991 GCATTCTGGCCTGGGCATCCAGG + Intronic
951595648 3:24315548-24315570 GGATTCTGCACTGTGCCTCCCGG + Intronic
951687217 3:25358371-25358393 AGATTTTGGGCTGGGACAACGGG + Intronic
952911012 3:38186041-38186063 TGTTTGTGGCCTGGGCCACCAGG + Intronic
953542574 3:43835019-43835041 GGAGTCTGGGTTGGACTACCTGG + Intergenic
953931792 3:47009367-47009389 GACTTCTGGGCGGGGCCTCCCGG - Exonic
954130792 3:48559790-48559812 GGCTTCTAGGCTGGGACACTGGG - Intronic
954297927 3:49684496-49684518 AGATCCAGGGCTGGGCCTCCTGG + Intronic
954469065 3:50675578-50675600 GGTTTCTGGTGTGGGCCACGGGG + Intronic
959344274 3:105173475-105173497 GGATTCAGGCATGAGCCACCAGG + Intergenic
959354677 3:105310641-105310663 GGATTTTGGGCTGAGACAACAGG - Intergenic
959808972 3:110593524-110593546 GTTTCCTGGGCTAGGCCACCAGG + Intergenic
961185935 3:124915123-124915145 GGATTCTGGATTTGGCAACCAGG + Intronic
962196760 3:133370457-133370479 GGATGCTGGCCTTGACCACCTGG + Intronic
962425157 3:135262973-135262995 GGATTCTTGCCGAGGCCACCTGG + Intergenic
963929753 3:150991582-150991604 GGTTTCTGAGCTGGGAGACCAGG - Intergenic
965757617 3:172040872-172040894 GGAGACTGGGCTGCGCCGCCCGG + Intronic
965945117 3:174231713-174231735 AGATTCTGGGCTGGGGGAACAGG - Intronic
966253707 3:177893678-177893700 TGATTATGGGCTGGGCCTCCAGG - Intergenic
967975052 3:195029677-195029699 GTAGTCTGTGCTGGGCCACAGGG - Intergenic
968019508 3:195371944-195371966 GGATTTTGGGCTGGGCGTACCGG - Intronic
968590894 4:1459155-1459177 TCATGCAGGGCTGGGCCACCAGG + Intergenic
968810253 4:2796540-2796562 AGAATGTGGGCTCGGCCACCTGG + Intronic
969338468 4:6525988-6526010 GAATGCTGGGCTGGGCAACGTGG - Intronic
969390928 4:6890859-6890881 GGTTTCTGGGCTGGGGCACTGGG + Intergenic
969409118 4:7016271-7016293 GGATGCTGGGCTGGCCTGCCTGG + Intronic
969482007 4:7451679-7451701 GGATTCTGGGCTTTGCCACTGGG + Intronic
971362387 4:25950134-25950156 GGGCTCTGAGCTGGACCACCTGG + Intergenic
978091122 4:104716409-104716431 GGTTTCTGGGTTGGGCAACTGGG + Intergenic
978449841 4:108820065-108820087 GGATTCTGGGCAGGGGCATGTGG + Intronic
979527760 4:121735498-121735520 GGTTTCTGGCCTGAGCCACTGGG - Intergenic
982780139 4:159482015-159482037 GTTTTGTGGGCTGGGCCAGCTGG + Intergenic
986124681 5:4874265-4874287 GCACACTGGGCTCGGCCACCGGG - Intergenic
986690460 5:10309187-10309209 GAAGTCTGGGATGGGCCAGCAGG - Intergenic
987789882 5:22551407-22551429 CCTTTCTGGGTTGGGCCACCTGG - Intronic
988687981 5:33543999-33544021 AAATTCTGGGCTGGGCAATCAGG + Intronic
988869252 5:35370688-35370710 AGCTTTTGTGCTGGGCCACCTGG - Intergenic
989153818 5:38325153-38325175 GGAATCTGGGCAGAGTCACCAGG + Intronic
992216848 5:74534032-74534054 GGATTGTGGCCTGGGCAACGTGG + Intergenic
992795627 5:80253096-80253118 GGTTTCTGGCCTGAGCCACTGGG - Intronic
994279693 5:97886428-97886450 GGATACTGGGCTTTGCCACAAGG - Intergenic
997354840 5:133255547-133255569 GGATTCTGGGCAGGGCTGTCTGG + Intronic
998224733 5:140318046-140318068 GAATGCTGGGCTGGGCATCCGGG + Intergenic
999366107 5:151024549-151024571 GGACTGTGGGCTGGGAGACCTGG - Intronic
1002131104 5:177082169-177082191 GAATGCTGGGCTGGGCCAGGAGG - Intergenic
1002135970 5:177107838-177107860 GACATCAGGGCTGGGCCACCGGG - Intergenic
1003921013 6:10833315-10833337 GGAGTGTGGGCTGGGCGCCCTGG + Intronic
1006256865 6:32838817-32838839 TCATTCTGGGCTGGGCCGCCGGG + Exonic
1006595363 6:35189157-35189179 GGATTTGGGCCTGAGCCACCAGG + Intergenic
1011599608 6:89047942-89047964 AGGTTCTGGGCTGGGCCAGGTGG + Intergenic
1011629359 6:89309423-89309445 GGATTCTAGGCTCTCCCACCTGG + Intronic
1015414374 6:132932051-132932073 GCAAGCTGGGCTGAGCCACCCGG - Intergenic
1016481566 6:144487553-144487575 GGAATCTGTTCTGCGCCACCCGG + Exonic
1017714775 6:157201246-157201268 GGACGCTGGGCTGGGCGCCCTGG - Exonic
1019532570 7:1511083-1511105 GGAGCCGGGGCTGGGCCCCCAGG - Intergenic
1019550672 7:1600914-1600936 GGAATCTTGGCTGGTCCACCAGG - Intergenic
1019820524 7:3239515-3239537 GGTTTCTGGCATGGGCCACATGG + Intergenic
1021267370 7:18541319-18541341 GGAATCTTGGCTGGCACACCGGG - Intronic
1021959356 7:25857189-25857211 GGATTCGGGGGCGGGCCACAAGG + Intergenic
1023220890 7:37919438-37919460 GGTTTCTGGTTTGGGCCACTGGG - Intronic
1024037953 7:45524437-45524459 GGCTTCTGTTCTTGGCCACCTGG - Intergenic
1024075776 7:45817197-45817219 AGAAGCTGGGCTGAGCCACCCGG - Intergenic
1024983144 7:55174061-55174083 GGCCTCTGGGCTGGGCCGCAGGG + Intronic
1026154097 7:67812250-67812272 TGTTTCTGAGCTGAGCCACCGGG - Intergenic
1028734367 7:94190618-94190640 AGGCTCTGGGCTGGGCCTCCAGG + Intergenic
1029098295 7:98106776-98106798 GGATGATGGGCGGGGCCTCCTGG + Intergenic
1029499716 7:100921225-100921247 TGCTTCTGGGCAGGGCCACAGGG + Intergenic
1029591710 7:101511354-101511376 GGTTTCAGGGCTGGGTCTCCTGG + Intronic
1033586872 7:142780625-142780647 GGCTTGTTGGATGGGCCACCAGG - Intergenic
1034218988 7:149430102-149430124 GGAATCTGAGCTGGGCCTGCGGG - Intergenic
1034413077 7:150951292-150951314 GGTTTGGGGGCTGGGTCACCAGG - Intronic
1035162035 7:156958290-156958312 GGTTTCTGGTCTGGGTAACCAGG - Intronic
1035896878 8:3412924-3412946 GGAAGCTGGGCTGGGCGCCCAGG + Intronic
1036658098 8:10690690-10690712 GGAGTCTGGGCTGGGCGAGCCGG - Intronic
1037980308 8:23248484-23248506 GGATTCAGGCCTAGGCCAGCCGG - Intronic
1039032761 8:33327817-33327839 GAAGTCTAGGCTGGGCCAACAGG - Intergenic
1039248215 8:35632791-35632813 GGAGTCTAGGCTGGCCCACGAGG + Intronic
1044072497 8:87779030-87779052 GGCTTGAGGACTGGGCCACCTGG + Intergenic
1044609471 8:94077997-94078019 TGAATCTGGGCTTGGCCATCTGG - Intergenic
1047558268 8:125957921-125957943 AGTTTCTGGCCTGAGCCACCTGG + Intergenic
1047617957 8:126578890-126578912 CGATTCTGGGCTTGGCCATGTGG - Intergenic
1048593340 8:135841971-135841993 GGATTGGGAGCTGGGCCACTGGG + Intergenic
1049206130 8:141364486-141364508 GGCTTCTGGCCAGGGTCACCTGG - Intronic
1049478058 8:142806028-142806050 GGCTCCTGGGCTGGGCACCCCGG - Intergenic
1049485616 8:142858382-142858404 GGGTGCTGGACTGGGCCACCTGG + Intronic
1049538404 8:143193769-143193791 GGCTGCTGGGCAGGGCCACACGG - Intergenic
1049758217 8:144320222-144320244 GGCTTCAGGGCTGGGCCAAAGGG + Intronic
1050431342 9:5565126-5565148 GGATTCTGGACTTGGACACCTGG - Intronic
1056128608 9:83562556-83562578 CGTTTCTCGGCCGGGCCACCTGG + Intergenic
1057463973 9:95294211-95294233 GGGTTCTGGGCTGGGCCAGATGG - Intronic
1057702480 9:97374000-97374022 GGCTTCTGAGCCAGGCCACCGGG + Intronic
1060149568 9:121279599-121279621 GGTGTCTGGACTGGTCCACCGGG + Intronic
1060213060 9:121722234-121722256 AGGTTCTGGGCTGGGCCAGGAGG + Intronic
1060224789 9:121784158-121784180 GGAGGAAGGGCTGGGCCACCAGG + Exonic
1060791356 9:126487730-126487752 GCATTCCGGCCTGGGCCACAGGG + Intronic
1062024409 9:134333649-134333671 GCATTCTGGGCTGCAGCACCAGG - Intronic
1062115348 9:134805529-134805551 TGGGTCTGGGCTGGGCCAGCAGG + Intronic
1062445150 9:136590522-136590544 GAGTGCTGGCCTGGGCCACCTGG + Intergenic
1062467009 9:136685984-136686006 GGACCCCGGCCTGGGCCACCTGG + Intronic
1062679980 9:137774200-137774222 GGGTTCTGGGCTGGGTATCCAGG - Intronic
1062688478 9:137828383-137828405 GGAGTCTGGGCTGGGTCATCAGG + Intronic
1185548765 X:967004-967026 GGATCCTGGGCCTGCCCACCTGG + Intergenic
1187306668 X:18101331-18101353 TGATTCTGGGTTGGGACTCCTGG - Intergenic
1188467908 X:30503615-30503637 GGATTCTGGGCTGGGCACAGTGG + Intergenic
1194617730 X:96127794-96127816 GGATACTGGGCTGGGCAAGTGGG + Intergenic
1196564709 X:117191168-117191190 GGATTCTAGGCTGGGCACCGTGG + Intergenic
1196692706 X:118577329-118577351 GGATGCTTTGGTGGGCCACCTGG + Intronic
1196817599 X:119677553-119677575 TGATGCTGGGCTGGGCCTCCTGG - Intronic
1197640962 X:128967657-128967679 GGATTCTGGGATTTGGCACCAGG - Intergenic
1200101340 X:153690297-153690319 GGAGTCTGGGCTGGCCCGCTGGG + Intronic
1201262848 Y:12177239-12177261 GGATTACAGGCTGAGCCACCGGG - Intergenic