ID: 1173904919

View in Genome Browser
Species Human (GRCh38)
Location 20:46619561-46619583
Sequence GGCCCCCAGACTCACAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173904910_1173904919 8 Left 1173904910 20:46619530-46619552 CCCTGCTCAAACACCTCCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 360
Right 1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG 0: 1
1: 0
2: 2
3: 16
4: 180
1173904915_1173904919 -8 Left 1173904915 20:46619546-46619568 CCTCTGGCTCCCCATGGCCCCCA 0: 1
1: 1
2: 8
3: 81
4: 640
Right 1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG 0: 1
1: 0
2: 2
3: 16
4: 180
1173904909_1173904919 9 Left 1173904909 20:46619529-46619551 CCCCTGCTCAAACACCTCCTCTG 0: 1
1: 0
2: 2
3: 72
4: 566
Right 1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG 0: 1
1: 0
2: 2
3: 16
4: 180
1173904914_1173904919 -5 Left 1173904914 20:46619543-46619565 CCTCCTCTGGCTCCCCATGGCCC 0: 1
1: 0
2: 11
3: 105
4: 960
Right 1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG 0: 1
1: 0
2: 2
3: 16
4: 180
1173904912_1173904919 7 Left 1173904912 20:46619531-46619553 CCTGCTCAAACACCTCCTCTGGC 0: 1
1: 1
2: 3
3: 50
4: 369
Right 1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG 0: 1
1: 0
2: 2
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173904919 Original CRISPR GGCCCCCAGACTCACAGTCA TGG Intronic
900078953 1:841352-841374 GGCCTCAAGAATCACAGTCCAGG + Intergenic
901070011 1:6512367-6512389 GGCTCCCAGAGTCCAAGTCAGGG - Intronic
901154454 1:7125995-7126017 AGGCCTCAAACTCACAGTCATGG + Intronic
901445990 1:9308379-9308401 TGTCCCCCGACCCACAGTCAGGG - Intronic
901794435 1:11672261-11672283 GGCCCCCAGGTGCACTGTCATGG + Intronic
902511907 1:16971297-16971319 GGCTCGCAGGCTCACTGTCAGGG + Intronic
903320209 1:22538611-22538633 AGCCCCCAGGCTGACAGTCAGGG + Intergenic
903654065 1:24938221-24938243 GGCCCTCAGACTCCCCTTCAGGG + Intronic
904010961 1:27390351-27390373 GGCCCCAAGACTCAGGGTCAGGG - Intergenic
905126375 1:35718686-35718708 GGGCCCCAGACTCGGACTCACGG + Exonic
905345291 1:37307115-37307137 GGCTCCCCAACACACAGTCAGGG + Intergenic
905473017 1:38207290-38207312 AGTCCCCAGACTCACAGCCCTGG - Intergenic
905663462 1:39746582-39746604 GGCCCCCAGCTGCAGAGTCAGGG + Intronic
906151749 1:43591631-43591653 AGCCCCCAGCCTCACAGCCGAGG - Intronic
908400989 1:63772857-63772879 TGCCCACAGTCTCACAGACATGG - Intergenic
910803951 1:91171967-91171989 CCCCCCCAGACTCACAGTCACGG + Intergenic
915879996 1:159659454-159659476 GGCCCCCGAACTCACACTGAAGG - Intergenic
916719576 1:167474192-167474214 CACCCCCAGACTCAGAGCCAGGG - Intronic
922615889 1:226961006-226961028 GGCGCACAGACTCCCAGTCTAGG - Intronic
1063611977 10:7570359-7570381 GGCGGCCAGGCGCACAGTCAGGG + Intronic
1063994317 10:11603791-11603813 GGCAACCAGAGTGACAGTCAAGG + Intronic
1067737633 10:48870609-48870631 GGCCCACAGACTCACAGGCAGGG - Intronic
1074085073 10:110203751-110203773 GGCTGCCAGACTCACAGTTCTGG + Intergenic
1075001983 10:118805406-118805428 TGCCCCCAGAATCACAGCCCAGG + Intergenic
1075687552 10:124375138-124375160 AGCACCCAGACTCACTGTCCTGG - Intergenic
1076062070 10:127420610-127420632 GGGTCCCAGGCTCCCAGTCAAGG + Intronic
1077443202 11:2578283-2578305 GCCCCCCACACTCAGAGCCACGG + Intronic
1080665498 11:34332435-34332457 AACCCCCACACTCACACTCAGGG + Intronic
1081644977 11:44783969-44783991 GGACCCCAGAGGCACAGCCAGGG + Intronic
1083488598 11:62998802-62998824 GGCACCCAGTCCCAGAGTCAGGG - Intronic
1084597122 11:70123524-70123546 GCCTCCCAAACTCAGAGTCAAGG - Intronic
1084930374 11:72550885-72550907 GGCCCACATACTCACATTCAAGG - Intergenic
1085766569 11:79288246-79288268 GGATCACAAACTCACAGTCAGGG - Intronic
1089346249 11:117793589-117793611 AGCCCCCAGACACAGGGTCAAGG - Intronic
1089357387 11:117862704-117862726 GGCCCTGAGACACACAGGCAGGG + Intronic
1089379147 11:118015317-118015339 GGCCCTAAGACCCACAGGCAGGG + Intergenic
1089390648 11:118099333-118099355 AGCCCCCACCCCCACAGTCAGGG + Intronic
1098636354 12:72788860-72788882 GGACCTCAGCCTCACAATCATGG - Intergenic
1099725201 12:86417569-86417591 GGTACCCACATTCACAGTCAGGG - Intronic
1100341434 12:93683276-93683298 GACACCCAGACCCACAGCCAGGG - Intronic
1102084862 12:110127890-110127912 GGCCCCCAGATTCCAAGTGAGGG - Intronic
1102244619 12:111347644-111347666 GGTCCTCAGTCTCAGAGTCAGGG - Exonic
1103342634 12:120229171-120229193 GGTCCCCAGAGCCACAGTCTGGG - Intronic
1104441502 12:128797146-128797168 GCCCCCCAGGCTCACAGGCAGGG + Intronic
1104473123 12:129046961-129046983 GGTCCCCAGCCTCACATTTATGG - Intergenic
1107440399 13:40422116-40422138 GGCCCCCAAACACACTCTCATGG - Intergenic
1107680020 13:42838605-42838627 GGCCACCAGACTTCCAGACATGG + Intergenic
1117198042 14:53360929-53360951 GGCCCCCAGGCTTCCAGGCAAGG - Intergenic
1118908276 14:70039374-70039396 GCCCCACAGTCCCACAGTCATGG + Intergenic
1119099808 14:71869388-71869410 GTCCCCTGGAATCACAGTCATGG - Intergenic
1119540071 14:75432158-75432180 GGCCCCAAGACTGAGAGTGAAGG - Exonic
1119659929 14:76443363-76443385 TTCCCCCAGACTCAGACTCAGGG - Intronic
1121322837 14:93002596-93002618 GGCCACCAGCCTGACAGTCCAGG + Intronic
1121333474 14:93062762-93062784 GGCTGCCAGGCTCACAGTCAAGG + Intronic
1122575207 14:102737628-102737650 GGAGCCCAGACTCACACTCCAGG - Intergenic
1122987324 14:105218482-105218504 GGACCCCAGTCTCGCAGGCAGGG + Intronic
1123136819 14:106034905-106034927 GATCCCCAGAGACACAGTCATGG - Intergenic
1125672911 15:41486472-41486494 GGCCCGCAGCCTCAGAGCCAGGG + Intergenic
1127726033 15:61751009-61751031 GGCCACTGGACTCACAGTCGGGG + Intergenic
1128052462 15:64676010-64676032 GGCCCCCAGCCTGACAGACCTGG + Exonic
1128945922 15:71820752-71820774 GTATCTCAGACTCACAGTCAAGG - Intergenic
1129766726 15:78174370-78174392 GCCCCCCAGACACACCTTCAAGG + Exonic
1132613363 16:828621-828643 GGCCCCCAGACTCCCAGGTCAGG - Intergenic
1132858570 16:2058461-2058483 GGCCCACAGCCTCGCAGTCTGGG - Intronic
1132899415 16:2245103-2245125 GAGCCTCAGACTCCCAGTCAGGG + Intronic
1136239107 16:28933283-28933305 GGCCCCTGGACACAGAGTCAGGG - Exonic
1137582778 16:49644140-49644162 GGCCCACAGACTCACAGGAGTGG + Intronic
1138029293 16:53547103-53547125 GGGCCCCAGACACACAGGGAAGG + Intergenic
1139475984 16:67202783-67202805 TCCCCCCAGACTCACAGTATAGG - Exonic
1142598020 17:1039057-1039079 GGCTCCCAGACTCAGAGGCACGG - Intronic
1144281357 17:13730289-13730311 GGCCCCTAAACTCGCAGACAAGG + Intergenic
1145236032 17:21209058-21209080 GTGCCCCAGACTCAAAGGCACGG + Intronic
1146849917 17:36213081-36213103 TGCCCCCAGTTTCACAGTTAAGG + Intronic
1147449032 17:40492252-40492274 GGCTCACAGTCACACAGTCAGGG - Intronic
1149036164 17:52136502-52136524 GGCCCCTAGCTTCACGGTCAAGG + Intronic
1149070204 17:52532567-52532589 GGCCTCCAGACCAACAGCCAGGG + Intergenic
1152705566 17:81841793-81841815 GGCTCACAGAGTCACAGGCAGGG + Intergenic
1153339592 18:3960695-3960717 GGTCCCCAGACTAACAGCCTCGG - Intronic
1155105288 18:22658733-22658755 TGCCCACAGACTCAAAGTAAAGG + Intergenic
1156503013 18:37571510-37571532 GGACCCCAGAGTCCCAGACAGGG + Intergenic
1157517376 18:48320607-48320629 GGCTCCCAGGCTGACAGCCAAGG + Intronic
1159586539 18:70288674-70288696 GGCCCCCAGAGTCCCTGTCCTGG - Intergenic
1159725477 18:71952332-71952354 CGCCCCCATACTCACAGAAAGGG - Intergenic
1160127940 18:76195721-76195743 GGCCACCAAGATCACAGTCAAGG + Intergenic
1160349632 18:78165553-78165575 GGCTTCCAGACACAGAGTCACGG - Intergenic
1160398280 18:78588238-78588260 GGGCCCCAGCCACCCAGTCAGGG + Intergenic
1160957306 19:1699590-1699612 CGCCCCCAGCCCCACTGTCAGGG - Intergenic
1160981298 19:1817787-1817809 GGGACACAGACACACAGTCAGGG + Intronic
1161342848 19:3752464-3752486 GGCCCCCACACTCCCAGGAAGGG - Intronic
1163697874 19:18773102-18773124 GGACACCAGACACACAGACATGG - Intronic
1163845860 19:19637771-19637793 CGCCCCCAGACCCACTGTCTCGG - Intronic
1164679000 19:30121598-30121620 GGGCCCCAGACGCACAGAGAGGG - Intergenic
1164703396 19:30302355-30302377 GGCCCTGGGACTCACAGCCATGG + Intronic
1165336355 19:35172774-35172796 TGCTCTCAGACTCACAGTTAGGG + Intergenic
1165860037 19:38904386-38904408 TCCCCACAGACTCACAGGCATGG + Intronic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167728343 19:51234619-51234641 GGTCCCAACACTCAGAGTCAGGG - Intronic
1168230175 19:55026141-55026163 TGCCCCCAGGGTCACAGTGAGGG - Intronic
925845921 2:8033288-8033310 GACCCCCAGACTTGCAGTAATGG - Intergenic
927872224 2:26630905-26630927 GGCTCCCACTCTCACAGTCTAGG - Intronic
929381258 2:41357016-41357038 CACACCCACACTCACAGTCAAGG + Intergenic
929617610 2:43324348-43324370 GGCCCCAAGCCTCACAGTTGTGG - Intronic
929892357 2:45928892-45928914 GGCCCCCAGACTCCCAGCCTCGG - Intronic
930747362 2:54898435-54898457 CAGCCCCAGAGTCACAGTCAGGG - Intronic
931756994 2:65383312-65383334 GGGCCCCGGCCTCACAGACAAGG - Intronic
931970406 2:67579440-67579462 GTCCCCCAAACCCACAGTTAGGG - Intergenic
937206660 2:120241009-120241031 GGACCCCAGATCCACTGTCACGG + Intronic
937854704 2:126663800-126663822 GGCCCCCGGCTTCACACTCAGGG - Intronic
946488744 2:220126933-220126955 TGCCTCTAGCCTCACAGTCAAGG - Intergenic
947952219 2:234158154-234158176 AGCCCCTAGACTGTCAGTCATGG - Intergenic
948698761 2:239747690-239747712 GGACCCCTGAATCACAGTCAGGG + Intergenic
948887762 2:240892588-240892610 GGCCAGCAGGCTCACAGTGACGG + Intronic
948887775 2:240892642-240892664 GGCCAGCAGGCTCACAGTGACGG + Intronic
1169969170 20:11250137-11250159 GGATCCCAGAATCAGAGTCAGGG - Intergenic
1170940633 20:20845436-20845458 GGATCCAAGACTCAGAGTCATGG + Intergenic
1171105130 20:22426130-22426152 GGCCTCCTGACTCCCAGTCCAGG - Intergenic
1172006423 20:31821691-31821713 GGCCCTCTGTCTCACAGCCAGGG + Exonic
1172046458 20:32084082-32084104 GGCCCACAGACTCCTAGTCACGG + Intronic
1172632697 20:36389944-36389966 GGCCTCCAGAGTACCAGTCATGG - Intronic
1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG + Intronic
1175484576 20:59336743-59336765 GACCCGCAGACTCTCTGTCAAGG - Intergenic
1175585252 20:60134002-60134024 GGCACCCAGAGGCGCAGTCAAGG - Intergenic
1175749729 20:61487004-61487026 GGGCCCTGGAGTCACAGTCAAGG + Intronic
1176162450 20:63654593-63654615 CCCCACCAGACTCACAGTCCCGG - Intergenic
1178495071 21:33079293-33079315 GGACCCCAGCCTCACTGGCAGGG - Intergenic
1179973380 21:44848891-44848913 TGCCCCCAGACACACTGCCATGG - Intergenic
1181029452 22:20142836-20142858 GGCCCCCTGGCCCATAGTCAGGG - Exonic
1181140889 22:20804042-20804064 GGCCCCCAGCCTCACAACAACGG + Intronic
1181266781 22:21635245-21635267 GGCCACCAGATTCAAACTCAAGG + Exonic
1181513793 22:23400482-23400504 GGCCCCCGGGCCCATAGTCAGGG + Intergenic
1183571401 22:38656217-38656239 TGCCCCCAAACTCACAGCAAGGG + Exonic
1183619066 22:38962182-38962204 GGCCCGCAGCCTCCCACTCAGGG - Exonic
1183624269 22:38992118-38992140 GGCCCGCAGCCTCCCACTCAGGG - Exonic
1184457672 22:44620821-44620843 GCCCGCCAGACCCACAGACACGG - Intergenic
1185057904 22:48590625-48590647 GGCTCTCAGAGTCACAGTCCTGG - Intronic
1185103751 22:48855722-48855744 GGGACCCAGCCTCACAGACATGG + Intergenic
955971897 3:64445090-64445112 GGCCCTCAGGGTCACAGTCTGGG - Intronic
966845958 3:184130057-184130079 GGCCCCAAGACTTACCCTCAAGG + Intergenic
968957596 4:3727132-3727154 TGCCCCCATACTCACAGGGAGGG + Intergenic
969657838 4:8508359-8508381 GGCACCCAGACCCACCCTCAGGG - Intergenic
975312262 4:72915704-72915726 GGCACCTACACTCACAGTGAAGG + Intergenic
975937904 4:79603637-79603659 GACCCCCACACTCATAGTTATGG + Intergenic
979186841 4:117807391-117807413 GGCACCCAGTCACAAAGTCAGGG - Intergenic
979594190 4:122515240-122515262 GGCCCCCAGGTCCACAGACAGGG + Intergenic
984756547 4:183330544-183330566 GGCCTCCAGACTCAGATTCCAGG + Intergenic
986450384 5:7857638-7857660 GGCACCCTGACACACAGTCAAGG - Intronic
992552971 5:77876672-77876694 GGTCCCGAGACACACAGTCAGGG - Intergenic
998029432 5:138852263-138852285 AGCCCACAGCCTCACAGGCAAGG - Intronic
999251043 5:150182574-150182596 GACCCACAGACTCACAGTCTGGG - Intronic
1001536384 5:172501120-172501142 GGATCCCGGACTAACAGTCATGG + Intergenic
1001601680 5:172933001-172933023 GACCCCAACACTCAAAGTCATGG + Intronic
1002569301 5:180130943-180130965 GGCCACCAGACACACAGGCTTGG + Intronic
1004205921 6:13591901-13591923 GACCCCCAGCCTCCCATTCAGGG + Intronic
1004422505 6:15484298-15484320 TGTCCACAGACTCTCAGTCATGG + Intronic
1005501321 6:26431348-26431370 GTTCCCCAGTCTCACAGCCATGG + Intergenic
1007714813 6:43849646-43849668 GGCCCCCAAACTCCCAGGGAAGG - Intergenic
1007719327 6:43876040-43876062 GGCCTCCACACTCAGAGTTATGG + Intergenic
1017135974 6:151147833-151147855 AGCCCCCAGACTCAGAGCCCTGG + Intergenic
1019607122 7:1915558-1915580 GCCTCCAAGTCTCACAGTCAAGG + Intronic
1020433186 7:8133987-8134009 GGGACCCCAACTCACAGTCAAGG + Intronic
1022089543 7:27098442-27098464 GGCCCGCAGACACACAGGCCCGG + Intergenic
1023814779 7:43941325-43941347 GGCCCAAACACTCACATTCAAGG - Intronic
1024030458 7:45455975-45455997 GGCCCACAGACTCACTGGCCAGG + Intergenic
1026231121 7:68485014-68485036 GACACCCAGACTCAGTGTCAGGG + Intergenic
1026991391 7:74587904-74587926 GGCCCCCACACTCCCAGACACGG + Intronic
1027507832 7:79040272-79040294 GGCCTCCGGAAACACAGTCATGG - Intronic
1028323538 7:89493306-89493328 GGCCTCCTGAGGCACAGTCAGGG + Intergenic
1029956181 7:104642705-104642727 GGCCCCCACTCTCACATGCAGGG + Intronic
1030084461 7:105804819-105804841 GGCTCCCAGTCTCACAGTTTGGG + Intronic
1030529695 7:110697134-110697156 GGTACCTAGACTCACAATCAGGG + Intronic
1031986655 7:128168051-128168073 TTTCCCCAGACTCCCAGTCATGG - Intergenic
1032239971 7:130153119-130153141 GGCCCCCTGACTCAGAGCCGGGG + Intergenic
1032255285 7:130292199-130292221 GGACACCAGACCCACAGTCTAGG + Intergenic
1033278199 7:139988379-139988401 TGACCACAGACTCACAGTCATGG + Intronic
1034063147 7:148111212-148111234 GACCCCCAAACTCACAATCCAGG + Intronic
1035420124 7:158722684-158722706 GGCCCACACAGACACAGTCAGGG - Intergenic
1035526678 8:318332-318354 GGCCTCAAGAATCACAGTCCAGG - Intergenic
1035788428 8:2281189-2281211 GTCCCACAGATTCACAGCCATGG - Intergenic
1035804377 8:2440516-2440538 GTCCCACAGATTCACAGCCATGG + Intergenic
1042182718 8:66107924-66107946 GGCCTCCTGAATCACAGCCAGGG - Intergenic
1042664882 8:71193999-71194021 GCCTCCCAGACTCACAGTCCTGG + Intergenic
1043813084 8:84766972-84766994 GGCACCCATACTCAGTGTCATGG + Intronic
1044467205 8:92521384-92521406 GGCCCCCAGGATCAAAATCATGG + Intergenic
1046087071 8:109451114-109451136 GGGCACCAGACTGACAGTCGTGG + Exonic
1049642852 8:143723182-143723204 GGCTGCCAGGCTCACAGTCTGGG + Intergenic
1055724076 9:79208865-79208887 GGCCCACAGACACACAGTGCTGG + Intergenic
1057209593 9:93192568-93192590 GGCCCCCCGAGACACAGTCCTGG - Intronic
1057882742 9:98805629-98805651 GGTCTCCTGACTCACAGTCCAGG - Intergenic
1059031126 9:110697487-110697509 GGCCCCTGGTCACACAGTCAGGG - Intronic
1059381604 9:113931394-113931416 GTGCCCCAGGCTCAAAGTCAGGG + Intronic
1060778214 9:126392287-126392309 GCCCCCCAGGCTCTCAGCCATGG + Intronic
1061188006 9:129066246-129066268 GGCCCACAGACACCAAGTCAAGG - Intronic
1061463019 9:130755321-130755343 AGTCGCCAGACTCACAGTCATGG - Intronic
1061563451 9:131421595-131421617 TGCCCCCAGCCTCACGGCCAGGG + Intronic
1062074047 9:134574866-134574888 CGCCCCCTGACTCCCAGGCAAGG - Intergenic
1062402436 9:136378461-136378483 GGCCGCCCGAGTCTCAGTCAGGG + Exonic
1190569482 X:51766995-51767017 GCACCCCAGACTCACAGTTGGGG - Intergenic
1190603581 X:52117471-52117493 GGACTCCAGACACACAGTGAAGG + Intergenic
1191950996 X:66593036-66593058 GGGCCTCAGAGTCACAGTCTTGG + Intergenic