ID: 1173906595

View in Genome Browser
Species Human (GRCh38)
Location 20:46634237-46634259
Sequence GGGGGCTAATTCAGTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173906595 Original CRISPR GGGGGCTAATTCAGTCTTGA GGG Intronic
902149084 1:14428016-14428038 GGGCCCTCATTCAGACTTGATGG - Intergenic
902262443 1:15236895-15236917 GGGAGGTAATTGAGTCATGAGGG + Intergenic
903371865 1:22841668-22841690 CGGGGGTGACTCAGTCTTGAAGG + Intronic
904870262 1:33613205-33613227 GGGTGCTAATTCAGGTTTCAGGG - Intronic
905000440 1:34663947-34663969 AGGGGGTGATTAAGTCTTGAGGG + Intergenic
907870469 1:58438324-58438346 TGGGCCTAATCAAGTCTTGAGGG + Intronic
910232566 1:85001276-85001298 GGGAGGTAATTAGGTCTTGAGGG + Intronic
911254864 1:95621518-95621540 GGGAGGTGATTCAGTCATGAAGG + Intergenic
913065994 1:115255501-115255523 GGGAGCTGATTAGGTCTTGAAGG + Intergenic
915463947 1:156085035-156085057 GAGGGCTGATTCATTCTTGTTGG - Intronic
917753476 1:178075950-178075972 GGGAGCTAATTAGGTCATGAGGG + Intergenic
920460777 1:206138334-206138356 GGGGACTAAGTCATTCATGAGGG + Intergenic
922672266 1:227519611-227519633 GGGGGGTAATTAGGTCCTGAAGG + Intergenic
922681304 1:227599074-227599096 GGGGTCCAATCCAGTCTTCAGGG - Intronic
1065148718 10:22799841-22799863 GGGAGATAATTCAGTCATGGTGG + Intergenic
1068578867 10:58715612-58715634 GGGGTCCAATCCAGTCTTCAGGG + Intronic
1069115366 10:64498640-64498662 GGGAGGTAATTCAGTTTAGATGG + Intergenic
1069596139 10:69672088-69672110 GGGCACTAATCCATTCTTGAGGG + Intergenic
1070425670 10:76284743-76284765 GGGAGGTAATTGAATCTTGAGGG + Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1074590856 10:114811669-114811691 GGGGGCTGATAAAGTCTAGAAGG + Intergenic
1074600420 10:114908198-114908220 GGGGGATAATTAGGTCATGAGGG - Intergenic
1076448776 10:130540402-130540424 GGGGGGTCATTAAGTCATGAGGG - Intergenic
1078205592 11:9226474-9226496 TGGGGCTATTTCAATCTTCAAGG + Intronic
1080308826 11:30866479-30866501 AGGGGCTAATTAAGTCATGAGGG - Intronic
1082204503 11:49416221-49416243 GTGGGCTTAATGAGTCTTGATGG + Intergenic
1082577214 11:54822465-54822487 GGGGGCTAATTGAGGCTATAGGG + Intergenic
1085732244 11:79009901-79009923 GGGAGGTAATTCAGTCATGGGGG + Intronic
1086307201 11:85494112-85494134 GGGAGGTAATTAAGTCATGAAGG - Intronic
1086650589 11:89284283-89284305 GTGGGCTTAATGAGTCTTGATGG - Intronic
1087157418 11:94919034-94919056 TGGGGGCAATTCAGTCTTGGGGG - Intergenic
1088753476 11:112865683-112865705 AGGGGCGTATTCAGTCCTGAGGG - Intergenic
1089307512 11:117535910-117535932 GGGGGCTGATGCTGCCTTGATGG + Intronic
1090105761 11:123852394-123852416 GGGTGCTAAGTCACTCATGAGGG - Intergenic
1093445012 12:19246877-19246899 GGGGCCTATTTCATTCTTAATGG - Intronic
1093977168 12:25436223-25436245 GGGGTCCAATCCAGTCTTAAGGG - Intronic
1097446217 12:59675300-59675322 GGGAGGTAATTAAGTCGTGATGG + Intronic
1097955399 12:65480369-65480391 GGGGGGTGATTAAGTCATGAGGG - Intronic
1098156026 12:67599615-67599637 AGGGGATAATTAAGTCATGATGG - Intergenic
1098391169 12:69971467-69971489 GGGGGCTAATTGAATCATGGGGG - Intergenic
1100678313 12:96892364-96892386 GGGAGGTAATTTAGTCATGAGGG + Intergenic
1101924198 12:108957592-108957614 TGGGGCTTATTAAGTCTTAATGG - Intronic
1104012148 12:124939513-124939535 GGGCCCTAATTCAGTGTTGCAGG + Intergenic
1105724784 13:23151987-23152009 GGGAGGTAATTGAATCTTGAAGG - Intergenic
1107108236 13:36669764-36669786 TGGAGATAATTCAGTCATGAAGG + Intergenic
1109702592 13:66047183-66047205 GGGAGCTAATTGAATCATGAGGG - Intergenic
1109901042 13:68770494-68770516 GGGAGGTAATTCAGTCATGGGGG + Intergenic
1110404810 13:75138279-75138301 GGAGGCTAATTAAGTCATGTTGG - Intergenic
1111706405 13:91754474-91754496 GGACCCTAATTCAGTCTTGGTGG - Intronic
1111890068 13:94070275-94070297 GGGAGGTAATTCAGTCATGGAGG - Intronic
1111918637 13:94387658-94387680 GGGAGATAATTAGGTCTTGAGGG + Intronic
1112938398 13:104829308-104829330 GTTGGCTAATTCAGTCTCCATGG - Intergenic
1114593348 14:23890432-23890454 GGGAGATAATTAAGTCATGAAGG + Intergenic
1115373881 14:32651695-32651717 GGGAGGTAATTAAGTCATGAGGG - Intronic
1116233559 14:42248903-42248925 GGGTGCTAATCCATTCATGAGGG - Intergenic
1116706724 14:48312029-48312051 GGGAGGTAATTTAGTCATGAGGG - Intergenic
1120947353 14:90011002-90011024 GGGAGGTAATTCAGTCATGGGGG + Intronic
1121377362 14:93425311-93425333 GGGAGGTAATTCAGTCATGGGGG - Intronic
1125320463 15:38482335-38482357 GGGTGATAATTTAGTCTTGCTGG + Intronic
1126292958 15:47101952-47101974 GGGGACTAATCCATTCATGAGGG - Intergenic
1127439170 15:58988430-58988452 GGGCGCTAAGTCAGCCCTGACGG + Intronic
1127686742 15:61353215-61353237 GGGAGCTAACTAAGTCATGAGGG + Intergenic
1128778549 15:70342467-70342489 GGAGGCTGGTTCAGTCTTGAAGG - Intergenic
1128940810 15:71786301-71786323 GGGTGCTCATTCAACCTTGAAGG + Intergenic
1130318319 15:82816133-82816155 GGGGGGTAATTAGGTCATGAGGG - Intronic
1131570270 15:93527849-93527871 GGGGACTAATCCCATCTTGAAGG - Intergenic
1135137523 16:19895895-19895917 GGGAAGTAATTAAGTCTTGAGGG + Intergenic
1135804412 16:25529107-25529129 GGGAGCTGATTAGGTCTTGAGGG - Intergenic
1138293774 16:55869697-55869719 GGAGGCTGAGCCAGTCTTGAAGG + Exonic
1143840327 17:9726621-9726643 GGGTGGTAATTAGGTCTTGAGGG - Intronic
1148891348 17:50809603-50809625 GGGAGGTGATTAAGTCTTGAGGG + Intergenic
1152100195 17:78296930-78296952 GGGGGCTGGTTAAGTCATGAGGG + Intergenic
1153366894 18:4266432-4266454 GTGGGCTAAATCATTTTTGAAGG + Intronic
1155482121 18:26300426-26300448 GGGTGCTAAATCAGTATTTAGGG - Intronic
1156169089 18:34460669-34460691 GGTAGGTAATTCAGTCATGAGGG + Intergenic
1156822995 18:41395109-41395131 AGTGGGTAATTCAGTCTGGAGGG - Intergenic
1157659451 18:49426798-49426820 AGGGCCTATTTCTGTCTTGAGGG - Intronic
1157923019 18:51733267-51733289 GTGGGCTGATACAGACTTGAGGG - Intergenic
1158414504 18:57237703-57237725 GGGAGATAATTCAGTCATGAGGG - Intergenic
1159717815 18:71848141-71848163 GGGGGGTAATTGAATCTTGGGGG + Intergenic
1159749597 18:72283794-72283816 GGGTGCTAATTGAGTCATGGGGG - Intergenic
1159751220 18:72304457-72304479 GGGAGATAATTAAGTCTTGGGGG - Intergenic
1160312410 18:77808181-77808203 GGGAGATAATTCAGTCATGGGGG + Intergenic
1166628529 19:44383993-44384015 GAGGGCTGATTCTGTCATGAAGG + Exonic
925382761 2:3438302-3438324 GGGGGCTAATCCAGGGGTGATGG - Intronic
926447437 2:12961017-12961039 GGGAGGTAATTAGGTCTTGAGGG + Intergenic
927010000 2:18893534-18893556 AGGGGCTAATTCATTTTTGCAGG + Intergenic
928052672 2:28016402-28016424 GGGGTCCAATCCAGTCTTCAGGG - Intronic
935607396 2:104984632-104984654 GGGAGGTAATTAAGTCATGAGGG + Intergenic
936257672 2:110930682-110930704 GGGGGCTAATTGAATCATGGGGG + Intronic
938813103 2:134871849-134871871 GGGGGCTATCTGAGTCATGATGG - Intronic
939746124 2:145970564-145970586 GGGAGGTAATTCAATCTTGGGGG - Intergenic
940459540 2:153946674-153946696 GGGGGGTGATTAAGTCATGAAGG - Intronic
940730195 2:157380334-157380356 GGGGTCCAATCCAGTCTTCAGGG - Intergenic
940965604 2:159833762-159833784 GGGAGGTAATTGAATCTTGAGGG + Intronic
941301783 2:163811421-163811443 GGGAGGTAATTCAGTCTGGTTGG + Intergenic
942079785 2:172389177-172389199 GGCGCCTAATTTAGTCTTGGGGG + Intergenic
943235012 2:185306677-185306699 GGGAGGTAATTGAATCTTGAGGG - Intergenic
943266738 2:185740812-185740834 GGGGGATAATTAAGTCATGAGGG - Intronic
948131408 2:235603106-235603128 GGGGGATAATTGAATCATGAGGG + Intronic
948132426 2:235610526-235610548 GGGTGCTAATTCCATCATGAGGG + Intronic
948332124 2:237177930-237177952 GGGGGTTAATTAGGTCATGAGGG + Intergenic
1171873934 20:30553926-30553948 GAGGGCCAATTCTGTCATGAGGG - Intergenic
1173456782 20:43208994-43209016 AGGAGGTAATTCAGTCATGAGGG + Intergenic
1173677974 20:44854402-44854424 GGGGGGTAACTGAGTCATGAGGG + Intergenic
1173906595 20:46634237-46634259 GGGGGCTAATTCAGTCTTGAGGG + Intronic
1176224718 20:63990235-63990257 GGAGGCCACTTGAGTCTTGAGGG - Intronic
1177255123 21:18651912-18651934 GGGAGGTATTTAAGTCTTGAGGG + Intergenic
1179310314 21:40189617-40189639 GGGGGGTAATTGAGTCATGGAGG + Intronic
1185152443 22:49172103-49172125 GGGAGGTAATTGAGTCATGAGGG - Intergenic
950157255 3:10730971-10730993 GGGGGGTAATTAGGTCATGAGGG - Intergenic
951195621 3:19820015-19820037 GGGCACTAATTCAATCATGAGGG - Intergenic
951969910 3:28432057-28432079 GGGAGGTAATTGAGTCATGAGGG - Intronic
953321861 3:41979756-41979778 TGGGGCTAAGTCATTCATGAGGG + Intergenic
956943125 3:74187233-74187255 GGGTTCCAATTCATTCTTGAAGG - Intergenic
961615904 3:128180874-128180896 GGGGGCTAATGAAGTCCTGAAGG + Intronic
963256877 3:143154014-143154036 GGCGGCTGAGTCATTCTTGATGG - Intergenic
963512727 3:146269001-146269023 GGGAGGTAATTAAGTCATGAGGG + Intergenic
970165380 4:13231845-13231867 GGGGGGTAATTGAATCATGAGGG - Intergenic
970628521 4:17916389-17916411 TGGGGCTAAGTCATTCATGAGGG - Intronic
972382013 4:38527774-38527796 GGGGGGTGATTAAGTCATGAGGG + Intergenic
975225475 4:71866309-71866331 GGTAGGTAATTAAGTCTTGAGGG + Intergenic
976305180 4:83552831-83552853 GGGAGGTAATTAAGTCATGAAGG + Intronic
977063929 4:92289447-92289469 GGGAGATAATTCAATCATGAGGG - Intergenic
977605680 4:98983031-98983053 GGGAGGTAATTAAGTCATGAAGG - Intergenic
979851727 4:125579752-125579774 GGGAGCTCATTCATTTTTGATGG + Intergenic
980199188 4:129632970-129632992 GGGGGGTAATTGAATCATGAGGG - Intergenic
981853521 4:149259492-149259514 GGGGGCACATTCATTCTTTAAGG - Intergenic
981916694 4:150041548-150041570 GGGAGGTAATTAAGTCATGAAGG - Intergenic
982115325 4:152094180-152094202 GGGCACTAATCCATTCTTGACGG - Intergenic
983673007 4:170259876-170259898 GGGGGATAAGTCAGTTTTCAGGG + Intergenic
983789781 4:171782644-171782666 GGGAGGTAATTCAGTCATGGGGG - Intergenic
985864229 5:2500888-2500910 GGGCGCTAATCCTGTCATGAGGG + Intergenic
986536393 5:8792478-8792500 GGGAGCTAATCCATTCATGAAGG - Intergenic
987223674 5:15817589-15817611 GGGGGGTAATTGAGTCATGGGGG + Intronic
988412664 5:30907291-30907313 GGGGAATGATTAAGTCTTGAAGG - Intergenic
989196781 5:38724122-38724144 GGGAGCTAATGAAGTCATGAGGG - Intergenic
990959165 5:61375170-61375192 GGGGTCCAATCCAGTCTTCAGGG + Intronic
991166695 5:63571017-63571039 GGGGCTTAATTCAGGCTTGCTGG - Intergenic
992778544 5:80108281-80108303 GAAGGGTAATTCAGTCATGAGGG + Intergenic
993000816 5:82379126-82379148 GGGAGGTAATTTAGTCATGAGGG - Intronic
993237486 5:85331928-85331950 GGGGCCTACTTGAGTCTGGAGGG - Intergenic
994112730 5:96025392-96025414 GGGGGATAATTAGGTCATGAAGG - Intergenic
995931345 5:117449823-117449845 GGCATCTTATTCAGTCTTGATGG + Intergenic
996522763 5:124445690-124445712 TGGGGGAAATTCAATCTTGAGGG - Intergenic
997826095 5:137108242-137108264 GGGGGCTATTTCAGTCTGGTTGG - Intronic
999005034 5:147966563-147966585 GGAGGCTAATACAGTACTGAAGG + Intergenic
999945895 5:156595203-156595225 GAGGGGTAATTAAGTCATGAGGG + Intronic
1001021769 5:168189153-168189175 GGGAGGTAATTAAGTCATGAAGG - Intronic
1002059573 5:176618594-176618616 GGCGGCAAACTCAGTCTTTAGGG + Intergenic
1002436875 5:179236904-179236926 GGGGGGTAATTAGGTCATGAGGG + Intronic
1003538404 6:6996531-6996553 GGGAACTAATTCATTCATGAGGG - Intergenic
1008377267 6:50806412-50806434 GGGAGATAATTGAGTCATGAGGG + Intergenic
1009515215 6:64607555-64607577 GGGAGGTGATTCAGTCATGAGGG - Intronic
1015639348 6:135314208-135314230 GGGAGGTAATTAGGTCTTGAGGG + Intronic
1021604969 7:22400828-22400850 GGTGGTTCTTTCAGTCTTGAAGG - Intergenic
1022245269 7:28553051-28553073 GTGGGCTACTTAGGTCTTGATGG + Intronic
1023539594 7:41251304-41251326 GGGGGCTGATTAGGTCATGAGGG - Intergenic
1024122585 7:46260251-46260273 GGGGCCTGATCCAGTCTGGAAGG - Intergenic
1026629109 7:72022184-72022206 GGAGGAAAATACAGTCTTGAAGG - Intronic
1027521977 7:79220645-79220667 GGGGGCTAAATAAGTCCTGGTGG + Intronic
1027733513 7:81904654-81904676 GGGAGATAATTCAATCATGAGGG - Intergenic
1028117347 7:87014323-87014345 ATTGGCTAATTCAGTCTTCATGG + Intronic
1028265530 7:88719226-88719248 GGGAGGTAATTCAGTCATGGGGG + Intergenic
1028599103 7:92581547-92581569 GGGGTCCAATCCAGTCTTCAGGG - Exonic
1031070249 7:117154152-117154174 GGGAGCTAATTAGGTCATGAGGG + Intronic
1031200856 7:118683409-118683431 GGGAGGTAATTCAATCATGAGGG - Intergenic
1031792114 7:126118948-126118970 GGGAGGTAATTGAGTCTTGGGGG + Intergenic
1032872990 7:136006280-136006302 GGGAGGTAATTGAGTCATGAGGG + Intergenic
1033513236 7:142081601-142081623 GGGGGCAGCTTCAGCCTTGAAGG + Intronic
1033992426 7:147305049-147305071 GGGGGCTAATTAGGTCATGAGGG - Intronic
1035154604 7:156902004-156902026 GGGGGATAATTGAATCATGAGGG + Intergenic
1035706145 8:1676765-1676787 GGGTGTTAATTCATACTTGAGGG - Intronic
1036915853 8:12803090-12803112 TGGGGGTGATTCAGTCATGAGGG - Intergenic
1037677065 8:21060039-21060061 GGGGGATAATTGAATCATGAGGG - Intergenic
1038175915 8:25182267-25182289 GGGGGCTATTTCAGTCATTCAGG - Intergenic
1038181462 8:25232683-25232705 GGGAGGTAATTAAGTCATGAGGG - Intronic
1040542773 8:48374746-48374768 GGGAGGTGATTCAGTCATGAGGG - Intergenic
1042684483 8:71422814-71422836 GGGGGGTAATTTAGTCATGGGGG - Intronic
1042936241 8:74061232-74061254 GGGAGGTAATTAGGTCTTGAAGG + Intergenic
1043305120 8:78784150-78784172 GGGAGGTAATTAAGTCATGAAGG + Intronic
1044018817 8:87078644-87078666 AGGGACTAATAGAGTCTTGATGG + Intronic
1044184957 8:89239991-89240013 GGGGCCTAATTCTCCCTTGAGGG - Intergenic
1044529544 8:93291655-93291677 GGGCGCTAAGTCATTCATGAGGG + Intergenic
1044751526 8:95421043-95421065 TGGGGCTCATTCATGCTTGAAGG + Intergenic
1044885607 8:96773918-96773940 GGGAGATAATTAAGTCATGAGGG - Intronic
1045468863 8:102493409-102493431 GGGGGATAATTAGGTCGTGAGGG + Intergenic
1046226509 8:111286985-111287007 AGGAGATAATTGAGTCTTGAAGG + Intergenic
1046419763 8:113964914-113964936 GGGAGGTAATTAAGTCATGAGGG + Intergenic
1050153323 9:2639343-2639365 GGGAGGTAATTAAGTCATGAGGG - Intronic
1050778575 9:9300562-9300584 GGGAGGTAATTAAGTCATGAAGG + Intronic
1050872949 9:10597962-10597984 GACGGCTAATGCATTCTTGATGG + Intronic
1051371128 9:16360150-16360172 GAGGGATAATTAAGTCATGAGGG - Intergenic
1052733496 9:32316686-32316708 GGGAGATAATTGAGTCATGAGGG - Intergenic
1055599615 9:77901975-77901997 GGGAGGTGATTCAGTCATGAAGG - Intronic
1055728693 9:79258653-79258675 GGGGGGTGATTAAGTCATGAGGG + Intergenic
1056286319 9:85091097-85091119 GGGAGATAATTGAGTCATGAGGG + Intergenic
1058022725 9:100106474-100106496 GTGCGCTAATGCAGTCGTGAGGG - Intronic
1058222090 9:102314789-102314811 GGGAGCTAATTTAGTCATGAGGG + Intergenic
1058955504 9:109943193-109943215 GAGGACCAATTCAGCCTTGATGG - Exonic
1059166011 9:112077154-112077176 TGGGGATAATTCTGTATTGAGGG + Intronic
1059330535 9:113532733-113532755 GGGGGCTGCCTCAGTATTGAGGG + Intronic
1060308825 9:122440804-122440826 GGGGGCTAATTGAATCATGGGGG - Intergenic
1185920829 X:4090290-4090312 GGGTACTAATTCCATCTTGAGGG - Intergenic
1186275004 X:7928879-7928901 GGGAGGTAATTAAGTCATGAGGG + Intergenic
1186673079 X:11787005-11787027 GTGTGCTAATTCACTTTTGACGG - Intergenic
1191089090 X:56601509-56601531 GGGAGGTAATTCAATCATGAGGG - Intergenic
1192184776 X:68939652-68939674 GGGTGCTAATTCAGTCTCCAGGG - Intergenic
1192779163 X:74276820-74276842 GGAGGGTAATGCAGTCTCGAAGG + Intergenic
1194156378 X:90394221-90394243 GGGAGGTAATTCAGACATGAGGG - Intergenic
1194893140 X:99405609-99405631 GGGAGGTAATTCAGTCATGGGGG + Intergenic
1197966128 X:132063953-132063975 GGGACCTAATTAAGTCATGAAGG + Intergenic
1199228528 X:145408494-145408516 TGGAGATAATTCAGTCTTGAGGG + Intergenic
1199484574 X:148333925-148333947 GGGGGCAATTTTACTCTTGAAGG - Intergenic
1199935311 X:152567701-152567723 GGGGGACAATTCAATCTGGAAGG + Intergenic
1200491581 Y:3830421-3830443 GGGAGCTAATTAGGTCATGAGGG - Intergenic
1200502726 Y:3971210-3971232 GGGAGGTAATTCAGACATGAGGG - Intergenic
1201849774 Y:18466582-18466604 GGGGGCTCAGTCAGTCTGGGGGG + Intergenic
1201883544 Y:18853793-18853815 GGGGGCTCAGTCAGTCTGGGGGG - Intergenic
1202345692 Y:23923139-23923161 GGTGCCTAATTCAGTGTTCATGG - Intergenic
1202525079 Y:25746951-25746973 GGTGCCTAATTCAGTGTTCATGG + Intergenic