ID: 1173910786

View in Genome Browser
Species Human (GRCh38)
Location 20:46668920-46668942
Sequence ACTGTTCAGTAGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173910784_1173910786 -7 Left 1173910784 20:46668904-46668926 CCTATTGTTGAGATATACTGTTC 0: 1
1: 0
2: 13
3: 116
4: 598
Right 1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173910786 Original CRISPR ACTGTTCAGTAGACTGTGGA AGG Intronic
No off target data available for this crispr