ID: 1173910905

View in Genome Browser
Species Human (GRCh38)
Location 20:46670100-46670122
Sequence CACCCATATGTAGCTTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173910897_1173910905 23 Left 1173910897 20:46670054-46670076 CCTAGAAGGTGCACTGGGAGGCT 0: 1
1: 0
2: 1
3: 21
4: 239
Right 1173910905 20:46670100-46670122 CACCCATATGTAGCTTCCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173910905 Original CRISPR CACCCATATGTAGCTTCCTT TGG Intronic
900542362 1:3209552-3209574 CACCCACAGGGAGCTTCCTTTGG - Intronic
905792157 1:40795661-40795683 CCCCCATATGTCTCTTCCTCAGG - Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918474502 1:184908827-184908849 AGCCAATCTGTAGCTTCCTTGGG - Intronic
920991533 1:210944434-210944456 CACCCCTTGGCAGCTTCCTTTGG - Intronic
921006150 1:211095452-211095474 ATCCCTTATGTAGCTCCCTTAGG + Intronic
922988588 1:229886061-229886083 CAAGCACATGTTGCTTCCTTGGG - Intergenic
923796503 1:237162185-237162207 AAGCCATAGGTAGCTTCCTCTGG + Intronic
1064331116 10:14395073-14395095 CACCCAAAGGTGTCTTCCTTTGG + Intronic
1065009112 10:21405779-21405801 CACCCAAATGTTGCTTTTTTTGG + Intergenic
1066844164 10:39977621-39977643 CACCGATTTGAACCTTCCTTTGG + Intergenic
1066847912 10:40051287-40051309 CACCGATTTGAACCTTCCTTTGG + Intergenic
1066882760 10:40742343-40742365 CACAGATTTGTACCTTCCTTTGG + Intergenic
1066905909 10:41199214-41199236 CACCGATTTGAACCTTCCTTTGG + Intergenic
1066917223 10:41421029-41421051 CACCGATTTGAACCTTCCTTTGG + Intergenic
1068889911 10:62138026-62138048 CACCCATATGCATCTTCATTTGG + Intergenic
1072518079 10:96206061-96206083 CTCCCATATCTTGCTTCCCTAGG - Intronic
1077890043 11:6411994-6412016 CACCAAGATGTAGCTTCATCTGG - Intronic
1078645191 11:13135643-13135665 CTCATATCTGTAGCTTCCTTGGG - Intergenic
1081129883 11:39365886-39365908 CATCCATAAGTAGCTTACTGTGG + Intergenic
1085667207 11:78425015-78425037 CACCCAGATGTATCTTCCGGAGG + Intergenic
1086989185 11:93284287-93284309 CACTCATCTGTAGATTCTTTTGG + Intergenic
1092487252 12:8913852-8913874 CAACCTAATGTAACTTCCTTTGG - Intergenic
1095421157 12:42025219-42025241 TACCCAGAGGCAGCTTCCTTTGG + Intergenic
1096943588 12:55377551-55377573 CACCCATGTATTTCTTCCTTCGG - Intergenic
1098139273 12:67435101-67435123 CACCCATTTTTAGCTTCCCAAGG + Intergenic
1106370341 13:29126713-29126735 GTCCAATATGTAGCTTCCCTGGG - Intronic
1107790406 13:43996413-43996435 GTCACATATGTAGCTTGCTTTGG - Intergenic
1112647635 13:101353400-101353422 CACTCTTATTTAGCTTCCTCTGG + Intronic
1112893262 13:104265210-104265232 CACCCACATGTAGCCTCTCTTGG + Intergenic
1118241405 14:64062561-64062583 AACCCATATGCAGGTCCCTTTGG + Intronic
1118946007 14:70388101-70388123 CACTAATGTGTATCTTCCTTTGG - Intronic
1128207842 15:65869136-65869158 CACGCATGTGTAGCTGCCTTCGG + Intronic
1128529558 15:68434506-68434528 CACTCATATGCTGCTGCCTTGGG - Intergenic
1128874135 15:71188352-71188374 CACCTAGATGGAGCTTCCTCTGG + Intronic
1129096270 15:73211791-73211813 GAACCCTATATAGCTTCCTTGGG - Intronic
1138085682 16:54131862-54131884 AACCCATCTGTAGCTTCCCCAGG - Intergenic
1149746341 17:59102835-59102857 AAGGCATATGTATCTTCCTTAGG + Intronic
1157556028 18:48613410-48613432 CAGCACTCTGTAGCTTCCTTAGG - Intronic
1159162969 18:64668203-64668225 CACTCATCTGTAGCTTCCTGGGG - Intergenic
1159316538 18:66781932-66781954 CACTTATATTTAGTTTCCTTTGG - Intergenic
1160110971 18:76030238-76030260 AACCCAAATGTGGCTTCCATAGG + Intergenic
1163304717 19:16470932-16470954 CACCCATCAGTTGCTTCCTTTGG - Intronic
1164820000 19:31242545-31242567 CACCCATCTGCTGCTGCCTTTGG - Intergenic
925787433 2:7446589-7446611 CACCCTTCTGTAGATTCCATGGG + Intergenic
929896221 2:45963060-45963082 CACCTATATGAAGCTTCCTAAGG + Intronic
932214885 2:69960351-69960373 CAAGCATTTCTAGCTTCCTTGGG + Exonic
932400809 2:71479819-71479841 CAGCCACATAGAGCTTCCTTGGG + Intronic
933778819 2:85787649-85787671 GACCCATAGGTAGCTGCCCTGGG - Exonic
934041510 2:88131015-88131037 CACCCATCAGTTGCTTCGTTTGG + Intergenic
936377873 2:111957790-111957812 CTTCCATTTGTTGCTTCCTTTGG + Intronic
943539898 2:189199788-189199810 TACACTTATGTTGCTTCCTTTGG - Intergenic
944916702 2:204368337-204368359 GACCCAGATGAGGCTTCCTTCGG - Intergenic
947264275 2:228259839-228259861 CAACCCTATGTAACTTACTTGGG - Intergenic
1169216369 20:3796741-3796763 CCCCCATATGCAGCCTCCTTGGG - Intronic
1172195928 20:33091468-33091490 CACACATATGTACTTTCCCTAGG + Intronic
1173218664 20:41112746-41112768 AACCCAAATGTAGATTACTTTGG - Intronic
1173910905 20:46670100-46670122 CACCCATATGTAGCTTCCTTTGG + Intronic
1176628103 21:9111986-9112008 GACCTACATGTAGGTTCCTTGGG + Intergenic
1181848192 22:25730089-25730111 CCCCCATATCCAGCTTCCCTCGG - Intergenic
1184417868 22:44362696-44362718 CAAAAATATCTAGCTTCCTTAGG - Intergenic
949912144 3:8920447-8920469 CCCCTATATTTAGCATCCTTTGG - Intronic
952769717 3:36987401-36987423 CCTCTATATGTAGGTTCCTTTGG + Intergenic
955260511 3:57384770-57384792 TACCCATATTCAGCTTCCCTTGG + Intronic
955471376 3:59290023-59290045 CACCCATATTTAGCATCCCTGGG - Intergenic
957387608 3:79517717-79517739 CACCTATAATTAGCTACCTTGGG - Intronic
959876852 3:111393241-111393263 AGCCCATATGTTGCTTACTTTGG + Intronic
963960653 3:151305374-151305396 CACCCATTGGTATTTTCCTTTGG + Intronic
967079272 3:186033964-186033986 CATCCATGTGTAGCTTTCTTTGG + Intergenic
968425706 4:521932-521954 CAGCCGTACGTACCTTCCTTGGG - Exonic
969448110 4:7256922-7256944 CACCCATTCCTAGCATCCTTTGG + Intronic
974067360 4:57091350-57091372 CACTCAATTTTAGCTTCCTTTGG + Intronic
974178304 4:58353442-58353464 TTCCCATCTTTAGCTTCCTTAGG - Intergenic
974856419 4:67466392-67466414 CACCCACATGAAGCTCCCATGGG - Intergenic
979777390 4:124607724-124607746 CACTTATACGTAGCTTCCTTAGG - Intergenic
981169233 4:141602907-141602929 CACCCATATGTATTTTTTTTTGG + Intergenic
988168174 5:27620664-27620686 CACCCATAGGTAGCAGCCTAAGG + Intergenic
990970661 5:61502355-61502377 CAACCATTTCTAACTTCCTTGGG - Intronic
995750785 5:115451504-115451526 CACCCCTATGAAGCTGCATTTGG - Intergenic
996379609 5:122849670-122849692 CACCCAAATGTTACTTCCTGGGG + Intronic
998467016 5:142354714-142354736 AATACATATGTAGCTTACTTAGG + Intergenic
1008741920 6:54619331-54619353 AATCACTATGTAGCTTCCTTTGG + Intergenic
1009324137 6:62329074-62329096 CAGCCAGATGTAGCTTCATAAGG + Intergenic
1011928628 6:92680680-92680702 TACACATATGTAACTACCTTAGG - Intergenic
1013822048 6:114166156-114166178 CACCTAAAGGTAGTTTCCTTAGG + Intronic
1014259270 6:119197469-119197491 CATCCATATGCATCTTCCTAAGG - Intronic
1018633638 6:165841728-165841750 AAGACATATGTAGCTTTCTTAGG - Intronic
1028654751 7:93191954-93191976 TACCCAGATGTGGATTCCTTGGG + Intronic
1030255079 7:107500699-107500721 CATCAGTATGTATCTTCCTTTGG + Intronic
1031213922 7:118866218-118866240 CACCCATTAATATCTTCCTTTGG - Intergenic
1031957704 7:127959014-127959036 CACACAAATGTAGCTTCCAATGG - Intronic
1051608615 9:18940334-18940356 CCCCCATAGATAGCTACCTTTGG - Intronic
1051756533 9:20406907-20406929 CACCCCTAAGCAGCTTCCTTAGG - Intronic
1053082159 9:35185361-35185383 CAGCTCTGTGTAGCTTCCTTTGG + Intronic
1056613859 9:88144830-88144852 CAACCATATGTATATTACTTAGG + Intergenic
1057557502 9:96099582-96099604 GACCCCTATGTAGCTTTATTGGG - Intergenic
1062343618 9:136104732-136104754 CACCCAGATGCTGCTTTCTTGGG - Intergenic
1203750946 Un_GL000218v1:79666-79688 GACCTACATGTAGGTTCCTTGGG + Intergenic
1189767224 X:44384208-44384230 CATTCATATGTTGCTTCCTGGGG + Intergenic
1190842656 X:54160192-54160214 CATCCATATGTACCTACCTAAGG - Intronic
1194342535 X:92722313-92722335 GACCCATTTGTAGCTCCCTCAGG - Intergenic
1196500248 X:116372604-116372626 CACCCATTTGTACCTACCTGTGG + Intergenic
1196907607 X:120452872-120452894 AACCCATATGTAGATCCCTGTGG - Intronic
1200650898 Y:5839002-5839024 GACCCATTTGTAGCTCCCTCAGG - Intergenic