ID: 1173911099

View in Genome Browser
Species Human (GRCh38)
Location 20:46671569-46671591
Sequence GTGGGTTCTCTAGGAAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173911099 Original CRISPR GTGGGTTCTCTAGGAAACAG GGG Intronic
902289412 1:15426831-15426853 GTAGGTTCACTGGGCAACAGCGG + Intronic
904079558 1:27863421-27863443 GTGGGGTTGCCAGGAAACAGTGG - Intergenic
904600912 1:31672261-31672283 GTGGCTTCTCTGGGATACACAGG - Intronic
905882802 1:41475426-41475448 GGGGGTGCTCTAGGAAGCAGAGG - Intergenic
914431392 1:147622948-147622970 AAGGCTTGTCTAGGAAACAGGGG - Intronic
915436933 1:155914111-155914133 GATGGCTCCCTAGGAAACAGTGG - Exonic
917166471 1:172118221-172118243 GTGGGTTCTCTATGAAGGATTGG + Intronic
917813168 1:178680389-178680411 GTGGGTCCTCTAGGGATGAGGGG - Intergenic
923143188 1:231178922-231178944 TTGGGCTCTCTAGGACACAAGGG - Intronic
923715667 1:236422935-236422957 CTGGGCTCTCTTGGAAATAGAGG - Intronic
1067126176 10:43517611-43517633 CTGGGGTCTCTTGGAAATAGAGG + Intergenic
1067552736 10:47246804-47246826 CTGGGTTCTCTGGGCAGCAGAGG + Intergenic
1068950147 10:62768792-62768814 GTGGGTGCTGTAGCATACAGTGG - Intergenic
1070589263 10:77789943-77789965 GTGGGCTGTCAAGGAGACAGAGG + Intergenic
1071252649 10:83836812-83836834 GTGGTTTCTTTAAGAACCAGGGG - Intergenic
1073603615 10:104871081-104871103 GTGGTTCCTCTGGGAAGCAGGGG - Intronic
1077798931 11:5518842-5518864 GTGGGTTCTCTATGCCACTGAGG - Intronic
1081634362 11:44711153-44711175 GTGGGTTCTCCAGGGTAGAGAGG + Intergenic
1081961043 11:47137773-47137795 CAGGTTTCTCTAGGAAGCAGTGG - Intronic
1082690623 11:56299246-56299268 GAGGGTTATCTGGGAAACAGTGG - Intergenic
1083248505 11:61449279-61449301 GAGGGTTCACTGGGAAACTGAGG - Intronic
1084735817 11:71104630-71104652 GTGGGTGCTCTCAGAAACAAAGG - Intronic
1085177729 11:74505548-74505570 CTGGGCTCTGAAGGAAACAGAGG + Intronic
1089655266 11:119942482-119942504 GTGTCTTCTCCAAGAAACAGTGG - Intergenic
1089846575 11:121463386-121463408 GTGGGTTCACCAGGACAGAGTGG + Intronic
1090499212 11:127245247-127245269 GTGGGTCCACAAGGAATCAGAGG + Intergenic
1092117695 12:6021101-6021123 GTGAGTTTTCTAGCAAACACAGG - Intronic
1094638294 12:32248121-32248143 GTGACTGCTCTAGGAGACAGAGG - Intronic
1094841856 12:34345618-34345640 GTGGGTTGCCTGGGAAACTGGGG - Intergenic
1101869235 12:108549451-108549473 TTGGGTTCTCTTGGAAATAAAGG + Intronic
1106069933 13:26400515-26400537 GTGGGTCTTCTAAGAAATAGGGG - Exonic
1110681804 13:78322520-78322542 GTGGGTTCAGGAGGAAACAATGG + Intergenic
1119635268 14:76268220-76268242 GTGGGACCTCTAGAAAACAGCGG - Intergenic
1119887874 14:78158885-78158907 GGGGGTTCTAAAGGAAGCAGAGG + Intergenic
1119903960 14:78284860-78284882 GTGGGTTCTCTACAAAATATTGG - Intronic
1121498123 14:94411707-94411729 GTGGGTGCCAGAGGAAACAGTGG + Intergenic
1121788345 14:96679942-96679964 GTGGATTCTCTGGGCAACTGAGG + Intergenic
1123580968 15:21714698-21714720 GTGGCTTCTCTATGGGACAGGGG - Intergenic
1123617617 15:22157321-22157343 GTGGCTTCTCTATGGGACAGGGG - Intergenic
1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG + Intronic
1127285774 15:57532371-57532393 GTGAGATCACGAGGAAACAGAGG - Intronic
1131301367 15:91202616-91202638 CTGGGTTCCCTGGGAAGCAGAGG + Intronic
1131518446 15:93095248-93095270 CTGGGTTCTCCTGCAAACAGAGG - Intergenic
1136248627 16:28989456-28989478 GGGGGTTCTCTGGGAACCTGTGG + Intronic
1137538042 16:49342368-49342390 GTGCCTTCTCTGGGAGACAGCGG + Intergenic
1140237663 16:73173607-73173629 CTGGGTTTTATAGGGAACAGGGG - Intergenic
1142504027 17:351427-351449 GTGAGTCCTGTAGGGAACAGAGG - Intronic
1146362921 17:32193460-32193482 GTTGGATCTCAAGGATACAGAGG + Intronic
1149761284 17:59232823-59232845 GTGGGTTCTCTAGGAGTGAGGGG - Intronic
1149982561 17:61322887-61322909 GGGGGTCCTCTGGGAGACAGGGG + Intronic
1151071774 17:71221964-71221986 TTGGATTTTATAGGAAACAGGGG - Intergenic
1151228688 17:72666193-72666215 GTGGGTTCTCTAGATTCCAGGGG + Intronic
1152573017 17:81128727-81128749 GTGGCTTTTCTGGGAAGCAGCGG - Intronic
1152690752 17:81716705-81716727 GGGGGTTCTCGAGGAAGCAGAGG - Intronic
1153773438 18:8433354-8433376 GTGCGGTCTCCAGGAAGCAGAGG + Intergenic
1155368336 18:25071807-25071829 CAGGGTGCTCTAGGACACAGAGG + Intronic
1156061874 18:33087533-33087555 GTGTGTTTTCTAAGAAACAGGGG + Intronic
1157385790 18:47259406-47259428 TTGGCTTCTCTAGGAAACACTGG - Intergenic
1158250622 18:55483291-55483313 GTAGTTTCTCTAGCTAACAGTGG - Intronic
1158856626 18:61549426-61549448 GCAGGTTCTTTAGGAAACACAGG + Intronic
1159473874 18:68891964-68891986 GTGGGTTCTATGGGAGAAAGTGG + Intronic
1162249182 19:9428163-9428185 CTGGGCTCTCCTGGAAACAGAGG + Intronic
1164561779 19:29297405-29297427 GTGGGCTCTCAAGCAAGCAGTGG - Intergenic
1164695086 19:30237408-30237430 CTTGTTTCTCTAGGAATCAGAGG + Intronic
1166020211 19:40021663-40021685 GTAGGTTCTTGAGGAAACATAGG - Intergenic
1166855411 19:45780709-45780731 GTGGGTTCTGGAGGAAAGAGAGG + Intronic
1168027484 19:53653222-53653244 CTGTGTTCTATAAGAAACAGAGG - Intergenic
927713250 2:25338655-25338677 TTGTGATCTCCAGGAAACAGGGG - Intronic
928359364 2:30650191-30650213 GTGTGGTCTCCAGGAGACAGGGG - Intergenic
929212377 2:39371434-39371456 TTAGGTTCTCCAGGAAAGAGTGG + Intronic
934032104 2:88057167-88057189 GTGATTTCTTTGGGAAACAGGGG - Intergenic
934631306 2:95926625-95926647 TTGGCTGCTTTAGGAAACAGTGG - Intronic
934802733 2:97182356-97182378 TTGGCTGCTTTAGGAAACAGTGG + Intronic
934833468 2:97558211-97558233 TTGGCTGCTTTAGGAAACAGTGG - Intronic
936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG + Intergenic
936680427 2:114763855-114763877 GAGTAATCTCTAGGAAACAGAGG - Intronic
944380717 2:199107301-199107323 GTGGGTGGTAGAGGAAACAGTGG - Intergenic
944609597 2:201388655-201388677 GTGGGTACTCTGGGATACTGGGG + Intronic
947130111 2:226913758-226913780 GTGGGATCTGTATGAAACATTGG + Intronic
947812478 2:233013187-233013209 GTGGGCTCTCTGGGACAGAGTGG - Exonic
1168859754 20:1037404-1037426 ATGGGTTCTCGGGGAAAGAGTGG + Intergenic
1170815343 20:19709112-19709134 GTGGGAGCTCTGGGAAACAGAGG + Intronic
1170923590 20:20702277-20702299 GTGGGTTCTCTGAGAAGTAGAGG + Intronic
1171059791 20:21945204-21945226 GTAGGTTCTCTTGAAAACAGAGG + Intergenic
1171530391 20:25849365-25849387 GTGGGTGGTGTAGGAAGCAGGGG - Intronic
1172030749 20:31980437-31980459 ATGGGTTCTCTAGGAAACATTGG - Intronic
1173911099 20:46671569-46671591 GTGGGTTCTCTAGGAAACAGGGG + Intronic
1174083861 20:47990733-47990755 ATGGGTGCTCAAGGAGACAGTGG - Intergenic
1174622441 20:51886179-51886201 GTGGGCTCTCAAGGAACAAGTGG + Intergenic
1176153619 20:63606871-63606893 GTGGGCTCTCTAGGGGAAAGTGG - Intronic
1177019437 21:15835705-15835727 GTGGGTTATTTAGAAAGCAGTGG + Intronic
1179426619 21:41284522-41284544 GTGGTTTCTGTAGGAAAGAAGGG - Intergenic
1180569134 22:16699514-16699536 GTGAGTTTTCTAGCAAACACAGG - Intergenic
1181759640 22:25049306-25049328 GTGGCTTCTCCAGGGAACCGAGG - Exonic
1183485203 22:38084648-38084670 GTGGGTTTCCTAGGAAGTAGCGG - Intergenic
952887512 3:38020668-38020690 GCTGGTCCTCTAGGAACCAGGGG - Intronic
953588263 3:44225392-44225414 CTTGGTTCTCAAGGATACAGGGG - Intergenic
955715266 3:61822944-61822966 GTGTGTTTTCTGGGAAAGAGAGG + Intronic
959305666 3:104662564-104662586 GTTGGTTCTCTAGCAAAAAAAGG + Intergenic
962492220 3:135905487-135905509 GTGGCTTTTCTAGGAGAGAGAGG - Intergenic
967790959 3:193548574-193548596 GTGGGTTCACTAGTTAACATTGG + Intronic
968756208 4:2417756-2417778 GTGGGTTCTCTCAGAACCTGGGG + Intronic
971765275 4:30822788-30822810 ATGGGTTCTTTAGAAAACAGAGG - Intronic
973805441 4:54521678-54521700 GTCGGTTTTCAAGGAAACAGGGG - Intergenic
979351216 4:119646426-119646448 GTGGGTGCTCCAGGAAACCAGGG - Intergenic
979523131 4:121691032-121691054 GTGGGGACTCCAGGAAACAGGGG - Intronic
981821006 4:148887626-148887648 GTGGGGTTTCTAGGACAGAGAGG + Intergenic
983485187 4:168324248-168324270 CTGGGCTCTCTTGAAAACAGAGG - Intergenic
986350049 5:6868783-6868805 GTGAGTTCTCTAAGAAACAGTGG - Intergenic
986962241 5:13228983-13229005 GTGTGTACTCTAGAAAACAGGGG + Intergenic
989417931 5:41202195-41202217 GTGAATTCTCCAGGTAACAGAGG + Intronic
989564689 5:42890261-42890283 GCAGGTTCTCTAGAAAGCAGAGG - Intergenic
990051806 5:51511435-51511457 TTGGCTTCCCTGGGAAACAGTGG - Intergenic
992179214 5:74180476-74180498 GTGGGTTCTCCAGGCATGAGGGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
1001516394 5:172358293-172358315 GAAGGTTCTCTGGGAAACAACGG + Intronic
1001585427 5:172830985-172831007 GTGGGCTCTCTTGGAAGTAGCGG - Intergenic
1001646152 5:173283834-173283856 GAGAGTGCTCTAGGAAACACTGG - Intergenic
1001650028 5:173309692-173309714 TAGGGTCCTCTAGGAAGCAGAGG - Intergenic
1002075311 5:176705042-176705064 GTGGCTTCTCTAGGAAACACAGG - Intergenic
1002535976 5:179875802-179875824 GTGGGTTCCCTAGGAGTTAGAGG - Intronic
1003076135 6:2985200-2985222 GGGGGTGCTCTGGGAGACAGAGG + Intergenic
1005987115 6:30882355-30882377 GGGGGTTCTCAGGGACACAGGGG + Intronic
1006131993 6:31875098-31875120 GTGGCTTCTCAAGAATACAGTGG + Intronic
1007253044 6:40509529-40509551 GTGGGTATTCTAGGGAACACTGG + Intronic
1007525016 6:42484403-42484425 GTGGGTGCTGTAGGCATCAGTGG - Intergenic
1011863300 6:91787706-91787728 GTGGGATGTCTAGTAAACTGTGG + Intergenic
1012181927 6:96164913-96164935 GTGGTTTCTGTATGAGACAGTGG + Intronic
1013530974 6:111018311-111018333 GTGTATTCTTTAGGAAACTGTGG - Intronic
1018231181 6:161677165-161677187 GTGAGTTATCCAGGAAACAGGGG + Intronic
1026342710 7:69447924-69447946 GTGGGTGCTTTAGGAGTCAGGGG - Intergenic
1026883343 7:73921136-73921158 GTGTGTTATCTAGAAGACAGAGG + Intergenic
1029144071 7:98433506-98433528 GTGGGTGCTCCAGGCAACTGTGG - Intergenic
1029599905 7:101557592-101557614 GGGGCATCTTTAGGAAACAGCGG - Exonic
1034515244 7:151571937-151571959 GAGGGTGCTCAAGGAAACACTGG - Intronic
1036085701 8:5610683-5610705 TTTGCTTCTCCAGGAAACAGAGG + Intergenic
1037260770 8:17005219-17005241 GTGTGGTCTCTAGGAAGCATAGG - Intergenic
1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG + Intergenic
1041538045 8:58950669-58950691 GTGGGATTTCTAGGAAAGAGTGG + Intronic
1042078124 8:65018403-65018425 GTGGGTTCATTTGCAAACAGAGG + Intergenic
1049129678 8:140827275-140827297 CTAGGCTGTCTAGGAAACAGAGG - Intronic
1049216534 8:141410867-141410889 GTGGGTTCTCTGGGGTCCAGGGG - Intronic
1049340533 8:142109922-142109944 GTGGTTTCCCTGGGAAACCGGGG + Intergenic
1050186791 9:2983168-2983190 GGGGGATCACTAGGCAACAGTGG - Intergenic
1051322906 9:15928854-15928876 GTTGTTTGTATAGGAAACAGGGG + Intronic
1056113322 9:83417941-83417963 GTAACTTCTCTAGGAAGCAGTGG - Intronic
1057666362 9:97048647-97048669 GGGGACTCTCTAAGAAACAGAGG - Intergenic
1058456664 9:105143888-105143910 GTTGCTTCTCTAGGGAACAAAGG - Intergenic
1060722892 9:125990119-125990141 GTGGGATCTCTAGGAAATGCTGG + Intergenic
1186298031 X:8170035-8170057 GTCGGTGCTCTCGGAGACAGGGG + Exonic
1190650046 X:52560258-52560280 ATGGGTTCTCTAAGAAAAACAGG - Intergenic
1197161370 X:123326497-123326519 GTCAGTTGTCTATGAAACAGAGG - Intronic
1198037840 X:132819559-132819581 GTTGGATCTCTAGGAAGCATGGG - Intronic