ID: 1173912454

View in Genome Browser
Species Human (GRCh38)
Location 20:46680471-46680493
Sequence GCACCTATTGCCCCAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173912449_1173912454 -5 Left 1173912449 20:46680453-46680475 CCCAGATCCCTTAAGGAAGCACC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1173912454 20:46680471-46680493 GCACCTATTGCCCCAGAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
1173912450_1173912454 -6 Left 1173912450 20:46680454-46680476 CCAGATCCCTTAAGGAAGCACCT 0: 1
1: 1
2: 0
3: 10
4: 136
Right 1173912454 20:46680471-46680493 GCACCTATTGCCCCAGAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173912454 Original CRISPR GCACCTATTGCCCCAGAGGC AGG Intronic
900653447 1:3742753-3742775 GCTCCTATGGCCACCGAGGCTGG - Intergenic
901082424 1:6591168-6591190 GGACCCATTGCTGCAGAGGCTGG + Exonic
901711003 1:11115131-11115153 CCACCTGTTGCCCAAGAGCCTGG - Intronic
906674922 1:47686780-47686802 GCACCTCCTTCCCCAAAGGCAGG + Intergenic
907436508 1:54452768-54452790 GCACCTGTTGTCCCAGCTGCTGG + Intergenic
908530196 1:65026838-65026860 GCACCTCTGGAGCCAGAGGCAGG + Intergenic
913153230 1:116066507-116066529 GCACATATTTCTGCAGAGGCGGG - Exonic
917065488 1:171088017-171088039 GCCACTATTGCCCCAGGGGCAGG - Intergenic
1062768141 10:80765-80787 GCTCAGGTTGCCCCAGAGGCTGG + Intergenic
1062793561 10:325136-325158 GCACCTGTAGTCCCAGATGCTGG + Intronic
1063399141 10:5725051-5725073 ACTACTATTGCCCCAGAGGGTGG + Intronic
1065125823 10:22573155-22573177 GCACTTATTGCCTCACAGGAAGG + Intronic
1067894235 10:50162246-50162268 GCTCATATGGCCCCAGTGGCAGG - Intergenic
1067954606 10:50778015-50778037 GCTCATATGGCCCCAGTGGCAGG + Intronic
1069739126 10:70676263-70676285 GCACCTATAGCCCCAGCTCCTGG - Intronic
1070444569 10:76483571-76483593 GCCCCTATTGCCCCAGAACCAGG - Intronic
1074883886 10:117679772-117679794 GCCACCATTTCCCCAGAGGCTGG - Intergenic
1076179953 10:128399404-128399426 GTACCCAGTGCCCCATAGGCAGG - Intergenic
1077162052 11:1118208-1118230 GCACCACCTGCCCCAGAGGCGGG - Intergenic
1083946252 11:65924717-65924739 GGACCTGGGGCCCCAGAGGCTGG + Intergenic
1090357238 11:126148093-126148115 GACCCCATGGCCCCAGAGGCAGG - Intergenic
1090386942 11:126362917-126362939 GCACCTCTCTCCCCACAGGCAGG + Intronic
1092083773 12:5739041-5739063 CCACCTCTTTCCCCAGAGGAGGG + Intronic
1094091233 12:26652547-26652569 GCTCTTATTGCCCCAGCTGCTGG + Intronic
1102608416 12:114089102-114089124 CCACCTATTGACCCACATGCTGG + Intergenic
1104764254 12:131316161-131316183 GCAGCTATTCCCCCAGTGCCTGG - Intergenic
1106230491 13:27817498-27817520 GCAGCTATTCCCCAAGATGCTGG + Intergenic
1107594422 13:41947806-41947828 GCACCTATAGTCCCAGCTGCTGG + Intronic
1109488268 13:63057216-63057238 GCACATCTTCCCACAGAGGCAGG - Intergenic
1111403547 13:87771557-87771579 GCACCTGCTGCTCCTGAGGCTGG + Intergenic
1113734159 13:112665168-112665190 GCACCTGCTGCAGCAGAGGCAGG - Intronic
1115582103 14:34771117-34771139 GCAACTGTAGTCCCAGAGGCTGG - Intronic
1118634700 14:67737047-67737069 GCACTTATTCTCCCAGATGCTGG - Intronic
1122599744 14:102915362-102915384 GCTCCTCTTGACCCGGAGGCCGG + Intergenic
1122703931 14:103608397-103608419 GCACCTCTACCCCCAGAGGCAGG - Intronic
1123714083 15:23013846-23013868 GCAGCTACTGGCCCAGAGGAGGG - Intronic
1124909570 15:33905696-33905718 GCACCTGTGGTCCCAGAGGGAGG + Intronic
1125604789 15:40933897-40933919 GCACCTGTAGCCCCAGCTGCTGG + Intronic
1125671720 15:41478272-41478294 GCACCTATAGTCCCAGCTGCTGG + Intronic
1125729084 15:41882734-41882756 GCCCCTATTGTCCCTCAGGCGGG - Exonic
1125760873 15:42094639-42094661 GCCCCTCTTCCCCAAGAGGCTGG + Intergenic
1127991776 15:64124378-64124400 GCACCTGTAGCCCCAGCTGCTGG + Intronic
1128114894 15:65099185-65099207 GGACTTACTGCCCCAGATGCTGG + Intronic
1128386988 15:67156780-67156802 GCAGCTACTGCCCCATAGGCTGG - Intronic
1129461476 15:75702124-75702146 GCTCCCATTGCCCCAGGGTCAGG + Intronic
1130973955 15:88758621-88758643 GCATCTTTTGCCTCAGAGGAGGG + Intergenic
1131853084 15:96563561-96563583 GCCCCTTTAGCCCCAGAGGTTGG + Intergenic
1134589128 16:15437829-15437851 GCGCCTATTGTCCCAGCTGCCGG + Intronic
1135822547 16:25696842-25696864 GCACCAATTGCCACAATGGCAGG - Intronic
1141804881 16:86335961-86335983 GCAGCCACTGGCCCAGAGGCCGG - Intergenic
1142672460 17:1493429-1493451 GCACCGACAGCCCCATAGGCAGG + Intergenic
1142978473 17:3658614-3658636 GCACATCTTGCCCCACAGCCTGG + Intronic
1143543855 17:7585063-7585085 GCACCCATTGGCCCAGAGAAGGG + Intronic
1145354539 17:22129973-22129995 GCACATCTTCCCACAGAGGCAGG + Intergenic
1147856272 17:43482856-43482878 GAACTTATTCCCCCAGGGGCTGG - Intergenic
1148421373 17:47550059-47550081 GCGCCTATAGCCCCAGATGCTGG - Intronic
1149890900 17:60389888-60389910 GCACCTATAGTCCCAGCTGCTGG + Intronic
1150138363 17:62708370-62708392 GCACCTGTAGCCCCAGCTGCTGG - Intronic
1151793689 17:76327524-76327546 GCACCTATAGCCCCAGCCACTGG + Intronic
1152718745 17:81912186-81912208 CCACCTCTTGACACAGAGGCCGG + Exonic
1157052350 18:44181274-44181296 CCACATATTGCCCCAGTGGGAGG + Intergenic
1157454173 18:47811341-47811363 GCACCTATAGTCCCAGCTGCTGG + Exonic
1157576122 18:48744947-48744969 GCACCTATAGTCCCAGCTGCTGG - Intronic
1162026024 19:7894639-7894661 GTACCTACTTCCCCAGAGGCTGG - Intronic
1165279892 19:34786817-34786839 GCACCTAGGGCCTCAGAGGCAGG - Intergenic
1166061065 19:40326096-40326118 GCACCTCTTCCCCAAGGGGCAGG - Intronic
1166538264 19:43589627-43589649 GCACCTATTGTTCTAGATGCTGG + Exonic
1168045650 19:53792441-53792463 GCACCTATAGTCCCAGCTGCTGG - Intergenic
926106928 2:10158427-10158449 TCACCTAATCTCCCAGAGGCAGG - Intronic
927728742 2:25450929-25450951 GCACCTGTAGTCCCAGATGCTGG - Intronic
928089052 2:28363120-28363142 GCAGCAAGTGCCCCAGGGGCAGG + Intergenic
930093170 2:47546528-47546550 GCACCTATAGTCCCAGATACTGG + Intronic
930858190 2:56041564-56041586 GCACTTATTTGCCCAGTGGCAGG + Intergenic
934502371 2:94870850-94870872 GCACCTAGTGCCTGAGAGCCAGG - Intergenic
935138568 2:100330649-100330671 GCACCTATACCCCCAGCTGCAGG - Intergenic
945813100 2:214571911-214571933 GCACCTGTTGTCCCAGATACTGG - Intronic
946329748 2:219002439-219002461 GCTCCGAGTGCCCAAGAGGCTGG - Intergenic
947968519 2:234302391-234302413 GGACCAAGCGCCCCAGAGGCTGG + Intergenic
1169340747 20:4794580-4794602 GCACCTATAGTCCCAGCTGCTGG + Intronic
1171484878 20:25479403-25479425 TCACCTATCCCCCCTGAGGCAGG + Intronic
1172004203 20:31806663-31806685 GCTCCTATTTCTGCAGAGGCAGG + Intergenic
1172760866 20:37320656-37320678 ACGCCTATAACCCCAGAGGCCGG - Intergenic
1173912454 20:46680471-46680493 GCACCTATTGCCCCAGAGGCAGG + Intronic
1179947339 21:44687171-44687193 GCACGCGTTTCCCCAGAGGCTGG + Intronic
1184271646 22:43387861-43387883 GCAGCTCTTTCCCCAAAGGCTGG - Intergenic
1184346728 22:43918178-43918200 GCATCTATGGCCACAGAGCCGGG - Intergenic
1185294492 22:50046572-50046594 GCACCTAATACCCCAGGGTCAGG - Intronic
950058255 3:10046178-10046200 GCACCTATAGTCCCAGCTGCTGG - Intronic
952577217 3:34789965-34789987 GCCCCTATTGTCCCAGAATCAGG + Intergenic
954149115 3:48648418-48648440 GCACTGCTTGCCCCAGAGACAGG - Exonic
954664941 3:52246584-52246606 GGAGCTGTTGCCCCAGAGGGAGG + Intronic
958667643 3:97160949-97160971 GCACCTATGGCCTCATGGGCAGG - Intronic
959380121 3:105631526-105631548 GCACCTATGGTCCCAGCTGCTGG + Intergenic
961204543 3:125071185-125071207 CCACATCTTGCCCCAGTGGCAGG + Intergenic
962713023 3:138103403-138103425 GCAACAGTTGCCCCAGTGGCTGG + Intronic
965714316 3:171586423-171586445 GCAGCTACTGCCCCTGGGGCTGG - Intergenic
967964189 3:194947649-194947671 GCACTTATTGCCCCAGCTGTAGG - Intergenic
968643352 4:1726175-1726197 GCAGCGAGTGCCCCAGAGACAGG + Intronic
972766518 4:42156549-42156571 GCACCTATTGTCCCTTAGCCTGG - Intergenic
975806735 4:78120564-78120586 GCCCCTTTTTCCCCAGAGCCTGG - Intronic
975868430 4:78750692-78750714 GCACATTATGCCCCAAAGGCTGG - Intergenic
984958360 4:185068997-185069019 GCAGCTCTCCCCCCAGAGGCAGG + Intergenic
985627586 5:997864-997886 GCCCCTGTTGCCCCAGAGCCAGG - Intergenic
990747487 5:58974917-58974939 GCACCTGATGACCCAGAGGAGGG - Exonic
993194461 5:84722956-84722978 CTGCCTATGGCCCCAGAGGCAGG + Intergenic
997234301 5:132263890-132263912 GCACCTAAGGCTCCAGAGGCTGG - Intronic
997969203 5:138386415-138386437 ACACCTTTGGCCCCAGAGGTGGG + Exonic
1001397629 5:171428434-171428456 GACCCTCTTGCCCCAGAGTCTGG - Intronic
1005526884 6:26659799-26659821 GCTCCTATTGGCCCAGGGGCCGG - Intergenic
1007744376 6:44034496-44034518 GCACCTCTGACCCCAGAGGGTGG - Intergenic
1011515580 6:88149042-88149064 TCACCTACTGGACCAGAGGCAGG + Intronic
1014594856 6:123322765-123322787 GCACCTATAGTCCCAGCTGCTGG - Intronic
1016072881 6:139761421-139761443 CCAACTATGGACCCAGAGGCTGG - Intergenic
1016441777 6:144091876-144091898 GCACCTGTAGCCCCAGCTGCTGG - Intergenic
1021110212 7:16685252-16685274 GATTCTCTTGCCCCAGAGGCAGG - Intronic
1023222527 7:37934101-37934123 GCACCTATAGTCCCAGCTGCTGG - Intronic
1023567337 7:41536593-41536615 GCATCTATGGCCTCAGAGCCAGG + Intergenic
1023821479 7:43983032-43983054 TGACCTCTTGCCCCAGAGGGCGG + Intergenic
1024090704 7:45937624-45937646 GCACCAAGTGCCACCGAGGCTGG - Intergenic
1026660971 7:72302316-72302338 GCACCTAAAGCCCTAGAGGAAGG + Intronic
1026993532 7:74601309-74601331 GCATCTATAACCCCCGAGGCCGG - Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1032240061 7:130153437-130153459 GCCCCCATGGCCCCAGAGGCCGG - Intergenic
1036012841 8:4747061-4747083 GCAGCTCTAGCCCCAGAGGATGG - Intronic
1037916746 8:22777641-22777663 ACTCCTGTTGCCCCAGAGCCGGG + Intronic
1040877220 8:52166391-52166413 GCCCTGATTGCTCCAGAGGCAGG + Intronic
1041433777 8:57815735-57815757 GCACCGTTTGTCCCAGGGGCAGG - Intergenic
1053351598 9:37417054-37417076 ACACCCACTGCCCCAGAGGCTGG + Intergenic
1053466561 9:38312660-38312682 GGACCAAATGCCTCAGAGGCTGG - Intergenic
1055682708 9:78734303-78734325 GCACCTGTGGTCCCTGAGGCAGG + Intergenic
1055802323 9:80052047-80052069 GCACCTAGACCCACAGAGGCTGG - Intergenic
1059687723 9:116653624-116653646 GCCCCTATTTCCACTGAGGCAGG - Intronic
1060660250 9:125401170-125401192 GCAGCTGTGGCCCCAGAGCCAGG - Intergenic
1061601307 9:131672018-131672040 GCACCTATTGGCCCAGTGAGGGG - Intronic
1185446414 X:260153-260175 GCACCTGTTTCCGCAGGGGCCGG - Intergenic
1188894675 X:35652774-35652796 GGAACTATTCCCCCAGGGGCTGG + Intergenic
1189663270 X:43326509-43326531 GCACCTATACCCCAACAGGCAGG - Intergenic
1190456677 X:50634415-50634437 GCAGCTAGTGGCACAGAGGCAGG - Exonic
1192560915 X:72127409-72127431 GCCCCTCCTGCCCCAGAGGGTGG + Intronic
1194431445 X:93811745-93811767 GCAACTATTGCAACAGAGGAAGG + Intergenic
1196951745 X:120931520-120931542 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196952429 X:120936381-120936403 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953114 X:120941242-120941264 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953799 X:120946102-120946124 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196954484 X:120950963-120950985 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955167 X:120955823-120955845 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955854 X:120960706-120960728 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196956536 X:120965567-120965589 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957218 X:120970427-120970449 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957900 X:120975287-120975309 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196958582 X:120980147-120980169 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196959263 X:120985007-120985029 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1197336792 X:125219028-125219050 CCACATATTGCCCCAGTGGGAGG - Intergenic
1198578241 X:138034970-138034992 ACACTTATTTCCCCAGATGCTGG + Intergenic
1202019133 Y:20446903-20446925 GCACATATTGCTCCTGAGGGAGG + Intergenic